Transposon
Name: TnXca1       (Synonyms: Tn7215)
Family: Tn3        Group: Tn4651
Evidence of Transposition: no
 Host     

Host Organism:Xanthomonas campestris pv. vesicatoria Molecular Source:plasmid pXCV183
Date of Isolation:2005

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 29 bp)GAGGGTCGGCAGGGATTGATACAAAAAAC
IRR (Length: 29 bp)GAGGGTCGGCAGGGATTCGTGTAAAAGAC

 Sequence     
DNA SequenceLength  11523 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GAGGGTCGGC AGGGATTGAT ACAAAAAACA GCCAAATCTT GCCCAACCGC CTGATAATTG AAGAATTATC ACTCCGGCTT CCGGCACTGC GCATGCCGTC 100
TGGTTCGATG CGCCCATCGC CAGCGCCGCG CGACGCCTGA CCGAGCTGGC CCGCGCGCAT GCTGGACCGC GACCTCCACG TCTGGCGGTT TAGCGCTGGT 200
CTCGCGCCAT TTTATGAATT GTGATCGAGG ACGAAGTAAC GCGTTGCCGC AGAAGTAGCA CTTCTCTAAC GCGGCGATTA CTTCCGATTT TGTGCGCCGC 300
ATATTTACTA AAATTTTACT GTAATTTAAC TATCAAACCA GAAGAAAGAC CATGAGAAAA TTTAAATCGA AGTACATGCT TGGCGCCTGC ATCGTTGGAA 400
GCATCGTTAG CGCGGGTGCA GCGGCGCAGG TCGCTGCAAT AAACAATACT GGCCGTGCCG AGGCTATGTC TGCATGGGAA ACTACGCTCA AGCACGAGGC 500
TCCGGCTATG GAGGGCTGCT TTAGCTCGAC ATTTCCGGAC ATGGGGTGGC AGGCGGTACG CTGTGGCGCA CCGCCGAAGT TGGTCATGAA GCCACGACAC 600
GTTGCCAGCG GCAACGTTCG TACCACCACC GACAACCGTG TGCTCATCAC CGGCAATGGC GATGACTACG CTGCACGCAC GGGCAGGCTC ACCCACTCAG 700
CCGTCGGTTC GTTCCCGAGC GTAAGCGGCG TGACCACTGG GGTAGTCCAA TACTCGCTGC AAATCAATAC CGACAACGAC AGCAACCCCG CCGCTTGCGC 800
GCAGTTCGGT TTTTCTTCGT GCAAGACCTG GCAACAGTAC GTCTACTCCA GCGACGCCGA CGAAGACTCA AGTAATGGCT TTGACCCGGT CATCTTCATT 900
GAAAGCTGGG TATATGCGGA CAGTACCTCG GAATACGATG CGGCGGGTTG CCCGTCCGGC TGGGATGCTT ACGAAGGCAA CGCTTGCGTG ATTAACAGCG 1000
AATCGGTGCG AGTGCCTCTG GTGCCAGTTT CGGGCATCGC TGGTGTCAAG CTGACCGGTT CTGCGACCTC GGGGGGCGTG GATACCGTGT CGTTTTCGGT 1100
GAACGGAAGG GCCTACAGCG TGAGTCAGCG CGCCTCTACG GTGGATATCA ATAAGATCTG GCGCCTGACC GAATTCAACA TCTTCGGCAA CGGCGCCAGA 1200
ACTCAGACGG TGTCGTTCAA TCGCGGCTCG CACGTCACGG TAAACGTAGC CGTAAACGAT GGTACGACAA ATGCCCCGAC TTGCCTGGGC AATGCCGGCC 1300
AGACGTTCGA GCAGAACAAC CTGACGCGCG GTAGTTGCTC CGTCTTTGGT GGCGCTTCGC CCGGCATTAG CTTTCCTCAA AGCAACTGAC TATTTGCGTC 1400
TGGGGAGGTT TCGTCCTTCC CAGACGTTAC TTGTTCGCCA ACGGGGCGCG GTGGCCGCAG CTGCGCCAGG AGCTGTTCCA GCGTGCTCAG ACGTACCGTG 1500
GCCCGCAAGG TGTCCGCCTC GGCATGTTCC CGGCGCTGGC GCTCTTCGAT CAGATCGGTC CGCACCGCAG CCAATTCGGC GCGCACGCCT TCCAGCGCTT 1600
GGACATCTTT GGTCCAGCGC GCCTGCAGGC CTTGGTGCTC GGCGGCCGCC AGGCGCAGCG CGTCGCGCTC GCGCTGCTGG GCGTCGGCCC GCTGGCGTGT 1700
CTGCGTCAGT TCCCGCTCTA GCCGGGTATG GCGTTCCAGC CACTGGCCGT TTTCCCGGTT GAGCTGCATC AGGTCGTGGT TCTTGGCGGT CAGCGCCTCG 1800
