Transposon
Name: TnXo19       (Synonyms: Tn7217)
Family: Tn3        Group: Tn4651
Evidence of Transposition: yes
 Host     

Place of Origin:China Date of Isolation:2015

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 47 bp)GGGGTTCAGCCGACATACGTGTAAAAATAGCTCACAGAATTCTATTT
IRR (Length: 47 bp)GGGGTTCGGCCGACATACGTGTAAAAATGGCTCACAAAATCGGATTT

 Sequence     
DNA SequenceLength  18767 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTTCAGC CGACATACGT GTAAAAATAG CTCACAGAAT TCTATTTTCT TCTTTAAATC ATATGGTTGG CAGATAAAAC TGCTCTCTCT AGACTGTATT 100
TAGCTTGGCG CTTGGGATGG CCGGGCTCGT CTGGTTGGGG CGAAAGCTAT CCCAGATGCG CGCCTTCGAA CGGGGCGATC TGGAGTCCGA GACCCGCAGC 200
AGACAGGCCG GCAGGATGAA TTATGAGCAA ATTCATAATT ATGATTTTCA TCATAATCAA CCATAAAGAG CTCCAGCTGT AGCTCCTGGA GGACGGGCCA 300
TGGGTGCCTC GTTGGAGCGT CATCCCTCCT ATGTCAGCCT GTCCGGGTTG TTTCTGCACG TTCTGGAGCG GGTCCCCAAG GTCGGCGACA CGGTCCCGTG 400
GCTGGATGTT GCAGGTGGTG ACCCTGGAGC GCCGGCCCGC GGGCAAGGCG CGGCTGTCAT CGATTTGACT TGGCGCGGCT GCTCACGTGG TCCGGCGCAC 500
TTGAGGGCAC CATCAGCCCT AAACGATACA AATTGCTCGC CATCCCAGTC TGCCGCTTAT TGACACACCT TCCCAGTTTT CCCCTAAGCT AGTGCCATGC 600
TCCGCCCTTC GGCCACCGTC GCTTCGCTCC TGCGTACCAG CCTCTTTGTG CTGCTGGTGC TTGGAGCATT GGTGCGACCG ATGCTGAACT TGGTCGGCGA 700
TCTTCATGCC GATGAGCACG CGGTAGTGGC TGCTGCCGAG CACGGCCACC ACCATCCGGG CGAGCAAGAT GAGCGTGCCG ACCCTGATCA TACCAAGGGG 800
TTTCATGGCT TGCTCCACCA GGCGGACGCG CATGCGGCCG CCACCTTGTG GAATGCGTGG AGTTGGGGCG CGTCGCTCGC ACCTGCCCTT GAAGGGCCGA 900
CCATGGACGT GCTCTGGCAG CCTTCGCATC AGCCTACGTC TCCTTTCCGA CCTCCGATCG TCTGACGCAC CGGGCCGCTG TCTAGCGGCC CGCTCGGTGC 1000
TGCCCGCGCC TTCGCGGGTG GCGTTGCCAT GCGTCGACTT TACGGAGAGA TCCCGTGACT TTACGTTGTC TGTGGGTGCT GGCGTTTGCC TGTGCCTGTG 1100
GCGTCGTTCC CTATGGGCAC GCCGCCGAAC CATTGCGCCT GGAGGAAGCG GTTGCCCGCG CCCTGCAGGC GAACCCGGCC ATACAGGCTG AAACCGCTCG 1200
TCTGGAGGCA GCGCGCAACC GGGCCAGTCG AGAGGCGCTA CCAACGCCGT ACGTGATCGG TGGCGAACTC GAAAACGTCG CTGGGACCGG CAGTCTCAGC 1300
GGCGCGACCT CGGCTGAAAC AACACTGCGC ATTGGCCGCG TGCTGGAATT GGGAGGCAAG CGAGCAGCCC GCGAGGCCCT GGGCAGAGCC GAGGTCAGCC 1400
AGCAAGGCAA CGCGGCCGAC GTGGCGCAGC TGGAGGTCAC CAGCAGCACG GCGCTACGCT TCATCCAGGT GGTGGCCGAC CAGGAACACA TCGAGCACGC 1500
CGATGAGCGA GTGCAGCAGG CCGAGCGTAC CCGCCGCGAA GTAGCGCGCT GGGTGCAGGC CGCCCGCAAC CCGGATTCGG ATCTGCGGGT GGCCGAAATC 1600
GCGCTGACCG ACGCCGAACT GGAACGTGAG CAGGCTGGGC AAGCGCTGGT CGCGTCGAAG GCGCGCCTGG CGGCCTCTTG GGGTGCCTTT GCACCCGATT 1700
TCGAACGTGT CGCTGCCGAT TTGGACACGC TGCCCGCGCT CGGCGACTTC GATGCGCTCG CGGCGCGCCT GCCGGCGACG CCGGAGCAGC GGGCCGCCGA 1800
GCTGGAAGCG CAGACCATCG CTGCGCGGCG GCGTGTCGCC GTGACCAGCG CCAAACCCGA CCTCAACGTG AGCCTGGGTG TCAGGCGGCT CGAAGCCACC 1900
AATGACCAGG GGCTGGTCAT GTCGGTCTCG GTACCGCTAG GCAACCGCCG GCGCTCGGAC TACTCCGTTG CCGAAGCCGA CGCAGACCTG AGCGCGCTGA 2000
AGGCCCGCAC CGAAGCCACG CGCATCGAGC GTCGCCAACA GTTGTTCGAC CGCTATCAGG CGATGCAGCA AGCGCAGTCC GAGGTGACCT CGCTGCGCCA 2100
GCGGATGTTG CCCAAGGCCG AGGACGCCGT GCGTCTCACC CGACGCGGTT TTGAGGCCGG TCGCTTTTCG TTCCTGGCGC TCATGCAAGC GGAAAAAACG 2200
CTGTTCGATC TGCGCGAGCG CCAGGTCGAC GCCGCCGCCC GCTACTACAC CTTGCTGGTC GAGGTCGAAC GCCTCACCGC CCCTGTCTCG GATCGCATCC 2300
CATGAAGCGC TACGCACTTA TCATGTTGTT TCCGCTCCTG CTCAGCGCCT GTGGCGGCGA ATCGTCGGCC GATAAGAAGG CTGGCGAGGT CCAAGGCACC 2400
GAACAAGCCG CCGCGGACTA CGAACGTGGC CCGCATCGTG GCCGTATGCT GCGCGATGGC GACTTCGCGC TGGAAGTGAC GGTCTACGAG ACCAACACGC 2500
CACCGCATTT TCGCCTGTAC GCCTACCGCA ACGACAAGCA GATAGCGCCA GCCGAGGTGA CACCCACCAT CATGCTCAAG CGCCTTGACG GTGAGGTCAA 2600
CACGTTCGCG TTCAAGCCGG AGAAGGACTA TCTGGCCGCC ACTACCGAGG TCGTCGAGCC GCACTCCTTC GACGTCAAGG TCACCGCAGC ATCGGCAGGC 2700
AAATCGCACC ATTGGTCGTA CGCCTCCTAC GAGGGTCGCA CCACGATCGA TCCGCAGGCC GCCAAGGACG CCGGTGTGGC GGTCGAGACC GCCGGCGCTG 2800
CCACGATTCG CGACACCGTG CAGCTAATGG GCACGATCGC CGTCGACGCA AACCGGTTCG CGGCCGTCAA GGCCCGCTTT CCCGGCATCG TGCGCAACGT 2900
ACCGGTGCAG GTGGGCCAGC GCGTTTCCGC TGGCGCGACT CTGGTCACCA TCGAAGGCAA CGACAGCATG CGCACCTATG CTGTAACCGC GCCATTCGAT 3000
