Transposon
Name: TnpCTXM9       (Synonyms: Tn7181)
Family: Tn3
Evidence of Transposition: yes
 Host     

Host Organism:Enterobacter hormaechei strain WCHEH020038 Molecular Source:plasmid pCTXM9
Date of Isolation:2018

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGAACCGCAGAATTCGGAAAAAATCGTACGCTAAG
IRR (Length: 37 bp)GGGGAGCCCGCAGAATTCGGAAAAAATCGTACGCTAA

 Sequence     
DNA SequenceLength  5640 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGAACCG CAGAATTCGG AAAAAATCGT ACGCTAAGCT AACGGTGTTC TCGTGACAGC TCTTTGACTA GGCTTTCTAA GGCCATTCTG ATAGCCCTGA 100
CTTCCTGAAA AGCCATGGCT AAAATTTGTG CGGCTAAAAG GGATAACCGA TGGTAAAGTA AGTTATCCCT GTCGAGATAC TGAAAAGCGT TATCCTCGTT 200
TTTCCCAAAA CTGTTTTGCC AGTTCGCTCA GAGCGCTAGT TAACTGAGCG ACAGATTTCG CACTTTGCAA ATTATTCTGC CCGGTCTGTA CATTGGTATC 300
AGCAGCATCG CGTATATTGA TAATACTGCG GTTTATGTCT TCACTTACTG CTCCCTGCTG CTCGACCGCA GTCGCTATTT GCGCGTTCAT GTCGGTAATT 400
TCGTTAACGC GTTGGCCAAT TCCATCAAGA GCTGTAGCTG CTTCCTCTGC GTGAGCTACA CTCGTGTGCG CTTGCCGACT ACTTTGCTCC ATGACTGTAA 500
CAGCGGATTG CGCTCGCTCT TGTAGAGCGC TGATCATGCT TTGAATATCC GTTGTCGATT GCTGTGTGCG AGCAGCAAGA CTGCGAACCT CATCGGCGAC 600
AACAGCAAAA CCACGCCCCT GCTCACCAGC ACGCGCGGCC TCAATTGCTG CGTTGAGTGC CAACAAATTC GTTTGCTCGG CGATCCCTCG TATAACGTCA 700
AGAACTTTTG ATATCTCGTT ACTTTGACCT TCAAGCTCAT GAATAACCTG AGTGGCTTGC CTAATTTCAC CTTCAAGGGC AGTGATTGAC TGGCTTGTGT 800
GGGCTACCAG ACGCTGGCCA GATGCCGTCT CAGTGTCTGC TCTTCCGGCC GCATCTGCAG CATGCTGTGC ATTGCTCGCA ACCTCTTGAA TGCTTGCCAC 900
CATTTGGTTT ACTGCCGTTG CTATTTGATC TGTCTCTGCC TGCTGCTCAA CTGTAAGTAC ATTGCTTGAC TCAATATCCT TTAGTAGGCC TCGGGTGTGT 1000
TCGCTAAGCC GATTTGATGC ATCACCTATG CGACCTACTA TGGCGCCTGT TTCAGCTTGC ATCATTCGTA AAGCAAACTC TATTTGGCCA AACTCATCGG 1100
TGCGCCCAGT GTAGAGGGAT TGACTTAATG GGTTATTGGA AATATTCCTG GCTCTTTCAA CCAGTCTTCC AAGAGGAGAG AGAATAGCCA AAACACTAAC 1200
AGAGCTTAAG CTTCCTGACA TTAAAGTGGC TAACAATAAG CTGCTTATTG ATGTATCAGT AAGCATGCCG GCAGCCATTG CGCTTGATAT AATACTACCC 1300
CATATGAGCA AGAGTATTTT CACGGAAAAG CTAGCAGCCA ATTTCGGCCT CGCGGCCTTC CCGCTTCTCA ATTGAGCATA TAATTTTTCC GCAGCCAAAA 1400
CCTGCTCAGG TTCAGGCTTG GTCCTTACAG ACTGGTATTC AACAATCGAA CCATTCTTAG CTATTGGCGT TACATAAGCA CTTACCCAAT AGTGGTCGCC 1500
ATTTTTACAG CGATTTTTTA CTAGCCCCAT CCATGAGCGG CCAGATTTTA ATGTACTCCA CATATGCTCA AATGCAGCAG GCGGCATATC TGGGTGTCTT 1600
ACGATGTTGT GAGGCTGGCC TAATAGTTCT TCCTCAGTGA AACCACTGAT TTTAATGAAG TCAGGATTAA CGTACGTGAT ATGGCTTTGA GGGGAGGTAG 1700