TTGGCCTGCC GTAGGGCAAC CTGCAGTTCC TGTACCTGGT GCTCGTGCCG GCGTTGTTCC TGCTCACGCT GGTCCTTGAC CGAGGTGCGG TAGTGCTCCA 1900
GGGCTTCCCT GGCGTGGTCG TGCTTCTGCT CCAGGGAGCG GGCGTGGCTT TGGTGCTCCG CCAGTCGCGC CGTGAGGCCC GCGATCCGCT CCTCCAACTG 2000
AGCCAGTTCG GTAGTGCGGC TGGCCACCTC GCTTCTGGCG GTGGCGCTCG CCTCGCATTC GGCCTGCAGT ACGGTCTCGC AGCGCTGCAG CTGCGTCGTG 2100
AGTGAGTCAG CCTCTTGCCG GGCCTGCTCC AGCGTTTGGG TGCGCTCCTG GAGCTGCGCC TGGAAGCGCG CCTGGGCCTG CGCCACGACC GTGTCGGCCT 2200
CGCCGTGCAA CCGCTCGGCG AGGCGGGCGA CGAGGTCTTG GAGTGCGTCG CTCACGGCCA TCTTCGCGCC AACGCCTTGC CCTTCCTCCT CTTCCAACTC 2300
CCTCAGATAA CGGTGAATGG TGGTCTTGGA ACCGGTATTG CCGAGCGCCA CCCGGACCGC ATCGACAGAC GGATTCTTGC CCGTTGCGCG CAGGCTATCG 2400
CGGGCACGCT GCACATCGCT TTTGTACAGC CCAGACCGTG CCATCCGTCA CTCCACGTAT TTCGTAACGT ATTACATACC ATGTAATTAC GTACCATTCA 2500
ACACGTTAGA TAAACCGGTG GCGGTGTCGA GCTCACGCGG GATAATCTAG AATTATCCCG CCTGATACCG GTTTTTCGGC TAAGCTCGCA CGCGGGCCGT 2600
TACACCCCAG CCCATCGGGC GACTGGAGGA GCCGATGATC AGCGTTGGGC AGTACCTGGA AGCCGCCACC CGACCCAACA CCCAACGCGC TTACGCCGCG 2700
GCGACCCGCC ATTTCGAGGT CGAGTGGGGT GGTCATCTGC CGGCGACCGC AGAGCAGGTG GCGCGCTACT TGGCCGCCTA CGCCGGGCAA CTCGCGCTAA 2800
ACACACTCAG GCACCGGCTC GCAGCACTGG CCCAGTGACA CCAGGCGCAC GGTTTCGCCG ACCCCACGCG GGCGCCCGTC GTACGCAAGG TGCTCAAGGG 2900
CATCCAAACG GTGCATCCGA GTCAGGAAAA GCGAGCCACG CCACTACAGC TCACGCAGTT GGGTCAGGTC GTGGATTGGC TCGATGGCGC CGCAACTGCG 3000
GCCGGAACGC GTGACGATGC GGCCGGTCGG CTCCGGCACC TGCGCGATCG CGCCTTTGTA CTGCTGGGCT TTTGGCGCGG TTTCCGCGGC GACGAACTGG 3100
TTCGCCTCCA GGTTCAGGAT TTGGAGTTGG TGGCCGGCGA AGGCATGACC TGCTTCCTGC CGCACAGCAA GAGCGATCGC CAGCACGCCG GCACCACCTA 3200
CAAGGTCCCG GCACTGTCGC GCTGGTGCCC GGTGGCTGCC ACCATGACCT GGGTCGCGGC AGCCGCCCTC CACGAGGGGC CACTGTTTCG CGCAGTCAAC 3300
CAGTGGGGCG GGATTGCCGC CGCGCCACTC CACCCCAACA GCCTGGTGCC GCTGCTACGG CGGATCTTCC GCGAGGCGGG GCTGAGCTCT CCAGACGACT 3400
ACAGCGGCCA CTCGCTGCGG CGCGGCTTTG CCGGCTGGGC CAACGCCAAC GGCTGGGACG TCAAGGCGCT GATGGAGTAC GTCGGCTGGC GCGACGTGCA 3500
CTCGGCGATG CGTTACCTCG ACGGGGCCGA TCCGTTCGCC CGCCGGCGCA TCGAAGCCAG TCTGCCGGAA GCGCCCGCGC TGCCAAGGCC TGCAACGACC 3600
TGAGGGGCTG GATGGCGTCG ATCGAACGGA CCGCATACCC GCAGTTCAAG CGCAACCCGG TCGTCCGCGA ACTGGTTGCG GCCTACACGC CAACCGACGC 3700
TGAGGTGGCC TTCGTTGCCG AGTACACCCG GCAGCCTGCG CACCGCCTGA CGCTGACGAT CCTGCTCAAG ACCTTCCAAC GGCTGGGGTA TTTCCCCGTG 3800
CTGGACGAAG TCCCGCCGGC GGTGGTGCGC CATATCCGCA GCGCGCTGAA ACTGCGCGTG CAGGTCAAGC CAGCGAATCT TGCCAACGCC TCGCGCTATC 3900
GCTACTACCG TCGGATCCGT CAATTCCTGC AGGTCCGGGC CTACAGCGAC GGCGGGCTGA AGATTGCGGC GCGAGCGGTA TACGAAGCCG CTGCGGTGAT 4000
