Transposon
Name: TnXc5       (Synonyms: Tn7214)
Family: Tn3        Group: Tn3
Evidence of Transposition: no
 Host     

Host Organism:Xanthomonas campestris pv. citri XAS450 1
Date of Isolation:1989

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTTCGGGGAGCAATGGAACAGGGAAGTCAGTTAAG
IRR (Length: 39 bp)GGGTTCGGGGAGCAATGGAACAGGGAAGTCAGTTAAGCC

 Sequence     
DNA SequenceLength  6938 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTTCGGG GAGCAATGGA ACAGGGAAGT CAGTTAAGCC TTCACCAGTG CCGGTCTGTA CCTTCCATGC GGGCGTGGCT CTCTGAGAAA CAGTGGCGGT 100
CATCCGCACC GCAGGCGATG TCGGTTAGCA AATCGTTCAC GGCTTCATCC AGCTCTTCAT CCGTGTCATA GGGCACCTTC AGTTCATATT CCCCGTTCGG 200
CCGCCGCGTG GCATCGTATT GGGCAAGATC AAAAAACTCG ACATGCTCGA TCGAGCGCTT CTTTCCGCGC ACGAACTTGC TATTGTTCTC GATGCGCAAG 300
GTCAGCAGGA TGGTGGCGAC CTTCGGCTGG TCAGCGTTTC CGCTCTCGAC CACGGAGACG TTTATCGGCG ACTGCGCCGA TTGTTTGTAC GGGCCGATCT 400
CTACGCCGCG ATGCCGCAGG TAGCTGTACA GCGTGCTCTT GGACAAGTGC AGTTTCTGCG CAATGGCAGC GACCGACAGC TTGCGCTCGC GGTATAGGGT 500
CTCGGCCGCC AGCGCTGTCG CTTCGGCCTG CGGCGACAGG CCCTTGGGTC GCCCACCGAC CCTGCCACGC GCCCGCGCGG CCGTCAGCCC GGCCTGGGTG 600
CGCTCGCGAA TTAGCTCGCG CTCGAACTCG GCCAGCGTGG CGAACAGGTT GAACACGAAC CGCCCTTGGG CGCTGGTGGT GTCGATGGGG TCATTCAGGC 700
TGAGCAGCCC GACCTTGCGT TCCATCAGGC TACCCACCAA CTCAACCAGG TGCTTGAGTG AGCGTCCCAT GCGGTCGAGT TTCCAGATCA CCAGCACGTC 800
GCCGCCACGC AACTGGCCCA GCAGTTCATC GAGCGCTGGG CGCGCGGTCT TCGCGCCGCT CGCAACGTCC TGATAAATGC GCTCGCAGCC GGCCGCCTTG 900
AGGGAGTCCA CCTGCAAGGC TGGGTTCTGT TCGCGCGTGG ATACGCGCGC ATAGCCGATT TTCATCGTAA TATTTTGCTT TACTCGTTAA TTTTTAATAA 1000
TATCAAACTT TGATTGTACA AACCACTATT ACAGACTGCT TGTTGGCTTA CGGACACCTC GCGCCGATCG CCCCATCAGA GTTCATAAAA ACGATCGTTT 1100
TATTGAACCG TTGCAAAAAA AACCGCTTAA AGAGTGTATA AACACCGATG TGCATAAACT CTGATTGGAG AGAGCTTCAT GAATACCGTG CGCTGGAACA 1200
TCGCCGTATC GCCGGACGTG GATCAGTCCG TCCGCATGTT CATCGCCGCG CAAGGCGGCG GTCGCAAGGG CGACCTGTCA CGCTTCATCG AGGATGCGGT 1300
GCGCGCCTAC CTCTTCGAGC GGGCTGTGGA ACAAGCCAAA GCCGCTACGG TGGGTATGGG TGAGACAGAA CTGAACGACC TCATTGATGA GGCGGTGCAA 1400
TGGGCGCGTG AGCATTAATG CGGGTCGTCC TCGACACCAA CGTATTGCTG GCCGCGCTGA TCTCGTCGCA CAGCCCACCC GACATCATCT ATCGCGGTTG 1500
GCTTGCAGCA CGCTTTGAAC TGGTGACAGG GACGGCGCAG CTTGATGAAC TGCGCCGCGT GAGCCGTTAC CCGAAGATCA AGGCAATCCT GCCCGCGCAT 1600
CGCGTCGGCA CGATGATCAA CAACATGCAG CGCGCCGTTG TGCTGCATGT ATTGCCGCCT CTGCCTGATC GCATCGAGGT CAATGATCCG AACGATGCGT 1700
TCCTGCTGGC GATGGCACTG GCCAGCGAGG CCGATTACCT TGTGACTGGC GACCGCCGCG CTGGGCTGCT GCAACGCGGT AGCATTGGCC GCACGCGCAT 1800
CGTCACGCCA GTCACCTTCT GCGCCGAGGC GCTTTGACGC CATGCCGGTC AGCTTCCTGT CCACCACACA ACGGGAACGC TACGGCCGCT ATCCAGACAC 1900