TCGAAAGAAT ATTGGCATCT TTTGGGAGTT CTAAGTTTCG ACCCGTCACT GGTAAATTCT GGCGCATAAG AACCTCAAGG GTTGGCTGTT TTATTTTATT 1800
GTTTTCGGCA TTAAGCCCAA TTTCTTGAGC GTTACGATAA AGCTAGCATG GAAACGATAG GTGCAAGCAA GTTAAGGGTT GCATCGCGCA TGTCAATCTA 1900
GGCTATACCC TAACTTGATG TCAGGCAGGG CCGCGCCGCT TCGTCAGAAT AGAGTCTGCT TTCCCATTTT TTGACACATG CCCGCGAAGG TTATAGATTT 2000
CAGCCTGACA GAAATGGGCT TTGAGGCACA ACGGAACAGA AAGTGCACTT AAGCCGCCTT CAACCAAGGA GACATCGTGC AGGGGCACCG CATCGGCTAC 2100
GTCCGGGTCA GCAGCTTTGA CCAGAACCCG GAACGCCAGC TGGAACAAAC CCAGGTGAGC AAGGTGTTCA CCGACAAGGC ATCGGGCAAG GACACCCAGC 2200
GCCCCCAGCT CGAAGCGCTG CTGAGCTTCG TCCGCGAAGG CGATACAGTG GTGGTGCACA GCATGGATCG GCTGGCCCGC AACCTCGATG ACCTGCGTCG 2300
CTTGGTACAG AAGCTGACTC AGCGCGGCGT GCGCATCGAG TTCCTGAAGG AGGGCCTGGT GTTCACTGGC GAGGACTCGC CGATGGCCAA CCTGATGCTG 2400
TCGGTGATGG GGGCCTTCGC TGAGTTCGAG CGCGCCCTGA TCCGCGAGCG GCAGCGTGAG GGCATCGCCT TGGCCAAGCA GCGTGGCGCG TACCGGGGCC 2500
GCAAGAAAGC CCTGTCCGAT GAGCAGGCTG CTACCCTGCG GCAGCGAGCG ACGGCCGGCG AGCCCAAGGC GCAGCTTGCC CGCGAGTTCA ACATCAGCCG 2600
GGAAACCCTC TACCAGTACC TCCGCACGGA CGACTGACAC ATGCCGCGTC GCTTGATCCT CTCGGCCACG GAGCGGGACA CCCTGCTTGC GCTGCCGGAA 2700
AGCCAGGATG ACCTGATCCG CTACTACACC TTCAACGACT CCGACCTGTC GCTGATCCGC CAGCGACGCG GCGACGCCAA CCGCCTCGGC TTCGCCGTGC 2800
AGCTCTGCCT GCTGCGCTAC CCCGGTTACG CGCTGGGAAC CGACAGCGAG CTGCCCGAGC CGGTCATCCT GTGGGTGGCG AAGCAAGTCC AGGCCGAGCC 2900
GGCGAGCTGG GCAAAGTACG GCGAGCGCGA CGTGACCCGT CGCGAGCATG CCCAGGAACT GCGCACCTAC CTGCAACTGG CCCCGTTCGG CCTGTCCGAC 3000
TTCCGCGCCC TGGTGCGCGA GCTAACCGAG CTGGCCCAGC AGACCGACAA AGGCTTGCTG CTGGCCGGTC AGGCCCTGGA GAGCCTACGG CAGAAACGAC 3100
GCATCCTGCC GGCGCTGAGC GTGATTGACC GGGCCTGCTC GGAAGCCATT GCGCGAGCCA ATCGGCGGGT CTACCGCGCC CTGGTCGAAC CACTCACGGA 3200
CTCGCATCGG GCCAAGCTGG ACGAGCTGTT GAAGCTCAAG GCCGGCAGCA GCATCACCTG GTTGACCTGG CTGCGCCAGG CACCGCTGAA ACCCAACTCT 3300
CGGCACATGC TGGAACACAT CGAGCGGCTG AAGACATTTC AGTTGGTGGA CTTGCCCGAA GGCCTGGGCC GGCACATCCA CCAGAACCGC CTGCTCAAGC 3400
TGGCCCGCGA GGGTGGGCAG ATGACGCCCA AAGACCTCGG TAAGTTCGAG CCGCAGCGCC GCTACGCGAC CCTGGCCGCC GTGGTGCTGG AGAGCACCGC 3500
GACCGTGATC GATGAGCTGG TCGATCTGCA TGACCGCATC CTGGTCAAGC TGTTCAGCGG CGCGAAGCAC AAGCATCAGC AGCAGTTCCA GAAGCAGGGC 3600
AAGGCGATCA ACGACAAGGT GCGCCTGTAC TCCAGGATCG GCCAGGCGCT GCTGGAAGCG AAGGAAAGCG GCAGCGACCC CTATGCCGCC ATCGAGGCGG 3700
TGATTCCCTG GGACGAGTTC ACCGAGAGCG TCAGCGAGGC CGAGCTGCTG GCCCGGCCGG AAGGCTTCGA CCACCTGCAC CTGGTCGGCG AGAACTTCGC 3800