GGATAACCCG GCGGACCTGA TCAATGTAGC CATCGAACAG CTCGTGCGTG ATCGCGTCGA GCTGCCGGCG TTCTCCACAC TGGATCGCCT GACCCGGCGC 4100
ATCCGCTCGC TGGTCAACGG GCACTATTTC GCCCAGATCG AGGCTCGACT GACCATCGAC GAAAAACAGC GCCTGGAAGG CCTCCTGCAT GTCGAACAGG 4200
GGCGTCAGAA GAGCCCGTTG CACGCGATCA AGCGCCTACC CAAGCGCTCT TCGCTGCAGC ATTTCCAGGA GTTGATCGAC CATATCGCCG AACTGGGCGA 4300
ATTGGTCGGC AGCGAGGTGC ACCTGGCGGG CATCCGGGAG GTCAAGCGCA AGCACTTCGC CGCCGAGGCG CGGGCATTGG ATGCTTCCGA GCTGCGCAAG 4400
TTTCGGCCCG GCAAGCGCTA CGCGGTACTG GTGTGCTTGA TCCACCGGGC CCGGGTCCAG ACGCGCGACG ATCTCGCGGA GATGTTCATC AAACGCATGG 4500
GGAACATCCA CAACCGGGGC CGAGAGGAAC TGGAGCGGCT GAGGGCGCGC TATCGCGAGA AGACCGAAGC GATCGTGGCG ACGATGTCGG ATGTGGTCCG 4600
CGTCCTCGAC CATCATCGCG GCGACACCGA GGCGGGGCGT GAAATCCGCC GCCTGGTCAA CGCCCATGGT GGCGTGCAGA CGTTGCAGGC CGACTGCAAC 4700
GCCATTGCGG CGCATAGTGG CGACAATCAC TTGCCGCTGC TGTGGCCGTT CTATAAAAGT CACCGCTCCA CCATCCTGCG GATGGTGCGT AGGCTGGACT 4800
TGGCCTCGAC CACGGAGGAC CGCTCGCTGA TCGACGCGAT CGAGCTGATC CTGACGCAGG AACGAAGCCG CAGCCATTGG TTGGACGAAG CGGTCGATCT 4900
GGCATTCACC ACCCAGCTCT GGCGCAAGAC CATCGTCCAT CGCACCGAAG TGGGCGGCGA GGAGCGCATC CACCGGCGCC TGTTCGAGGT CTGCGTGTTC 5000
TCGTCGCTGG CCAACGAACT GAAATCGGGC GACGTGGCTG TGCGCGGATC GGAAACCTAC GCCGACTACC GCGAACAGTT GCTGCCGTGG GAGCAGTGCG 5100
AGCCTCTGTT GGAGGATTAC TGCAAGCAGG TGGGGCTGCC GGCCACGGCC GTGGGCTTTG TCAATGCCTT GCAATCGCGC CTGACGCAAG TCGCCGAGCT 5200
GACCGATCAG GGCTATCTGG AGAACGGCCA AGTGGTCATC GGCGAGGATG GCATTCCGGT ACTCAAGCGC AGCAAGGCCA AAGAGATGAG CTGCGGGGCC 5300
CGTGCCCTGG AAACCGCCGT CCTCGACCGC ATGCGCGAAC GCAGCGTCAT CGAGATCCTG TGCGATGTGG CCCACTGGAC GCGCTGGCCC CGTCACTTCG 5400
GTCCTCTGTC CGGCTCGGAC GCCAAGATCG AGCAACCGAC CGAGCGCTAC GTCCTCACCG CCTTCACCTA TGGTTGCAAC CTCGGACCGG CCCAGGCTGC 5500
CCGACACCTG CGTGGCGCCG TCTCGGCGCA CATGCTGTCG TTCGTCAACC GCCGGCATGT GGATGCCAAC AAACTGGCGG CGGCCTGTCG GGACATCATC 5600
AACAGCTACG CCGGCCTGCA GCTCCCCAAA TGCTGGGGCG ATGGCAAGAG CGCAGCCGCC GACGGCACCA AGTACGACCT CTACGACCAG AATCTGCTCG 5700
CTTCGTACCA CATCCGCTAT GGCGGCTACG GCGGCATCGC CTATCACCAC GTGTCCGATA CGTACGTCGC GCTGTTCAGC CACTTCATTC CGTGCGGTGT 5800
CTGGGAGGCG GTCTACATCA TTGATGGCCT GCTGAAGAAC ACCTCCGACA TCCAGCCTGA CACCGTCCAC GCCGACACGC AGGGGCAGTC GCTGCCGGTG 5900
TTCGGCCTTT CGCATCTGCT GGGCATCCAG CTGATGCCGC GCATCCGCAA CTGGTGCGAA TACAAGTTCT TCCGCCCCGA TGAGGACATT CGTTACGAAT 6000
ACATCGATGC ACTGTTCCGG GACACTGTCG ACTGGGATCT GATCGAGACC CACTGGAAGG ACCTGATGCA GGTCGTGCTC TCGATCAAGA CCGGCAAGAT 6100
CGCGGCCTCG ACGCTGATGC GCAAGCTGGG CAACTACAGC CGCAAGAACC GGCTGTACCA GGCCTTCAAG GCGCTCGGTT CGGCCGTGCG CACCCTGTTC 6200