GGCATCGTGA TCGCGCGCAA CACCAACGTG GGCGATTTCG CTGGGGACAA TACGTTGGTC GAGTTGGCCA ACCTGGCGCA GGTGTGGGTG GACCTGCGCG 3100
CCATCGGCAC CGACGCTGAA CGGCTGGCGC CAGGCCAGTC GGTCACTGTG CGTTCTGCCA CCAGTGGTGT GGAGAGCGAT GCGAAAGTGG TCTCGCTGCT 3200
GCCACTGGCC ACGGCAGGCC AGAGTGTGAT CGCGCGTGTC AGCCTGCCCA ATCCTGAAGG CAAATGGCGG CCCGGCATGA CGGTATCGGC TGAGGTGACG 3300
GTGGCCTCGG ACGAAGTGCC ATTGGCGGTG AAGGAATCCG GACTGCAGCG CTTTCGCGAC TTCACCGTGG TGTTTGCGCA GGTCGGCGAC ACCTATGAGG 3400
TGCGCATGCT CGAATTGGGT CGACGCGACG GCCACTACGC CGAAGTACTC GGCGGCCTGA AGCCCGGCGC GTCTTACGTT TCCGAGCAGA GCTACCTCAT 3500
CCGCGCGGAC ATCGAAAAGT CCGGCGCCAG CCACGATCAC TGAGGACGCG CCATGCTAGA GAAAATCATA CGGGCGTCCA TCGCACACCG ATGGCTGGTC 3600
CTGCTGCTCG TGCTCGGATT GTCCGCGCTT GGCATCTGGA ACTACAGCCG CCTGCCCATC GATGCCGTGC CGGACATCAC CAACGTCCAG GTGCAGATCA 3700
ACACCGAAGC CCCGGGCTAT TCGCCGTTGG AGGCCGAACA ACGTGTCACC TTCCCGGTGG AGACCGCGCT GGCCGGCTTG GCGAAGTTGG AATACACCCG 3800
CTCGATCTCA CGCTATGGCT TGTCTCAGGT CACCGTGGTG TTCGAGGACG GCACGGACAT CTACTTCGCG CGCCAGCAGG TCGCCGAGCG TCTGCAACAA 3900
GCCGCCTCCG CGCTGCCCGA GGGATTGGAG CCGTCACTGG GTCCGGTCGC CACGGGTCTG GGCGAGATCT TCATGTACAC CGTGGAAGCC GAACCGGGTG 4000
CCGAGCAAAC GTGGACACCG AAGGCCCTGC GTACCTTGCA GGACTGGGTG GTGCGGCCGC AGATGCGCCA CCTCAAGGGC GTCACCGAAG TCAACACGGT 4100
CGGTGGTTAT GTGCGCCAGT TCCACATCAC CCCGGATCCA ACCAAGTTGC AGGCGTATGG CTTGACGCTG CAGGACGTAC TCGATGCGGT CGGACGCAGC 4200
AATGCCAACG TGGGGGCTGG CTACATCGAG CGCGCGGGCG AACAATACCT GATCCGCGTG CCTGGCCAGG TGACTGGCAT CGACGGGCTG CGCAAGATAG 4300
TCGTGGCCAC CCGCGACGGC CTGCCCTTGC GCATCGGCGA TGTGGCGCAG GTGCTGGAAG GCAGCGAGCT GCGCACCGGC GCGGCCACCA AGGACGGCAA 4400
GGAAGTGGTG CTGGGCACGG CGTTCATGCT GATCGGCGAG AACAGTCGCG AGGTCGCGCA GCGCACTGCG GCCAAGCTCC AAGAGATCGA CAAGACCCTG 4500
CCGGAAGGTG TCCGCGTGCA TCCGGTCTAC GATCGCACCG AACTGGTCGA CCGCACCATC GAAACGGTGC GCAAGAATCT GCTCGAAGGC GCACTGCTGG 4600
TGATCGTGGT GCTGTTCCTG TTGCTGGGCA ACCTGCGCGC CGCCCTGATC ACGGCCGCCG TGATCCCGCT GACAATGCTG CTGACCATCA GCGGGATGGT 4700
GCAGAACCGG GTGTCGGCCA ACCTGATGAG CCTGGGCGCG TTGGACTTCG GTCTGATCGT CGACGGCGCA GTGATCATCG TCGAGAACTG TCTGCGCCGC 4800
TTCGGCGAGC GCCAGCATGC GCTTGACCGA CTGCTCACGC GCCAGGAGCG CTTCGAACTG GCCGCCAGTG CGAGCACCGA GGTGATCACG CCCAGCCTGT 4900
TCGGTCTGTT CATCATCGCC GCGGTGTACA TCCCGATCTT TGCGCTCTCC GGGGTTGAAG GAAAGATGTT CCATCCGATG GCGTTGACCG TCGTGATCGC 5000
CCTGACCGGC GCGATGATGT TGTCACTCAC CTTCGTTCCA GCGGCGGTGG CGCAATTCGT CACCGGAAAG GTGTCGGAGA AGGAAACGCG GGCGATGCGC 5100
AGCGTGAGCC GCTTCTACGC TCCGCTATTG GACAAGGTGA TGCATGCGCG CAGTTGGGTA GTCGCAGGTG CCGCCGTCTT GACGGTGCTG GCCGGCCTGC 5200
TTGCCAGCCG CCTGGGCACC GAGTTCATCC CCAATCTGGA CGAAGGCGAT ATCGCGATGC ACGCGCTGCG CATCCCCGGA ACCAGTCTGA GCCAGGCCAT 5300
CGGCATGCAG CGGCAATTAG AAGCGCGTAT CAAACAGTTC CCGGAAGTGG ACGAGGTGGT GGCCAAGATA GGCACTGCGG AAATCGCCAC CGATCCGATG 5400
CCTCCCTCGG TCGCCGACAC CTTCATCATG CTCAAGGACC GCAGCCAATG GCCGGATCCG CGCAAGTCGA AGGTCGAGTT GGTCGCTGAG CTGGAAAAGG 5500
CCGTCCGCGC CATCCCCGGC AATAACTATG AGTTCACCCA GCCGGTGCAG ATGCGCATGA ACGAATTGAT CGCCGGCGTC CGTGCCGAGG TCGCGATCAA 5600
GCTCTACGGC GATGACCTCG AACAGCTGAC CGCCATCGGC GGACAGATCG AGAAGGTCGC CAGCACCATC GATGGTAATG CCGACGTCAA GCTTGAGCAG 5700
GTCACTGGGT TGCCACTGAT GACCATTACG CCCGATCTAG ATGCATTGGC CCGTTACGGC ATCTCCGTCC AGGACATGCA GCAGACGATC TCGGTGGCAA 5800
TGGGCGGAAA GAGCGTGGGC CAAGTATTCG AGGGCGATCG CCGTTTCGAC ATCGTGGTGC GGCTGCCCGA GATGATGCGT CAGGATCCCA GGACCCTGGC 5900
CTCCTTGCCA GTCGCGGTTC CCGCCGCTGG CGAGGGTGGC CGCATCTATG TCCCGCTAGG TCAGTTGGCC AGGGTGGAGA TCGCTCCCGG TCCCAATCAG 6000
GTCAGCCGCG AGAACGGCAA ACGGCGCGTG GTCATCACCA GCAATGTGCG TGGACGCGAC CTGGGCTCGT TCGTGCAAGA ACTGCGCGAG CGCGTCGCCC 6100
AAGAGGTGAC GATGCCGGAA GGCTACTGGG TCGAGTACGG CGGCACGTTC GAGCAGTTGA TGTCGGCCAG CAGGCGTTTG TCCGTGGTGG TGCCGGTGGT 6200
GTTGGTGATG ATCTTCGGCC TGCTGTTCAT GGCCTTCGGC TCCGGCAAGG ATGCGGCCAT CGTGTTCAGT GGCGTCCCGC TGGCATTGAC CGGTGGCGTT 6300
CTGGCATTGG CGCTTCGCGG GATTCCGTTG TCGATCTCGG CTGGCGTGGG CTTCATCGCG CTGTCCGGCG TGGCGGTCCT CAACGGCTTG GTCATGATCA 6400