CACCCTGCGC CGTTACACGC CGGCCTTGCT GGAGGTGCTG GAACTGCGCG CCGCGCCGGC CGCGCAAGGC GTGCTGGCAG CCGTGCAGAC CCTGCGTGAG 3900
ATGAACGCCG ACAACCTGCG CAAGGTGCCG GCCGATGCAC CCACGGCCTT CATCAAGCCG CGCTGGAAGC CGCTGGTGAT CACCCCGGAA GGCCTCGACC 4000
GGAAATTCTA CGAAATCTGC GCCCTGTCCG AGCTGAAGAA CGCCCTGCGC TCCGGCGACA TCTGGGTCAA GGGCTCGCGG CAGTTCCGCG ACTTCGACGA 4100
CTACCTGCTG CCGGCCGAGA AGTTCGCCGC ACTCAAGCGC GAGCAGGCCC TGCCCCTGGC GATCAACCCG AACAGCGACC AGTACCTGGA AGAGCGTTTG 4200
CAGCTGCTGG ACGAGCAGTT GGCCACCGTC ACCCGCCTGG CCAAGGACAA CGAGCTGCCC GATGCCATCC TCACCGAGTC AGGGCTGAAA ATCACCCCGC 4300
TGGATGCGGC GGTGCCGGAT CGGGCGCAGG CGCTGATCGA CCAAACCAGC CAGTTACTGC CGCGCATCAA GATCACCGAA CTGCTGATGG ACGTGGACGA 4400
CTGGACGGGC TTCAGCCGCC ACTTCACCCA CTTGAAGGAC GGGGCCGAGG CCAAAGACAG GACGTTGCTG CTGTCCGCAA TCCTCGGTGA TGCGATCAAC 4500
CTCGGGCTGA CCAAGATGGC CGAGTCGAGC CCCGGCCTGA CCTACGCCAA GCTGTCCTGG CTGCAAGCCT GGCACATCCG CGACGAAACC TATTCGGCGG 4600
CCTTGGCCGA GCTGGTCAAC CACCAGTATC GCCACGCCTT TGCCGCCCAC TGGGGCGACG GCACGACCTC ATCCTCCGAT GGCCAGCGCT TCCGCGCGGG 4700
TGGCCGGGGC GAGAGCACCG GGCACGTCAA CCCGAAGTAC GGTAGCGAGC CGGGACGGCT GTTCTATACC CATATCTCCG ACCAGTACGC GCCGTTCAGC 4800
ACCCGCGTGG TGAATGTCGG CGTCCGCGAT TCCACCTATG TGCTCGACGG CCTGCTGTAC CACGAGTCCG ACCTGCGGAT CGAGGAGCAC TACACCGACA 4900
CGGCCGGCTT CACCGATCAC GTCTTTGCCC TGATGCACCT GCTAGGCTTC CGCTTCGCGC CGCGCATCCG CGACCTCGGC GAAACCAAGC TGTACGTGCC 5000
GCAGGGCGTG CAAGCCTACC CGACGTTGCG CCCGCTGATC GGCGGCACCC TGAACATCAA GCACGTGCGT GCCCACTGGG ACGACATCCT GCGCCTGGCC 5100
AGCTCGATCA AGCAGGGCAC CGTCACCGCC TCGCTGATGC TGCGCAAGCT CGGCAGCTAC CCGCGCCAGA ACGGACTGGC CGTGGCCCTG CGCGAGCTGG 5200
GCCGGATCGA GCGCACGCTG TTCATCCTGG ACTGGCTGCA AAGTGTTGAA CTGCGCCGCC GCGTGCATGC CGGCCTGAAC AAAGGTGAGG CGCGCAACTC 5300
GCTGGCCAGG GCGGTGTTCT TCAACCGCCT TGGGGAAATC AGGGATCGGA GCTTCGAGCA GCAGCGCTAC CGGGCCAGCG GCCTCAACCT GGTGACGGCG 5400
GCTATCGTGC TGTGGAACAC GGTGTACCTG GAACGCGCCA CCCAGGGGTT GGTCGAGGCC GGCAAGCCGG TGGACGGCGA GCTGCTGCAA TTCCTGTCGC 5500
CGCTGGGCTG GGAGCACATC AACCTAACCG GCGATTACGT CTGGCGGCAG AGCCGCAGAC TGGAAGACGG GAAGTTTCGG CCCTTACGGA TGCCCGGAAA 5600
ACCTTAGCGT ACGATTTTTT CCGAATTCTG CGGGCTCCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res_site_I 1886-1925 40 GCGCATGTCA ATCTAGGCTA TACCCTAACT TGATGTCAGG
res_site_II 1938-1981 44 GCTTCGTCAG AATAGAGTCT GCTTTCCCAT TTTTTGACAC ATGC
res_site_III 1985-2015 31 CGAAGGTTAT AGATTTCAGC CTGACAGAAA T

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