CTGCTGCAGT ACATCTCCAA CCGCGAACTG CGCGAGCAGA TCACCGCCTC GACGAACAAG GTGGAGGCCT ACAACGGCTT CGCGAAGTAT TTCTTCTTCG 6300
GCGGGGAAGG GGTGATCGCC GACAACGACC CCGTCGAGCA GGAGAAGGCC GTCCAATACA ACGACCTGGT GTCCAATGCC GTCATCTTCT ACAACGTGGT 6400
CGAACAGACC CGAATCATGA AGTCTCTGAT GCGGCAGGGG TGGAAGATCA CGCGGGAAGA CGTGGCGTTC CTCAGCCCGT ACGTGACCAG CCATGTGAAG 6500
CGCTTCGGGG ATTACCTGAT TGATGTGGAG GAGGTCCCGG AACCGTATGA GACTGAACTG GCATTGGCAG GGTAGTTTTG GTGCGCCAAA ATATCCGCTA 6600
ACTCACTGAT GCAATGGATG AAATCCGATC TTGTGAGCTA TTTTTACACG TATGTCGGCT GAACCCCTAT ATAGGCAAAA ACTAAAGGCA ATAACCTATC 6700
GGTTTAGGGG GGGTCCGATT CTGCGTGGCA AAGGGGTCCG ATTCTGCGTG CTTTTCGGTG TGGGAGGGGT CCGATTCTGC GTGACTAGGG GGGTCTAATT 6800
CTGCGTGGAT AACTTGCTGT ATCCACCGAC TTACCCACAA TCGAATCGAG GGGGGTCCGA TTCTGCGTGG CAACAGCCAA GGGCTGTCGC CAGCGCTGCG 6900
GAGTGCTATG AGCCTTTGTA GGGTATCGGC GGGGGCGAAG CCATCAGCAT GATTCCGCCT GTCACCTGCT TGACCTTCGC ATCGGGGTAG ACGGCAAGCA 7000
CGCGTCGGAG TGAGGGCAGG AATTTCTTCT TGAAGTCCTT GTCGGCTTCC TTGCCCTGAT ACTCCTGCCC GAACTGATCA CGCAAATTTG TCCAATACAG 7100
CACGACCGGC CGGCCCTCGA TGCGATGCAG GCGCTGGGCA AGCCACGCGT ACACGTCAAG ATCGAGCGCC GAGCCTTTCA GCTCCATGAA GGCGCGCAGG 7200
TCGAGTGGTA CGGCGTGGTC TTTGAGCGTC AGGTAGTAGT CTTGCGAAAA CGTCACGGAA CCGGGCCAAA GAGCGCGCTG CTTCTCTTCC AGATTGATCC 7300
ATGCTTCGAA GTGTTTGATG GGCTTGCCCT CGTAAGTGTG GGCGCGGCCG TTCGCGTTGA AGCCCAAGGT CATACGGCAG GCGGACAAGG CTTGTACCTG 7400
CTTGCGGAAA TTGGTGAAGG TGCCCCGTTC GCCGCCTGTG ATGTTCTTTT GACCGAGCAT CCGCAGAAAT TCACTCGCGC TGTCGCCTAC CGGAATCTCT 7500
GGCGAGTTGA ACCGAACGGC ATAGGTGTTC ATCCACGCCA ACATCAGGCG CGGCATGGCC CCGTAGGGGA TTGGTTGTTG CACGAACTGC TTGCCGTCCC 7600
ATAATTTGCC AGCTTCAACA AGTAGCGCTG CGCCGCCCGA ATGCCGCTCA AACGATGTGC CGTCCACCTT GGATCGTGGC AAGCCGACTT GGCACATGAT 7700
CGAGTGCATA TAGGCGCGGT CGTCGTCATC CGGACGTTCG CCGGCAATCT CTGCGGCCGT TTTGATTAGA CGTTCTTCGC GCGCGGTAGC TGTCGTAGTT 7800
TTGGGCTTCC GCTCAAGCGC GGCCGGTTCT ACGCGCTTAA GTTTTGCCGC CTTAGTGGGC TTTGCCTTGT CTGGCCGGGA GTCTTTTAGC GGGGGGACTT 7900
TGGCATCCGT GGCTTGTTCT CCCGGTGCGG TCGGCGGTTC GACCTGGAAT AGGGGGCGCG TCGCGGCTAG GTCGGTAGGG TAGAGGTCGG CCCGATAGCT 8000
AACCTTGGCT GCCAAATCTG CGGCAGATTC TGGTGGGATA CCCTTTGATT CAAGGTGGTG CCGGTATCCG TCACGCCATT GGAGCATTTC GGCCGATGTT 8100
GGCTGGGCGG TTAGTTCGCT GATTTTCTTC ATTTCAAACG TCCTTCCTCG TCTCTGTTCT TACAACCGCA CGGCTGCTAC AATTCCGACC GTTAAGCCCC 8200
TCTTGATGAG GGGTTGAACA TTGGAATTTA ATCCCGGCTC CGGCCGGGAT TTTTTATTGG GCGCTTGCGG TTGCGTTTCG CAGACGTGGC CACACCCCTT 8300
TGCTAGAATG CTTTCAGCCC TACGGATGTG CCACATGGTC TGTTTCCTTG TACAAGTTCG CACGGGTTAG GCGGGGTTGT AGGGCGGCTC CTTCAACCTC 8400