GCTTCATCCA CAATCTGCGC CAGGAGGGGA TGCTCCTGGA ACCGGCGATA CGTGAAGGCG CACTCACCCG TCTGCGGCCG GTCCTGGTGA CTGCGCTGGT 6500
GGCCAGCCTG GGTTTTCTGC CAATGGCCAT GAACGTCGGC GCCGGCGCCG AGGTCCAGCG GCCGCTGGCC ACCGTGGTCA TTGGCGGCAT CGTGTCATCG 6600
ACCCTGTTGA CCCTGCTGGT GTTGCCGGCG TTGTACCGGC TGGTGCATCG CAGTGCCGCG AGCACACATG GGGAGCGTGC ATGAAAGCTC CTCACGTTTC 6700
CTCAATGAAG GTGGTTCTCT TGCGCCTCTG GCAAAAGCCT GTTGCTGCAT TGGCGATGCT GGCCATGTCC CTGGTATCGG CCGCGGCGAT CGCCCATGGC 6800
GTCAGCGAAG GCGACCAAGC CTTCCTGGAA GATAGCTCGG GCCCACAGCT GGTGGCGTTC ACCTACTTGG GCGCCAAGCA CATGTTCACC GGTTACGACC 6900
ACCTGCTGTT CCTGTTGGGC GTGGTGTTCT TCCTGTATCG CATGAAGGAT GTCGGCATCT ACGTGACGTT GTTTGCCGTC GGCCACAGCA TCACGTTGTT 7000
GATGGGCGTG CTGGGCGGCT TCCACGTCAA CCCGTACATC ATCGACGCCA TCATCGGTTT GTCAGTGGTG TACAAGGCGT TGGACAACCT TGGAGCGTTC 7100
CGGCGCTGGT TGGGCTTCCA GCCCAACAAC AAGGCTGCCG TGCTGATCTT TGGCCTATTC CATGGACTGG GTCTGGCCAC CAAGCTGCAG GATTTTTCGC 7200
TGTCGCCAGA TGGTCTAGTC GCCAACATGA TCGCCTTCAA TGTCGGTGTC GAAATCGGCC AGCTGCTGGC GCTGGGGGCA ATCCTGCTGG TGATGGGCTT 7300
CTGGCGGCGC TCGCCGCTGT TCGCCCGGCA GGCTTTCGGT GCCAACACCC TCCTCATGTC GGCCGGTTTC CTGTTGATCG GCTATCAACT CACCGGCTAC 7400
TTCGTTTCCT GATCGAGAAA TTCATCATGT CCATTACCTT GAACCAGCCG CTCCCGAGCA CGGCTCGTCT GTTGCGTGCA ACTTTACTCG CTGCAGGCGT 7500
GGCTGCCGTG CTCCTCGTCA CCGTGGTGAT GCCCGCTGAA TACAACATCG ATCCGCTGGG CACTGGTCGT CTTCTGGGCC TGACCAAGCT CAGCGTGTCT 7600
TCGACCGAGG CGGAAACTGC CGCATCGCCG GCGCCTCTCA TGCCTGCCGC GCCAGGCGAC CACAGCGAAG CGAACATTCT GCTCGCGCAG AAGGCCAAGA 7700
CGGCCTTCGG CGAGAACAAG GGACAGACGC TCGACGCAGC CGCCACCGCG CTCACGAACG GCGATCTGCG CCGCGACACG CTGTCGGTGA CGCTGCCGCC 7800
AGGCAAGGGG GCCGAGATCA AGGCGCACCT CAAGCAGGGC GCCGGCGTGG TGTATCGATG GAAGGCCAGC GGCGACGTGG CCGTCGACAT GCATGGCGAG 7900
CGCCCCGACG TGAAAGGCGC CTGGACCAGC TATTCCGTCG AAGCGGCACA GCGGCAGGCC GAAGGCACCT TTATCGCACC GTTCGACGGT ACGCACGGCT 8000
GGTATTGGCA GAACCGCACA GCCCAGCCCG TCGATGTCGC AGTCGAGGTA GTGGGTTTCC AGGCCGATCT GTACCGCCCC TGATGTTTTT CCCTGGCTGA 8100
GTTTTCCCAA TGCGGCCGTC GTGCCGCCCA ACTGGAGTTG TCACATGAAG ATCCGTCGCG TCCTGCTGGC TGGCGTTGTT GGTGCCGTCT CGAACGTCGC 8200
GTTCGCCCAC GATCCGAGCC TGCACGAGCC GGTCGAGAAG AAGCCGAAAC CGACCACCTG CGAACACCTG TCGCAGCCCG GCAAGTATCA GATCGACCTG 8300
TCCGATGCTG ACACCAAGGC CTTGAAGGCC TCGTGCGATG CAAGCAAGCA GAAAGCCAGC AAGAAGTAAG CTGATGCGCT GCGACGGTCC CAGCCGACTG 8400
GGACCGTCGC AACGGATTGC TTCCATGCCA TCACAGCGAA TACGCCCATG ATCGAAGTTC TCAGCAATTC CGTTTTTCGC CGACTGTTTG TCGCGCAGGT 8500
CGTAGCACTG GTCGGCACTG GCTTGGCCAC GGTCGCGCTG GCGTTGCTGG CTTATGACCT TGCGGGCGCC CAAGCGGGCG CAGTGCTAGG TACGGCCTTG 8600
GCAATCAAGA TGATGGTGTA TGTCACGCTC GCCCCCGTTT CGGCCGCTGT CGTACCGCCT TCTTTACGCA AACCGGCGCT GATCGCACTG GATTTGATCC 8700
GGGCCGCCGC AGCGCTGTCT CTCCCGTTCG TCACTGCGGT CTGGCAGGTC TACATCCTGA TCGCCCTGTT GCAATCCGCC TCGGCATGTT TCACACCGTT 8800
GTTCCAGTCG TTGATTCCCG AGATACTCAA AGAGGAGCGC AAATACACCC GTGCGCTCTC GCTCTCACGC TTGGCTTATG ACCTGGAGAG CCTGCTCAGC 8900
CCCGCGCTTG CCGCAGCGTT GTTGACGCTA ATCAGCTTCC ACGGCCTGTT CGTCGGCACG TCGGCGGGCT TTGTGCTGTC CGCGCTGCTG GTGCTGTCAA 9000
CGACCTTACC CCTGATTGCA GACAAGCGTG GCGAGGAGGG GCCGTACGCG CGCGCCATTC GCGGGATGCG GATCTATCTG CGTACACCGC GGTTGCGCGG 9100
GCTGCTGGCG CTGAATCTGG TCGCTGCGGC AGGTGGCGCG ATGGTCTTCG TGAACACCGT GGTGGTGGTC CGCAGCGTGT TGCATGGCGG CGACCGCGAG 9200
GTGGCCTGGG CGCTGGCCGC GTTCGGCGCA GGCTCGATGC TGGTCGCCTT GCTGTTGCCT AGGGTACTCG ACCGCGTGCC GGACCGGCGC GTCATGCTCG 9300
GCGCGGCAGC GGCAATGTGC GGGATCCTGG TGACTCTGCT TGCCGCCTGG CTCGCCGAAC GGGGCGCCAT CGGCTGGGCC GTACTGCTCC CAGTCTGGAC 9400
TTTGCTTGGT ATGGCCTATG CGGGGCTGGT GACTCCCGGT GGCCGACTGC TGCGCCGCTC GGCCGAGTCC GCGGATCTTC CCTTCCTATT TGCCGCGCAG 9500
TTCTCTCTGT CGCATGTCTG CTGGCTTATC GCGTACCCGC TGGCCGGAGT GGTTGGTGCA CGTTTGGGTA TGCCGGTGAC GATCGCAGCA TTGAGCGTCC 9600
TGGCGCTGGC TGGTGTGATC GTCGCGTGGC GCGTCTGGCC CAAGCATGAT CCGGATGAGC TAACGCACCG TCACGACGAT CTTCCAGAGG ATCATCCGCA 9700
CTTGATCGAG CATCGTGCCA GCAACGGCGG CCATCGCCAT CGATACGTGA TCGATCCATT GCACGAGCAC TGGCCGCAGT AGCGAGCCAG TGAAGTAGAG 9800