mcp TnpCTXM9 190-1767 Passenger Gene Other -
tnpR TnpCTXM9 2077-2637 Accessory Gene Resolvase +
tnpA TnpCTXM9 2641-5607 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
mcp Mcp TnpCTXM9 1578 190-1767 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   methyl-accepting chemotaxis protein
Protein Sequence:  
MRQNLPVTGR NLELPKDANI LSTTSPQSHI TYVNPDFIKI SGFTEEELLG QPHNIVRHPD MPPAAFEHMW STLKSGRSWM GLVKNRCKNG DHYWVSAYVT
PIAKNGSIVE YQSVRTKPEP EQVLAAEKLY AQLRSGKAAR PKLAASFSVK ILLLIWGSII SSAMAAGMLT DTSISSLLLA TLMSGSLSSV SVLAILSPLG
RLVERARNIS NNPLSQSLYT GRTDEFGQIE FALRMMQAET GAIVGRIGDA SNRLSEHTRG LLKDIESSNV LTVEQQAETD QIATAVNQMV ASIQEVASNA
QHAADAAGRA DTETASGQRL VAHTSQSITA LEGEIRQATQ VIHELEGQSN EISKVLDVIR GIAEQTNLLA LNAAIEAARA GEQGRGFAVV ADEVRSLAAR
TQQSTTDIQS MISALQERAQ SAVTVMEQSS RQAHTSVAHA EEAATALDGI GQRVNEITDM NAQIATAVEQ QGAVSEDINR SIINIRDAAD TNVQTGQNNL
QSAKSVAQLT SALSELAKQF WEKRG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnpCTXM9 561 2077-2637 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MQGHRIGYVR VSSFDQNPER QLEQTQVSKV FTDKASGKDT QRPQLEALLS FVREGDTVVV HSMDRLARNL DDLRRLVQKL TQRGVRIEFL KEGLVFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKALSDEQ AATLRQRATA GEPKAQLARE FNISRETLYQ YLRTDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnpCTXM9 2967 2641-5607 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRLILSAT ERDTLLALPE SQDDLIRYYT FNDSDLSLIR QRRGDANRLG FAVQLCLLRY PGYALGTDSE LPEPVILWVA KQVQAEPASW AKYGERDVTR
REHAQELRTY LQLAPFGLSD FRALVRELTE LAQQTDKGLL LAGQALESLR QKRRILPALS VIDRACSEAI ARANRRVYRA LVEPLTDSHR AKLDELLKLK
AGSSITWLTW LRQAPLKPNS RHMLEHIERL KTFQLVDLPE GLGRHIHQNR LLKLAREGGQ MTPKDLGKFE PQRRYATLAA VVLESTATVI DELVDLHDRI
LVKLFSGAKH KHQQQFQKQG KAINDKVRLY SRIGQALLEA KESGSDPYAA IEAVIPWDEF TESVSEAELL ARPEGFDHLH LVGENFATLR RYTPALLEVL
ELRAAPAAQG VLAAVQTLRE MNADNLRKVP ADAPTAFIKP RWKPLVITPE GLDRKFYEIC ALSELKNALR SGDIWVKGSR QFRDFDDYLL PAEKFAALKR
EQALPLAINP NSDQYLEERL QLLDEQLATV TRLAKDNELP DAILTESGLK ITPLDAAVPD RAQALIDQTS QLLPRIKITE LLMDVDDWTG FSRHFTHLKD
GAEAKDRTLL LSAILGDAIN LGLTKMAESS PGLTYAKLSW LQAWHIRDET YSAALAELVN HQYRHAFAAH WGDGTTSSSD GQRFRAGGRG ESTGHVNPKY
GSEPGRLFYT HISDQYAPFS TRVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG ETKLYVPQGV QAYPTLRPLI
GGTLNIKHVR AHWDDILRLA SSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNSLAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERATQGLVEA GKPVDGELLQ FLSPLGWEHI NLTGDYVWRQ SRRLEDGKFR PLRMPGKP