GCCGCTTACA TCTATCTCTT GCCAAAATCC TTGGGTTCGA TGCCCTTGGA TGCCGGCCCT TGAATCTCTT TTGCTCCCCA TTCCTTCACG ATGCCGACCC 8500
GGTTGTACGG GTAGCGAATC TCGACGTTAG TGCCGGCGTT CAGCAGCTCG CGGCGGTCGC TGTTCAGTAC AAGTCGTTCG TGCTGGATGT GCAGCTCGCG 8600
GCCGGCTTCC CTGACTGACT GGATGACGTG CTTGTCGTCG GCCGACACAA TCGGGCCTTG GTAGGTCTTG CCGGTCTCGG GTGCGCGCAG CTCTGGTTGC 8700
TGCCGGCCGT AGTCCTGGCG CTCGTACTCG GCCGGCTTAT GCTCCGGGTA TTGCTGCCCT CCGTATTGGC GCGCTACGTC GCGCACGCGT TCGATCTCGC 8800
GTTCGTCGGC TCGGCGTGCG GTCATCATCG CAAGGATCGT TGCCCATTCG GCCTCTTGTT GTCGGCGTTC CTCGGGCGTA GGCGGGCGCT CGCGCTCGGC 8900
CTCGATGGCG GTCTTTGCTG CCGGCTGCCG TTTCCATTCG TTGCCCTGCA GCTCGTTGTC GTACAGCACG TTGCCCTTAC GGTCGTAGAC CTGCACGCGG 9000
TCAGCCAGTT TGTTGTGCTC GATGTATTCG AGCGTCGCCG GCATCCCTTT GTAGGCGTCG TCATGAGCCT GCACATTCGA CCAGCGGCCG AAGCCCTTGG 9100
CCGCCTTCTG TTCTTCATAG CGGCGGTGGA TGCCGGCCAT GCTGTCGCGT TCGTTGGCCG CGATTACGCG GGCGACGACG TAATAGCCGG CTTCTTTGAG 9200
GCGTCGCATC GTCTCGGTGA TAGGACCGGC TTCGCGCATC GTGCCTTCAA ACACGACGTT GCGACGTGTC TCGATGGTGC GGTCGAATAG CTGCTTGGTC 9300
CACGGCCGGG CGTGCGGGTC GGTCAGCTCG GCAAACCGGC GCTCGTCGGC CTTCTGAATG TCTCGGTATT GAGGGTGGTA GTAGCGCAGC TCGTCGCCGT 9400
TGATCGTGAC AACGTTGCGA TCTGCAAAGC CCTGTTTGCT GGCTTCGAGC AACCCGCTTT TGCCTGCGCC GGGCTGGCCG CCCAAGATGA TTGCCTGCGG 9500
TTGGTCGGCC GGCGCAGTGT CCTTGAAGTG ATGCCGCTCG ATTTTCTCGT AAGCGGCCGT GTGCTTGCGT GTGCTCAGTT GGAAGCGTTT TTCGTCCATG 9600
CCGCGTCACC CGTGCATCGG TTTGAGCAGG GGTGCGTAGA CATACAAGGC CCGGTTAATC AGGCTGAGAT TGTCGGGCGT AATGGCGCGG CGCTCGTCAA 9700
CCACGATTTC TAGCTCGTGC TCTAGCGCCT CGATGCGACC AGCGTTCGGC TCGGCCTTGT CCTGCTCGGC GTCGATCTCG CTGTTCAGGT AGCCGATGTA 9800
CTCGGCCAGT GTCTCCGTTG CGGCCTCCAA GCGGGCTGTT TTAGCAATCG GTGAAAGGGG AGTGTTCATG GTCTTTATCC TCGGTGATGC ACGTTAGCTG 9900
CGTGTCCAAT CTTCCACGGT CAAACCAACA ACACGACTAA ATGCGGCGTC ATTGGTAACG AGGACAGAAT CCGTTTCCAG TGCATGTGCT GCGATAAGCA 10000
TGTCGAGCGA CCCAAGCGCT TTACCTTGCT TTTCTAGGTC CGCTCTTACG CTTCCGTAAC GCTCCATTAC CGCGCCATCC CAAGGCAGCA CATCCACGCG 10100
CCGCAGGAGT TCCATGACGG CTTGCTGAAG GCGTTTGGCG TCTGGCACCT TAGCCAAGCC GAACATCAGC TCCCCACCGG TAATTGCGGA CATACATAGC 10200
GCAGTCATAG GCACTTCAAT GACCCGTCGA GAGACAGCCG GATGGCTCTT GACGAGATGG CTCACGGTGT TGGTATCAAG CATGTACCGC TTCATTCGCG 10300
CCATCCCGCA AAAGGATCAC GGTCCTGCGT GCCCTGATTG CGCTCGGCGG CATCTAGAAA ATTAGCAGGC ACATCTGCGC TCTTGAGTGC GATAAAGAAG 10400
TCCTCCCACG TTGCAGGCTT CCGAGACAGG ATGACGTCAC CGGTCTCCGG GTCTTGGCGA ATGAAAACCT CTTTCTCGGT AAAGCGATAG GCGGCAGGCA 10500
AGCGGACTGC CTGGCTGCGG CCATTGATGA ACAGCTTGGC AACTTGGCTC ACGATTTCCT CTCTGGGTGA AGGTTGGGAT ATACCGTAGG ATATGCCAAT 10600