CGTACATCGT CACTTCTGCT GCAACGGCGG GGTATCTGAT CGGAGTTTGG CCTACATAGG GATAGGGTAT ACTGACCACA TGGCATGCCT AAGCCAGCTC 9900
GACTATCGAA TACCGGCGTG ATCGCATCGA TCGATCACGC CCCTGTTGCT CATGTTGGTC AGAGCGCCGG CCTTATACCC CGGTGAGAGC ACGCGCCAGA 10000
TAAGCGCGTA CACGTCGGTT CGATTCCGAC CAGGGGCACC ACCTTCAGCG ACGAAAGAAC GCTTCAACTT GCGCGCCATG GCAGCGCTTG TACTTGCTGC 10100
CGCTGCCGCA CAAGCACGAC GTATGCTCGC GCAGTCCCGC ACCGAGTGAC TGGCCCAGGA AGTCCCTCGC CTGCAGAAGT GGTTGGATCT CATCGGCGGG 10200
AATGCTGAGG TGTCCGTACT GGGAAACCCG CTCGCCGCGG TTCATGACCC GGACGATCGC CTCGGACATC TGGATGAAGT GCCTGATCAG CAGATCGTCG 10300
CGTAGCGGCA TACGGACGTT GTCGATGGCC AAGCCCTCGT AGCGTCTGCG CGGATCCGGG ACGAACAGAA TGCGTGTCTC ACCTTCGGGC TTTGGCGTGA 10400
TGTCGACCAT TTCTCTGGCC GGGCTGACCC ACACGGCATG AAACTCCGCC TCCACCAGCA CGTGCGGCCA CTCCCACAGC TGCCAACCGC ACAGCATCTG 10500
GCCACCGTCG CGGGCGATCT TGGCTTGCAC GTTCGGAAAG CACTCATGGA CGATCGCATC GGCTTCCGGC TGAACACTAA GATAGACCGG CTCCGCGCCG 10600
CGCACGACCG AATCGGTCAA GCGCCGCACC GCGCGGGTGA TTTCCGGCGG TGTCGTCGTT ACTGCTCTCA TGGCAAAGCT CCTCGCGATC GTTGCGCCTG 10700
ATGTTCTCTG ACGTAGGCTA CGGCGCCGGC GTCTCTTCCG ATGAGATTCT CTTGGAGTTT TTGCCGCCGG TACTGGCCGG CTGTAGCTGG GCCAAAAGCG 10800
GCTCCAGGGT GCTCAGACGC ACCGTGGCGC GCAGCGTGTC GGCCTCTGCG TGCTCGCGTC GTTCGCGCTC TTGGGTCAGA TCGGCCCGGG CTTGGGCGAG 10900
CTCTTGTCGG ATCGCCTCTA AATTCTGAGC ATCTTGACCC CAGCGCACCT GCAGTGCCTG GTATTCGGCC GCTGTTAGGC GCAGCGTGTC GAGCTCATCC 11000
TGTTGAGTCT CAACAGTCTG ACGCACCTGT GCCAACTCCC TCTCCAGCCG GGTATGACGC TCCAGCCACT GGCCGTTTTC CCGATTGAGC TGCACCAGGT 11100
CGTGGTTCTT GGTGGTCAAC GCTTCGTTGG CCTGCCGCAG GGCGACCTGC AGTTCCTGCA CTTGGTGCTC GTGGCGGCGC TGCTCCTGCT CGCGTTGGTC 11200
TTTGACCGAG GTCCGGTAAT GCTCAAGAGC CTCCCTGGCA TGCTCGTGTT TCTGCTCCAG TGAGCGCGCG TGGCTTTCGT GCTCAGCCAG CCGCGCCGTG 11300
AGACCCGAAA TGCGCTCCTC CAGCTGGGCC AGTTCGGTGG TGCGGCCGGC CAGGTTGCTC ATGGCTGTTT CACACGCCTG GCGTTCTGCG TGCAGCGCCG 11400
TTTCGGTGTG CTGAAGCTGC ATACTGAGGT TGCCGGCCTC TTGTCGGGCC TGTTCAAGGG CTTGGGTGCG CTCGCGCAAC TCGGCTTGGA ACCGCCCTTG 11500
CGCCTGGGCG ACCACCGCTT CCGCCTCAGC ATGCAGCCGC TCGGCAAGAC GGGCGACGAG ATCCTGCAGG GCGTCGCTGA CAGCGATCTT GGTACCTACG 11600
CCTTGCCCTT CCTCTTCTTC CAGCTCCCTC AGGTAGCGGT GGATGGTGGT CTTGGACCCT GTGTTGCCCA GTGCCACGCG TACGGCGTCC ACCGAGGGGT 11700
GCTTGCCCTC AACCCGGAGG CTGTCCCGAG CGCGTTGCAC ATCACTTTTG TATAGTCCAG ACCGTGCCAT GCGCCGCTCC TGTTTATTTC GTAACGTATT 11800
ACATACCATG TAATTACGTA CCAAACAACG CTTCAGCCGG ACTGGCAGCG GACCGTAAAG TCACACGGGA TAATGTTGAA TTATCCCGCG TAACGGGCCT 11900
TCTGACCCTT CCCGGTTCCA AAAACAGTAT GAAACCACCT GGGTGGGCGA GCGCTGGGTA GTATGGCTCA GAGCGGAAAG GAGGCCGGCC GAGGGCGCGG 12000
GCACGCTCCG CCACTGAGCT CATTGGCCAT CAAGGGACTG TGCATGCCGA TCGAACGTGT CGTCATCGAC AACTTCAAGT CGTTTCGCCA TCTGGACTTG 12100
CCGCTCAATC CCCACATGAA CCTAGTGGTG GGCGACAACG AGGTCGGCAA GTCCACCCTG CTGGAGGCCA TCCACGCGGT GGTCACCGGA CAGTTGCATG 12200
GGCGCAACCT CGCCTACGAG CTCACGCCCT ACCTGTTCCA CCAACCCACG GTGCATGAGT ACTTGGCGGC GCTTCAGGCA GGCACGCCGG CATCGCCGCC 12300
ACGGATCTCC ATCGAAGCCT ACCTGGGCCG CGACGCGGCG CTGGCGTCGC TGCGTGGCAC CAACAACTCG CTGGGCTTGG ATACCGCTGG CATCCGCCTG 12400
TTGGTCGAGC TCAACGACGA CTATCGCGAG GAGTTCAACG CCTACCTGCA GCAACACCAG GGCGTGGTCA GCTTGCCGGT GGAGTATTAC ACGGTGCGCT 12500
GGTACTCCTT CGCCCACAAT GGCGTCACCG CACGCAGTAT TCCGTTCGAT TCGACCATCA TCGACACGCA CGGTATCAAG ACCTTGTCCG GTGCCGATCG 12600
CTATATCGCC GGCATCATCG AGCAGGCACT GACGCCTGCG CAACGCGTCT CGCTGTCGCT GAGCTTTCGC CGCATGCGAC AGAGCTTCTC CGAAGAAGCG 12700
GATGTGGCCG CCATCAATGC CTACCTGACC GAGCACACCG GGGACATCAG TCACCGGGCA CTGACGGTAG GCGTGGACAC ATCGCCGCGC TCAACGTGGG 12800
AAACCAGCCT GTCACCGTAT CTGGATGAGC TCCCCTTTAC CCAGGCCGGC AAGGGCGAAC AAAGCGCGGT GAAGATGAAG CTGGCGATGC ACGCTGCGGG 12900
CGCGGCGCAC GTTCTGCTGA TCGAGGAGCC GGAGAACCAT CTGTCCTTCT CCAGCATGAC CCAGCTGATC GATAAGATCG CGGCCCTCTC CGCAACGCAG 13000
CAGGTCGTCA TCGCCACCCA CAGCAGCTTC GTGCTGAACA AGTTGGGCGT GGACAACGTG ATCCTGTTCA GTGCGCAGGG CCAGATGAAG CTGGACCAGC 13100
TGCCATCCGA TACGCACGAC TATTTCATGA AGCTGCCCGG TCACGACACG CTGCGGCTGA TCCTGGCCAA ACAGGCGATT CTGGTGGAAG GCCCGTCCGA 13200
TGAGCTGATC GTGCAGCGTG CCTACTGCGA TCACCACGGC GTGGCGCCAC TGGCCCGCGG CGTGGACATC ATCTCGGTCA AGTCGTTGGC GTTTAAACGC 13300
TTCTTGCAGA TTGCAGAGCG TCTGCACATT CAAGCCAAAG TGATTACCGA CAACGATGGC GATATCGCGG TTGTACAAGA ACGCTACGCC GACTATCCAA 13400
ACGCCATCTA CTACGATTCC GACGAGAGCG CCCCATCGCT GGAAGAGCAG CTGATCAACG CCAATTCTCT GGCCGTGCTC AACACCGTGC TGGGTAAGTC 13500
ATTCGCCGAT GAGGTGGCGT TGCTCAAGTA CATGAAAGGC CATAAAACCG ACACGGCCCT GGCGATCTTC AACAGCCCGC ATTCGATCAG GTTCCCGGAC 13600
TATGTCCAGC GTGCCATCAC CTAACCGGGT GCTCCTCTCC GCGGCCGGCT CTGGCAAGAC CACCTTGCTG GTCCGGCAGG CCTTGGAGCG ACCGCTGCGC 13700
CGCATCGCCA TCGTCACCTA CACGCTGGAG AACCTTGAAG AGATCCGGCG TTCGTTCGAG ATGCACGCCG GTGCGGTTCC CCCGAATGTC ACGTTGCACA 13800
GCTGGTATGG ATTTCTGCTG CGCGAGTGCA TCCGCCCGTA CCAAGCTGCG CTTTGCCCTC AGCCTCGGAT CGAGACGATC CTGTTCGTCG ACGGGCGCAC 13900
CGACAACCGC GCCCCACGCT CTCAAGTCGC ACGACACTAT CTTGCCGGCG ACCGGATGTA CTCAGATCGG GCGGCCGACT TTGCTGTGCG CTGCGATGAA 14000
CTGACCCAGG GTCACGTTAT GGCGCGCCTG TCGGATATGT ACGACGAGCT GTACATCGAC GAAGTCCAGG ACCTGGCGGG TTACGATTTG GACTTGGTCG 14100
AGCGGCTTTT GAAGAGCGAT ATCGACATTA CGTTGGTAGG CGATACACGC CAGGCGACCT ACGCCACCAA CTACGCACCA AGACACAGCC AGTATCGCGG 14200
GCCGAATCTG GCAGCCTTGT TCCAGGTTTG GGAGTCGGAC GGCTTATGCC AGCTCGATCA ACGCCTCATC AGCCTGCGCT GCGTTCAGGC CCTCTGCAAT 14300
TTGGCCGATG CGCTCTATCC GCAGATGCCA AGGACCAAGT CAGGCAATGG CGAGGTCACG GGGCACGATG GCATCTATCT CGTCGCTCCC GGGCATGTCG 14400
CTGCGTACAT GCAGGAATTT GCTCCAACCG TGCTTCGTTA TGACCGGCGG CAGGCGTGTG ACGGACTGCT CGCAGTGAAC TTCGGCCAGT CTAAGGGCCG 14500
CACGTATAGC CGGGTCCTGA TCTTCCCTAA CGGGCCGTTG ACGCAGTACC TTCGCACGGC AGATGCGTCA CGCATCACCG CGCCACCAAA ATACTACGTG 14600
GCCTTCACCC GGGCGCGGCA AAGCGTGGCG TTTGTGTATG CCGGCGCGTG TGCGCTGCCG GGTCACCAGC TCTACGCGCC TAGTGGCGCA ACCCCATAAG 14700
CAGCGACCAC ATATTCTTAA CGGGATCGCC CAACGCCATG GCCGATTTGG AGCACTACCT CGACGCCGCC ACCCGTGCGA ACACGCATCG CAGTTACGCC 14800
TCTGCACTTC GGCACTTTGA GGTCGAATGG GGCGGCCACC TACCGGCGAC GCCGGACAGC GTCGCCCGCT ACCTGGCCGA CCACGCGGGC CAGTTGGCAA 14900
CCAACACACT CCGACACCGG CTCGCAGCGC TGGCGGGTTG GCACCGCGAA CACGGATTCG TGGATCCGAC CCGGGCGCCG CTGGTACGCA AGGTGCTCAA 15000
GGGCATCCAG ACCCTGCATC CGTCTGTGGA GAAGCAGGCA GAACCGCTGC AATTGATCCG ATTGGCCCAG GTGGATGCTT GGCTCGCCGG TGCGGTCACT 15100
GCGGCACAGG AACGTGGCGA TCACGCCGAT GCATTACGCC ATCGGCGGGA CCGCGCCTTG GTGCTTCTTG GATTCTGGCG CGGCTTCCGC GGGGACGAAC 15200
TGATCCGGGT GCAGGTCGAG CACCTGCGCC TGGTTACCGG TGAAGGCATG ACCTGTTTTC TCCCGTGCAG CAAGGGAGAT CGGCGGGCAC AGGGCAATAC 15300
GTATAAGGTG CCCGCACTGT CGCGACTGTG CCCGGTGACC GCGACGTGGG ACTGGATCGC CGCCGCCGAG CTGAGCGAGG GGCCGCTATT CCGTGGCATC 15400
GACCGTTGGG GCCACATCGC GGACGAGGCG CTGCACCCCA ACAGCCTGAT CCCGCTGCTA CGTCGGTTGC TGACGTGCGC TGGCCTGCCG GATGCCCAGG 15500
ATTACAGCGG CCACTCGCTG CGCCGAGGTT TCGCTGGTTG GGCCAACGCC AACGGGTGGG ACGTGAAGGC ATTGATGGAG TATGTCGGCT GGCGCGACGT 15600
GCATTCGGCA ATGCGCTACA TCGATGGGGG CGATCCATTC GCTCGCCAGC GCATCGAAGC CAGTCTGCCG GAAACGCCCG TGCTGCCAAG GCCTGCAACG 15700
ACCTGAGGGT ACTGGATGGC ATCGATCGAA CGAACTGCAT ACCCGCAATT CAAGCGAAAC CCGGTCGTCC GCGAGCTGGT TGCGGCCTAC ACCCCAACCG 15800
ACGCCGAGGT GGCCTTCGTT GCCGAGTACA CCCGGCAGCC TGCGCACCGC CTGACGCTGA CGATCCTGCT CAAGACTTTC CAACGGCTGG GGTACTTCCC 15900
TTTGCTGGAC GAAGTGCCGC CGGCGGTGGT GCGTCACATC CGTGGCGCGT TGAAACTGCG CGTGCAGGTC AAGCCAGTGA GTCTTGGCAA CGCCTCGCGC 16000
TATCGCTACT ACCGCCGCAT CCGGCAATTC CTGCAGGTCC GGGCCTACAG CGACGGCGGG TTGAAGATTA CGGCACGCGC GGTATACGAA GCCGCCGCGG 16100
TGATGGATAA CCCGGCGGAT CTGATCAACG TGGCCATCGA ACATCTCGTA CGCGATCGCG TTGAGCTGCC GGCGTTCTCC ACGCTGGATC GCCTGACCCG 16200
GCGCATTCGT ACGCTGGTTA ACGGGCGCTA TTTCGCACAG ATTCAGGCTC AACTGACCAT CGATGAAAAG CAGCGCCTTG AAGACCTCCT GCAGGTCGAA 16300
GAGGGACGCC AGAAGAGCCC ACTACATGCG ATCAAGCGCC TGCCCAAGCG CTCTTCGTTG CAGCATTTCC AGGAGTTGAT CGACCATATC GGCGAACTGG 16400
GGGAGTTGGT CGGCAGCGAG TTGCATCTCG CGGGCATCCC TGAGATCAAG CGCAAGCACT TCGCCGCAGA GGCGCGAGCA TTGGATGCGT CCGAGCTGCG 16500
TAAGTTTCGG CCCGCCAAGC GCTACGCCGT GCTGGTGTGC TTGATCCATC GGGCCCGGGT CCAGACGCGC GATGACCTCG CGGAGATGTT CATCAAGCGC 16600