GTTTGGTATA TATCAAGGCG TATGCCTGTC CGACAAACGA TCATTAGGCG GTCATGCCGG ACAATGTCCG GCAATGCGCT TGTTTAATGG GTTGTCGGAC 10700
ATTATGATGG GCGGACGGAA AGACGGACAA AAGGGGCGGT AATGGTACTG ATCGGCTATG CGCGGGTATC GACGGCGGAA CAGGACACCG CTTTGCAGAC 10800
GGATGCGCTA CGCAAGGCAG GCTGCGCGCG CGTTTTTGAG GACACGGCTT CTGGGGCCAA GGCCGACAGG CCCGGCTTGG CTGATGCGCT GGCCTACCTG 10900
CGCGCCGGCG ACGTGCTGGC CGTCTGGCGT CTGGATCGGC TCGGGCGCTC GATGCAACAC CTCATCGAGA CAATCGCCGC GCTGGAAGCG CGTGGCGTCG 11000
GCTTCCGGTC GCTGACCGAA AGCATCGACA CCACCACGCC GGGCGGACGG CTCATCTTCC ACGTCTTCGG CGCACTGGGC CAGTTCGAGC GCGACTTGAT 11100
CCGCGAGCGC ACCAAGGCCG GGCTGACCGC TGCCGCCGCA CGCGGGCGGA AGGGCGGGCG AAAGCCGGTT GTCACGGCCG ACAAGTTGCA GCGAGCGCGG 11200
GAGCACATCG CCAACGGGCT TAATGCCCGA GAGGCCGCTA CACGGCTCAA GGTGAGCAAG ACGGCTCTAT ACGCCGCGCT GCAATCCACA AGTGCAGCCG 11300
ACTCCTGACA TTCCGTGCAG CTGTCCTCTG AGAATGACAT CACGGGAATT GACTGCTGGA GCAGGACTTG CCGAGAAGTA AGGCAGGATC GCCAGTTGGG 11400
GATGGCGCAG GGTCCGCCGT GAACTCACCA GTGAGGGTCG GCAGGGATTC GTTTAAAAAA CAGCCAAAAG TGAGCTAACT GGCTCTCAGC AAAGGTCTTT 11500
TACACGAATC CCTGCCGACC CTC

 Recombination Sites     

Name Coordinates Gene Sequence
res_acc_IR2 2477-2485 9 TACCATGTA
res_acc_IR2 2533-2546 14 TCACGCGGGA TAAT
res_acc_IR1 2551-2565 15 AATTATCCCG CCTGA
res_core_IRR 2593-2600 8 CGGGCCGT

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
WP_011345700.1 TnXca1 352-1389 Passenger Gene Hypothetical +
tnpT TnXca1 1377-2444 Accessory Gene Resolvase -
tnpS TnXca1 2635-3603 Accessory Gene Resolvase +
tnpA TnXca1 3612-6575 Transposase   +
repA TnXca1 6906-8132 Passenger Gene Other -
zeta TnXca1 8412-9599 Passenger Gene Toxin -
epsilon TnXca1 9606-9869 Passenger Gene Antitoxin -
PIN TnXca1 9894-10304 Passenger Gene Toxin -
abrB TnXca1 10292-10552 Passenger Gene Antitoxin -
tnpR TnPsy42 like TnXca1 10742-11308 Accessory Gene Resolvase +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
WP_011345700.1 WP_011345700.1 TnXca1 1038 352-1389 +
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MRKFKSKYML GACIVGSIVS AGAAAQVAAI NNTGRAEAMS AWETTLKHEA PAMEGCFSST FPDMGWQAVR CGAPPKLVMK PRHVASGNVR TTTDNRVLIT
GNGDDYAART GRLTHSAVGS FPSVSGVTTG VVQYSLQINT DNDSNPAACA QFGFSSCKTW QQYVYSSDAD EDSSNGFDPV IFIESWVYAD STSEYDAAGC
PSGWDAYEGN ACVINSESVR VPLVPVSGIA GVKLTGSATS GGVDTVSFSV NGRAYSVSQR ASTVDINKIW RLTEFNIFGN GARTQTVSFN RGSHVTVNVA
VNDGTTNAPT CLGNAGQTFE QNNLTRGSCS VFGGASPGIS FPQSN

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpT TnpT TnXca1 1068 1377-2444 -
Class:   Accessory Gene