ATGGGGAACA TCCACAACCG GGGGCGTGAG GAACTGGAGC GGCTGAGGGC GCGCTATCGC GAGAAGACCG AAGCGATCGT GGCGACGATG TCGGATGTGG 16700
TCCGCGTTCT CGACCATCAT CCAGGCGACA CAGAGGCTGG ACGGGAAATC CGCCGCCTAG TCAACGCCCA CGGCGGCGTG CAGACCTTGC AAGCTGACTG 16800
CAACGCCATT GCGGCGCATA GTGGCGACAA CTACTTGCCG CTGCTGTGGC CGTTCTACAA AAGTCATCGC GCCACCATCC TAAGGATGGT GCGAATGCTG 16900
GACTTGGCCT CGACCACAGA GGACCGCTCG CTGATCGACG CGATCGAGCT GATCCTGACC CAGGAACGGA CCCGCGGCGA TTGGTTGGAC GAACCAGTCG 17000
ACCTGGCGTT CACCACCCAA CTCTGGCGCA AGACCATCGT CCATCGCACC GAACAGGGCG AAGAGCGCAT CCACCGGCGC CTGTTCGAAG TCTGTGTGTT 17100
CTCGTCGCTC GCCAACGAAC TGAAATCGGG CGACGTGGCT GTGCGCGGTT CGGAAACCTA CGCCGACTAC CGCGAACAGT TGCTGCCGTG GGAGCAGTGC 17200
GAGCCTATGT TGGAGGATTA CTGCAAGCAG GTGGGGCTGC CGGCCACGGC CGTGGGCTTC GTCAATGCGT TGCAATCGCG CCTGATGCAG GTCGCCGAGC 17300
TGACCGATCA AGGCTATCTG GAGAATGGCC AAGTGGTCAT CGGCGAGGAT GGCATCCCGG TGCTCAAGCG CAGCAAGGCC AAGGAGATGA GCAGCGGGGC 17400
CCGCGCCCTG GAAACCGCCA TCCTAGACCG CATGCCCGAA CGCAGCGTCA TCGAGATCCT GTGCGATGTG GCTTATTGGA CGCGCTGGCC CCGGCACTTC 17500
GGTCCTCTGT CCGGTTCGGA CGCCAAAATC GAGCAACCGA CGGAGCGTTA TGTCCTCACC GCCTTTACCT ACGGATGCAA CCTCGGACCA GCCCAGGCTG 17600
CCCGGCACCT GCGTGGTGCC GTCTCGGCGC ACATGCTGTC GTTCGTCAAC CGCCGGCACG TGGATGCCAA CAAACTGGCG GCGGCCTGTC GGGACATCAT 17700
CAACAGCTAC GCCGGCCTGC AGCTTCCCAA ATGCTGGGGC GATGGCAAGA GCGCGGCCGC TGACGGCACC AAGTACGACC TCTACGACCA GAATCTTCTC 17800
GCCTCGTACC ACATCCGCTA TGGCGGCTAC GGCGGCATTG CCTATCACCA CGTGTCCGAT ACGTACGTCG CGCTGTTTAG CCACTTCATT CCGTGCGGTG 17900
TCTGGGAGGC GGTCTACATC ATCGATGGCC TGCTGAAGAA CACCTCCGAC ATCCAGCCGG ACACCGTCCA CGCCGACACG CAGGGACAGT CGCTGCCGGT 18000
CTTCGGCCTT TCGCATCTGC TGGGCATCCA GCTGATGCCG CGCATCCGCA ACTGGCGCGA ATACAAGTTT TTCCGCCCTG ACGAGGACAT TCGCTACGAA 18100
CACATCGACG CGCTGTTCCG GGACACTGTC GACTGGGATC TGATCGAGAC CCACTGGAAG GACCTGATGC AGGTCGTGCT CTCGATCAAG ACCGGTAAGA 18200
TCGCGGCCTC GACGCTGCTA CGTAAGCTGG GCAACTACAG CCGCAAGAAC CGGCTGTACC AGGCCTTCAA GGCGCTCGGC TCGGCCGTGC GCACGTTGTT 18300
CCTGCTGCAG TACATCTCCA ACCGCGAGCT GCGCGAGCAG ATCACTGCCT CGACCAACAA GGTGGAGGCC TACAACGGCT TCGCGAAGTA CTTCTTCTTC 18400
GGCGGGGAAG GGGTGATTGC CGACAATGAC CCCGTTGAGC AGGAGAAGGC CGTTAAATAC AACGACTTGG TCTCGAATGC CGTCATCTTC TACAACGTGG 18500
TCGAACAGAC CCGGATCATG AAGGCACTGA TGCGGCAGGG GTGGAAGATC ACCCGGGAGG ACGTGGCTTT CCTCAGTCCG TACGTAACCA GTCATGTGAA 18600
GCGGTTCGGG GACTACCTAA TTGATGTGGA AGCGATCCCG GAACCGTATG AGATTGAACT GGCGTTGGTG GCGTAGTTTT GTTACCAAAA AAGTCAGCTA 18700
AATCACTGAT AAAATTGATT AAATCCGATT TTGTGAGCCA TTTTTACACG TATGTCGGCC GAACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res_acc_IR2 11804-11812 9 TACCATGTA
res_acc_IR1 11815-11822 8 TACGTACC
res_core_IRR 14531-14538 8 CGGGCCGT

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
czcC TnXo19 1919-2305 Passenger Gene Heavy Metal Resistance +
czcB TnXo19 2302-3543 Passenger Gene Heavy Metal Resistance +
czcA TnXo19 3553-6684 Passenger Gene Heavy Metal Resistance +
hupE_ureJ TnXo19 6681-7412 Passenger Gene Heavy Metal Resistance +
WP_150411558.1 TnXo19 7427-8083 Passenger Gene Hypothetical +
yfiS TnXo19 8448-9782 Passenger Gene Heavy Metal Resistance +
secC TnXo19 10045-10671 Passenger Gene Heavy Metal Resistance -
tnpT TnXo19 10718-11809 Accessory Gene Resolvase -
AAA ATPase 1 TnXo19 11963-13624 Passenger Gene Other +
AAA ATPase 2 TnXo19 13602-14699 Passenger Gene Other +
tnpS TnXo19 14738-15706 Accessory Gene Resolvase +
tnpA TnXo19 15716-18676 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
czcC CzcC TnXo19 387 1919-2305 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Cobalt||Zinc||Cadmium
Protein Sequence:  
MSVSVPLGNR RRSDYSVAEA DADLSALKAR TEATRIERRQ QLFDRYQAMQ QAQSEVTSLR QRMLPKAEDA VRLTRRGFEA GRFSFLALMQ AEKTLFDLRE
RQVDAAARYY TLLVEVERLT APVSDRIP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
czcB CzcB TnXo19 1242 2302-3543 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Cobalt||Zinc||Cadmium
Protein Sequence:  
MKRYALIMLF PLLLSACGGE SSADKKAGEV QGTEQAAADY ERGPHRGRML RDGDFALEVT VYETNTPPHF RLYAYRNDKQ IAPAEVTPTI MLKRLDGEVN
TFAFKPEKDY LAATTEVVEP HSFDVKVTAA SAGKSHHWSY ASYEGRTTID PQAAKDAGVA VETAGAATIR DTVQLMGTIA VDANRFAAVK ARFPGIVRNV
PVQVGQRVSA GATLVTIEGN DSMRTYAVTA PFDGIVIARN TNVGDFAGDN TLVELANLAQ VWVDLRAIGT DAERLAPGQS VTVRSATSGV ESDAKVVSLL
PLATAGQSVI ARVSLPNPEG KWRPGMTVSA EVTVASDEVP LAVKESGLQR FRDFTVVFAQ VGDTYEVRML ELGRRDGHYA EVLGGLKPGA SYVSEQSYLI
RADIEKSGAS HDH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
czcA CzcA TnXo19 3132 3553-6684 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Cobalt||Zinc||Cadmium
Protein Sequence:  
MLEKIIRASI AHRWLVLLLV LGLSALGIWN YSRLPIDAVP DITNVQVQIN TEAPGYSPLE AEQRVTFPVE TALAGLAKLE YTRSISRYGL SQVTVVFEDG
TDIYFARQQV AERLQQAASA LPEGLEPSLG PVATGLGEIF MYTVEAEPGA EQTWTPKALR TLQDWVVRPQ MRHLKGVTEV NTVGGYVRQF HITPDPTKLQ
AYGLTLQDVL DAVGRSNANV GAGYIERAGE QYLIRVPGQV TGIDGLRKIV VATRDGLPLR IGDVAQVLEG SELRTGAATK DGKEVVLGTA FMLIGENSRE
VAQRTAAKLQ EIDKTLPEGV RVHPVYDRTE LVDRTIETVR KNLLEGALLV IVVLFLLLGN LRAALITAAV IPLTMLLTIS GMVQNRVSAN LMSLGALDFG
LIVDGAVIIV ENCLRRFGER QHALDRLLTR QERFELAASA STEVITPSLF GLFIIAAVYI PIFALSGVEG KMFHPMALTV VIALTGAMML SLTFVPAAVA
QFVTGKVSEK ETRAMRSVSR FYAPLLDKVM HARSWVVAGA AVLTVLAGLL ASRLGTEFIP NLDEGDIAMH ALRIPGTSLS QAIGMQRQLE ARIKQFPEVD
EVVAKIGTAE IATDPMPPSV ADTFIMLKDR SQWPDPRKSK VELVAELEKA VRAIPGNNYE FTQPVQMRMN ELIAGVRAEV AIKLYGDDLE QLTAIGGQIE
KVASTIDGNA DVKLEQVTGL PLMTITPDLD ALARYGISVQ DMQQTISVAM GGKSVGQVFE GDRRFDIVVR LPEMMRQDPR TLASLPVAVP AAGEGGRIYV
PLGQLARVEI APGPNQVSRE NGKRRVVITS NVRGRDLGSF VQELRERVAQ EVTMPEGYWV EYGGTFEQLM SASRRLSVVV PVVLVMIFGL LFMAFGSGKD
AAIVFSGVPL ALTGGVLALA LRGIPLSISA GVGFIALSGV AVLNGLVMIS FIHNLRQEGM LLEPAIREGA LTRLRPVLVT ALVASLGFLP MAMNVGAGAE
VQRPLATVVI GGIVSSTLLT LLVLPALYRL VHRSAASTHG ERA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
hupE_ureJ HupE_ureJ TnXo19 732 6681-7412 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Cobalt||Zinc||Cadmium
Comment:   membrane protein
Protein Sequence:  
MKAPHVSSMK VVLLRLWQKP VAALAMLAMS LVSAAAIAHG VSEGDQAFLE DSSGPQLVAF TYLGAKHMFT GYDHLLFLLG VVFFLYRMKD VGIYVTLFAV
GHSITLLMGV LGGFHVNPYI IDAIIGLSVV YKALDNLGAF RRWLGFQPNN KAAVLIFGLF HGLGLATKLQ DFSLSPDGLV ANMIAFNVGV EIGQLLALGA
ILLVMGFWRR SPLFARQAFG ANTLLMSAGF LLIGYQLTGY FVS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
WP_150411558.1 WP_150411558.1 TnXo19 657 7427-8083 +
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MSITLNQPLP STARLLRATL LAAGVAAVLL VTVVMPAEYN IDPLGTGRLL GLTKLSVSST EAETAASPAP LMPAAPGDHS EANILLAQKA KTAFGENKGQ
TLDAAATALT NGDLRRDTLS VTLPPGKGAE IKAHLKQGAG VVYRWKASGD VAVDMHGERP DVKGAWTSYS VEAAQRQAEG TFIAPFDGTH GWYWQNRTAQ
PVDVAVEVVG FQADLYRP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
yfiS YfiS TnXo19 1335 8448-9782 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Cobalt||Zinc||Cadmium
Comment:   MFS transporter
Protein Sequence:  
MIEVLSNSVF RRLFVAQVVA LVGTGLATVA LALLAYDLAG AQAGAVLGTA LAIKMMVYVT LAPVSAAVVP PSLRKPALIA LDLIRAAAAL SLPFVTAVWQ
VYILIALLQS ASACFTPLFQ SLIPEILKEE RKYTRALSLS RLAYDLESLL SPALAAALLT LISFHGLFVG TSAGFVLSAL LVLSTTLPLI ADKRGEEGPY
ARAIRGMRIY LRTPRLRGLL ALNLVAAAGG AMVFVNTVVV VRSVLHGGDR EVAWALAAFG AGSMLVALLL PRVLDRVPDR RVMLGAAAAM CGILVTLLAA
WLAERGAIGW AVLLPVWTLL GMAYAGLVTP GGRLLRRSAE SADLPFLFAA QFSLSHVCWL IAYPLAGVVG ARLGMPVTIA ALSVLALAGV IVAWRVWPKH
DPDELTHRHD DLPEDHPHLI EHRASNGGHR HRYVIDPLHE HWPQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
secC SecC TnXo19 627 10045-10671 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Cobalt||Zinc||Cadmium
Comment:   zinc chelator
Protein Sequence:  
MRAVTTTPPE ITRAVRRLTD SVVRGAEPVY LSVQPEADAI VHECFPNVQA KIARDGGQML CGWQLWEWPH VLVEAEFHAV WVSPAREMVD ITPKPEGETR
ILFVPDPRRR YEGLAIDNVR MPLRDDLLIR HFIQMSEAIV RVMNRGERVS QYGHLSIPAD EIQPLLQARD FLGQSLGAGL REHTSCLCGS GSKYKRCHGA
QVEAFFRR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpT TnpT TnXo19 1092 10718-11809 -