Sub Class:   Resolvase
Protein Sequence:  
MARSGLYKSD VQRARDSLRA TGKNPSVDAV RVALGNTGSK TTIHRYLREL EEEEGQGVGA KMAVSDALQD LVARLAERLH GEADTVVAQA QARFQAQLQE
RTQTLEQARQ EADSLTTQLQ RCETVLQAEC EASATARSEV ASRTTELAQL EERIAGLTAR LAEHQSHARS LEQKHDHARE ALEHYRTSVK DQREQEQRRH
EHQVQELQVA LRQANEALTA KNHDLMQLNR ENGQWLERHT RLERELTQTR QRADAQQRER DALRLAAAEH QGLQARWTKD VQALEGVRAE LAAVRTDLIE
ERQRREHAEA DTLRATVRLS TLEQLLAQLR PPRPVGEQVT SGKDETSPDA NSQLL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpS TnpS TnXca1 969 2635-3603 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Tyrosine
Sequence Family:  Tyrosine Site-Specific Recombinase
Protein Sequence:  
MISVGQYLEA ATRPNTQRAY AAATRHFEVE WGGHLPATAE QVARYLAAYA GQLALNTLRH RLAALAQ*HQ AHGFADPTRA PVVRKVLKGI QTVHPSQEKR
ATPLQLTQLG QVVDWLDGAA TAAGTRDDAA GRLRHLRDRA FVLLGFWRGF RGDELVRLQV QDLELVAGEG MTCFLPHSKS DRQHAGTTYK VPALSRWCPV
AATMTWVAAA ALHEGPLFRA VNQWGGIAAA PLHPNSLVPL LRRIFREAGL SSPDDYSGHS LRRGFAGWAN ANGWDVKALM EYVGWRDVHS AMRYLDGADP
FARRRIEASL PEAPALPRPA TT

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnXca1 2964 3612-6575 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MASIERTAYP QFKRNPVVRE LVAAYTPTDA EVAFVAEYTR QPAHRLTLTI LLKTFQRLGY FPVLDEVPPA VVRHIRSALK LRVQVKPANL ANASRYRYYR
RIRQFLQVRA YSDGGLKIAA RAVYEAAAVM DNPADLINVA IEQLVRDRVE LPAFSTLDRL TRRIRSLVNG HYFAQIEARL TIDEKQRLEG LLHVEQGRQK
SPLHAIKRLP KRSSLQHFQE LIDHIAELGE LVGSEVHLAG IREVKRKHFA AEARALDASE LRKFRPGKRY AVLVCLIHRA RVQTRDDLAE MFIKRMGNIH
NRGREELERL RARYREKTEA IVATMSDVVR VLDHHRGDTE AGREIRRLVN AHGGVQTLQA DCNAIAAHSG DNHLPLLWPF YKSHRSTILR MVRRLDLAST
TEDRSLIDAI ELILTQERSR SHWLDEAVDL AFTTQLWRKT IVHRTEVGGE ERIHRRLFEV CVFSSLANEL KSGDVAVRGS ETYADYREQL LPWEQCEPLL
EDYCKQVGLP ATAVGFVNAL QSRLTQVAEL TDQGYLENGQ VVIGEDGIPV LKRSKAKEMS CGARALETAV LDRMRERSVI EILCDVAHWT RWPRHFGPLS
GSDAKIEQPT ERYVLTAFTY GCNLGPAQAA RHLRGAVSAH MLSFVNRRHV DANKLAAACR DIINSYAGLQ LPKCWGDGKS AAADGTKYDL YDQNLLASYH
IRYGGYGGIA YHHVSDTYVA LFSHFIPCGV WEAVYIIDGL LKNTSDIQPD TVHADTQGQS LPVFGLSHLL GIQLMPRIRN WCEYKFFRPD EDIRYEYIDA
LFRDTVDWDL IETHWKDLMQ VVLSIKTGKI AASTLMRKLG NYSRKNRLYQ AFKALGSAVR TLFLLQYISN RELREQITAS TNKVEAYNGF AKYFFFGGEG
VIADNDPVEQ EKAVQYNDLV SNAVIFYNVV EQTRIMKSLM RQGWKITRED VAFLSPYVTS HVKRFGDYLI DVEEVPEPYE TELALAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
repA RepA TnXca1 1227 6906-8132 -
Class:   Passenger Gene
Sub Class:   Other
Protein Sequence:  
MKKISELTAQ PTSAEMLQWR DGYRHHLESK GIPPESAADL AAKVSYRADL YPTDLAATRP LFQVEPPTAP GEQATDAKVP PLKDSRPDKA KPTKAAKLKR
VEPAALERKP KTTTATAREE RLIKTAAEIA GERPDDDDRA YMHSIMCQVG LPRSKVDGTS FERHSGGAAL LVEAGKLWDG KQFVQQPIPY GAMPRLMLAW
MNTYAVRFNS PEIPVGDSAS EFLRMLGQKN ITGGERGTFT NFRKQVQALS ACRMTLGFNA NGRAHTYEGK PIKHFEAWIN LEEKQRALWP GSVTFSQDYY
LTLKDHAVPL DLRAFMELKG SALDLDVYAW LAQRLHRIEG RPVVLYWTNL RDQFGQEYQG KEADKDFKKK FLPSLRRVLA VYPDAKVKQV TGGIMLMASP
PPIPYKGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
zeta Zeta TnXca1 1188 8412-9599 -
Class:   Passenger Gene
Sub Class:   Toxin
Target:   murA cell wall synthesis
Sequence Family:  UDP-N-acetylglucosamine kinase (Pfam:PF06414)
Comment:   UDP-N-acetylglucosamine kinase
Protein Sequence:  
MDEKRFQLST RKHTAAYEKI ERHHFKDTAP ADQPQAIILG GQPGAGKSGL LEASKQGFAD RNVVTINGDE LRYYHPQYRD IQKADERRFA ELTDPHARPW
TKQLFDRTIE TRRNVVFEGT MREAGPITET MRRLKEAGYY VVARVIAANE RDSMAGIHRR YEEQKAAKGF GRWSNVQAHD DAYKGMPATL EYIEHNKLAD
RVQVYDRKGN VLYDNELQGN EWKRQPAAKT AIEAERERPP TPEERRQQEA EWATILAMMT ARRADEREIE RVRDVARQYG GQQYPEHKPA EYERQDYGRQ
QPELRAPETG KTYQGPIVSA DDKHVIQSVR EAGRELHIQH ERLVLNSDRR ELLNAGTNVE IRYPYNRVGI VKEWGAKEIQ GPASKGIEPK DFGKR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
epsilon Epsilon TnXca1 264 9606-9869 -
Class:   Passenger Gene
Sub Class:   Antitoxin
Sequence Family:  Epsilon_antitox (Pfam:PF08998)
Protein Sequence:  
MNTPLSPIAK TARLEAATET LAEYIGYLNS EIDAEQDKAE PNAGRIEALE HELEIVVDER RAITPDNLSL INRALYVYAP LLKPMHG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
PIN PIN TnXca1 411 9894-10304 -
Class:   Passenger Gene
Sub Class:   Toxin
Target:   single stranded RNA
Sequence Family:  PIN (Pfam:PF01850)
Comment:   tRNA(fMet)-specific endonuclease
Protein Sequence:  
MARMKRYMLD TNTVSHLVKS HPAVSRRVIE VPMTALCMSA ITGGELMFGL AKVPDAKRLQ QAVMELLRRV DVLPWDGAVM ERYGSVRADL EKQGKALGSL
DMLIAAHALE TDSVLVTNDA AFSRVVGLTV EDWTRS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
abrB AbrB TnXca1 261 10292-10552 -
Class:   Passenger Gene
Sub Class:   Antitoxin
Sequence Family:  abrB
Protein Sequence:  
VSQVAKLFIN GRSQAVRLPA AYRFTEKEVF IRQDPETGDV ILSRKPATWE DFFIALKSAD VPANFLDAAE RNQGTQDRDP FAGWRE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnPsy42 like TnpR TnPsy42 like TnXca1 567 10742-11308 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   94% identity
Protein Sequence:  
MVLIGYARVS TAEQDTALQT DALRKAGCAR VFEDTASGAK ADRPGLADAL AYLRAGDVLA VWRLDRLGRS MQHLIETIAA LEARGVGFRS LTESIDTTTP
GGRLIFHVFG ALGQFERDLI RERTKAGLTA AAARGRKGGR KPVVTADKLQ RAREHIANGL NAREAATRLK VSKTALYAAL QSTSAADS

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRint TnXca1 9857-9894 GGGGAGTGTT CATGGTCTTT ATCCTCGGTG ATGCACGT

 References