Class:   Accessory Gene
Sub Class:   Resolvase
Protein Sequence:  
MVCNTLRNKQ ERRMARSGLY KSDVQRARDS LRVEGKHPSV DAVRVALGNT GSKTTIHRYL RELEEEEGQG VGTKIAVSDA LQDLVARLAE RLHAEAEAVV
AQAQGRFQAE LRERTQALEQ ARQEAGNLSM QLQHTETALH AERQACETAM SNLAGRTTEL AQLEERISGL TARLAEHESH ARSLEQKHEH AREALEHYRT
SVKDQREQEQ RRHEHQVQEL QVALRQANEA LTTKNHDLVQ LNRENGQWLE RHTRLERELA QVRQTVETQQ DELDTLRLTA AEYQALQVRW GQDAQNLEAI
RQELAQARAD LTQERERREH AEADTLRATV RLSTLEPLLA QLQPASTGGK NSKRISSEET PAP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
AAA ATPase 1 AAA ATPase 1 TnXo19 1662 11963-13624 +
Class:   Passenger Gene
Sub Class:   Other
Protein Sequence:  
MAQSGKEAGR GRGHAPPLSS LAIKGLCMPI ERVVIDNFKS FRHLDLPLNP HMNLVVGDNE VGKSTLLEAI HAVVTGQLHG RNLAYELTPY LFHQPTVHEY
LAALQAGTPA SPPRISIEAY LGRDAALASL RGTNNSLGLD TAGIRLLVEL NDDYREEFNA YLQQHQGVVS LPVEYYTVRW YSFAHNGVTA RSIPFDSTII
DTHGIKTLSG ADRYIAGIIE QALTPAQRVS LSLSFRRMRQ SFSEEADVAA INAYLTEHTG DISHRALTVG VDTSPRSTWE TSLSPYLDEL PFTQAGKGEQ
SAVKMKLAMH AAGAAHVLLI EEPENHLSFS SMTQLIDKIA ALSATQQVVI ATHSSFVLNK LGVDNVILFS AQGQMKLDQL PSDTHDYFMK LPGHDTLRLI
LAKQAILVEG PSDELIVQRA YCDHHGVAPL ARGVDIISVK SLAFKRFLQI AERLHIQAKV ITDNDGDIAV VQERYADYPN AIYYDSDESA PSLEEQLINA
NSLAVLNTVL GKSFADEVAL LKYMKGHKTD TALAIFNSPH SIRFPDYVQR AIT

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
AAA ATPase 2 AAA ATPase 2 TnXo19 1098 13602-14699 +
Class:   Passenger Gene
Sub Class:   Other
Protein Sequence:  
MSSVPSPNRV LLSAAGSGKT TLLVRQALER PLRRIAIVTY TLENLEEIRR SFEMHAGAVP PNVTLHSWYG FLLRECIRPY QAALCPQPRI ETILFVDGRT
DNRAPRSQVA RHYLAGDRMY SDRAADFAVR CDELTQGHVM ARLSDMYDEL YIDEVQDLAG YDLDLVERLL KSDIDITLVG DTRQATYATN YAPRHSQYRG
PNLAALFQVW ESDGLCQLDQ RLISLRCVQA LCNLADALYP QMPRTKSGNG EVTGHDGIYL VAPGHVAAYM QEFAPTVLRY DRRQACDGLL AVNFGQSKGR
TYSRVLIFPN GPLTQYLRTA DASRITAPPK YYVAFTRARQ SVAFVYAGAC ALPGHQLYAP SGATP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpS TnpS TnXo19 969 14738-15706 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Tyrosine
Sequence Family:  Tyrosine Site-Specific Recombinase
Protein Sequence:  
MADLEHYLDA ATRANTHRSY ASALRHFEVE WGGHLPATPD SVARYLADHA GQLATNTLRH RLAALAGWHR EHGFVDPTRA PLVRKVLKGI QTLHPSVEKQ
AEPLQLIRLA QVDAWLAGAV TAAQERGDHA DALRHRRDRA LVLLGFWRGF RGDELIRVQV EHLRLVTGEG MTCFLPCSKG DRRAQGNTYK VPALSRLCPV
TATWDWIAAA ELSEGPLFRG IDRWGHIADE ALHPNSLIPL LRRLLTCAGL PDAQDYSGHS LRRGFAGWAN ANGWDVKALM EYVGWRDVHS AMRYIDGGDP
FARQRIEASL PETPVLPRPA TT

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnXo19 2961 15716-18676 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MASIERTAYP QFKRNPVVRE LVAAYTPTDA EVAFVAEYTR QPAHRLTLTI LLKTFQRLGY FPLLDEVPPA VVRHIRGALK LRVQVKPVSL GNASRYRYYR
RIRQFLQVRA YSDGGLKITA RAVYEAAAVM DNPADLINVA IEHLVRDRVE LPAFSTLDRL TRRIRTLVNG RYFAQIQAQL TIDEKQRLED LLQVEEGRQK
SPLHAIKRLP KRSSLQHFQE LIDHIGELGE LVGSELHLAG IPEIKRKHFA AEARALDASE LRKFRPAKRY AVLVCLIHRA RVQTRDDLAE MFIKRMGNIH
NRGREELERL RARYREKTEA IVATMSDVVR VLDHHPGDTE AGREIRRLVN AHGGVQTLQA DCNAIAAHSG DNYLPLLWPF YKSHRATILR MVRMLDLAST
TEDRSLIDAI ELILTQERTR GDWLDEPVDL AFTTQLWRKT IVHRTEQGEE RIHRRLFEVC VFSSLANELK SGDVAVRGSE TYADYREQLL PWEQCEPMLE
DYCKQVGLPA TAVGFVNALQ SRLMQVAELT DQGYLENGQV VIGEDGIPVL KRSKAKEMSS GARALETAIL DRMPERSVIE ILCDVAYWTR WPRHFGPLSG
SDAKIEQPTE RYVLTAFTYG CNLGPAQAAR HLRGAVSAHM LSFVNRRHVD ANKLAAACRD IINSYAGLQL PKCWGDGKSA AADGTKYDLY DQNLLASYHI
RYGGYGGIAY HHVSDTYVAL FSHFIPCGVW EAVYIIDGLL KNTSDIQPDT VHADTQGQSL PVFGLSHLLG IQLMPRIRNW REYKFFRPDE DIRYEHIDAL
FRDTVDWDLI ETHWKDLMQV VLSIKTGKIA ASTLLRKLGN YSRKNRLYQA FKALGSAVRT LFLLQYISNR ELREQITAST NKVEAYNGFA KYFFFGGEGV
IADNDPVEQE KAVKYNDLVS NAVIFYNVVE QTRIMKALMR QGWKITREDV AFLSPYVTSH VKRFGDYLID VEAIPEPYEI ELALVA

 References     

Niu XN, Wei ZQ, Zou HF, Xie GG, Wu F, Li KJ, Jiang W, Tang JL, He YQ. Complete sequence and detailed analysis of the first indigenous plasmid from Xanthomonas oryzae pv. oryzicola. BMC Microbiol. 2015 Oct 24;15:233. doi: 10.1186/s12866-015-0562-x. PubMed ID: 26498126