GCTTTCCAGC GAAGAGCTGG CGCGCTATTT CCACCTGGAC GACGATGACC GCGAGTGGAT CGCCACCAAG CGACGCGACA GCAGTCGCCT CGGTTATGCG 2000
CTGCAACTGA CCACGGCGCG GTTTCTCGGC ACCTTTCTGG AAGACCCTAC CGCCGTGCCA AGCCCGGTGC TGCATACGCT GTCGTCGCAA CTTGGCATCG 2100
CCGACCCTTC CGATTGCGTC ATTGACTACC GGACAACTCG GCAGCGCTGG CAGCACACGA GCGAGATTCG CACCCGCTAT GGCTACCGCG AGTTCACGGG 2200
TACCGGCGTC CAGTTCCGCC TTGGCCGCTG GTTGTGCGCG TTGTGCTGGA CGGGCACTGA CCGCCCGAGT GCGCTGTTCG ACTACGCCAA CGGCTGGCTG 2300
GTCGGCCACA AGGTGCTGCT ACCCGGCGTC ACCTTGCTGG AGCGCTTTAT CGCCGAGATA CGCTCACGCA TGGAGTCGCG TCTGTGGCGA CTACTGGTGC 2400
ACGGCGTGAC ACCCGAGCAG CGACAACGCC TCGATGACTT GCTCAAGCTT GTCGAAGGCA GCCGGCAGTC TTGGCTGGAT CGATTGCGCA AGGGGCCGGT 2500
ACGCGTCAGC GCTCCGGCGC TCGTTGCGGC CTTGCTGCGA ATCGAAACCG TGCGTGGCTT GGGCATTAAG CTGCCAGGCA CCCATGTGCC GCCGAGCCGC 2600
ATCGCAGCGC TGGCCCGCTT CGCCAGTACT GCCAAGGTAT CCGCCGTGGC TCGATTGCCG GAGGTGCGAC GCATCGCCAC GCTAGTGGCC TTCGTCCACT 2700
GCCTGGAAGC CAGCGCGCAA GACGATGCCA TCGATGTGCT CGACCTGCTG CTGCGCGAGC TGTTCACCAA GGCTGAGAAA GAAGATCGTA AGGTCAGGCA 2800
GCGCTCCCTC AAGGATCTGG ATCGGGCCGC CTCGACGCTG GCCGAGGCAT GCCGGATGCT GCTCGATCCG GCCCTGCCGG ACGGCGAACT GCGCGAGCGC 2900
GTCTATGCCG CCATCGGCCA CGATGAACTG GCCCAGGCGC TCAATGAAGT GCGCGGTCTG GTGCGCCCGC CCAACGATGT GTTCTACACC GAACTGGAAG 3000
CCCGCAAGGC CACCGTCTCG CGCTTCCTGC CGGCGTTGCT GCGCGTCATC CGCTTTGACG CCAATCCGGC CGCGCAACCT TTGGCGCAGG CGTTGCAATG 3100
GCTGCATGAG AAGCCCGACC ATGATCCGCC CACGGCCATC GTCGGCAAGG CGTGGCAACG CCATGTCGTT CAGGATGATG GCCGCATCAA TGCCACAGCC 3200
TATTCGTTCT GCGCGCTCGA CAAGCTGCGC AGTGCGATTC GCCGCCGCGA CGTGTTCATC AGCCCGAGTT GGCGCTACGC CGATCCACGC GCCGGGCTGC 3300
TGGCCGGAGC TGAATGGGAG GCCTCGCGGC CTATCGTCTG CCGCTCGCTG AGCCTGTCGG CGCAGCCCGA GGCCACGTTG TCCGAGCTGA CGCGCGAGCT 3400
GGACGAAACC TACCGCCGCG TCGCCGCGCG CCTGCCCCAG AACGACGCAG TGCGCTTCGA GAACGTTGGC GACAAGACGG AACTGGTGCT CAGTCCGCTT 3500
GAAGCATTGG AGGAGCCGCC TTCATTGATC GCGCTGCGCA ACGAAATCAA GGCGCGCATG CCGCGCGTCG ATCTTCCGGA AATCCTGCTG GAAGTCGCCG 3600
GTCGTACTGG CTGCATGGAA GCGTTCACGC ACCTGACTGA ACGCACCGCG CGCGCGGCCG ACCTGACCAC CAGCCTGTGC GCGGTGCTGA TGGCCGAAGC 3700
CTGCAACACC GGCCCGGAAC CACTGGTGCG GCCAGACACT CCGGCGCTCA AGCGCGACCG GCTGATGTGG GTCGATCAGA ACTATGTGCG TGACGACACG 3800
CTGACAGCCT GCAATGCCGT GCTGGTGGCC GCGCAAAGTC GTATCGCACT GGCGCGAACC TGGGGAGGTG GCGATGTGGC TTCGGCCGAC GGCATGCGAT 3900
TCGTGGTGCC GGTGCGCACG ATCCACGCTG GACCGAACCC AAAGTATTTC AATCGCGGGC GCGGCGTCAC TTGGTACAAC TTGCTTTCCG ATCAGCGCAC 4000
CGGACTGAAC GCGATCACTG TGCCTGGCAC GCTGCGCGAC AGTTTGATTT TGCTAGCGGT TGTGCTGGAG CAGCAAACGG AGTTGCAGCC GACCCAGATC 4100
ATGACCGACA CCGGCGCGTA CAGCGATTTG GTGTTCGGTT TGTTCCGCCT CTCCAACTAT CGATTCTGCC CGCGCCTGGC CGATGTTGGC GGTACCCGTT 4200
TCTGGCGCGT CGATCCCGAC GCCGACTATG GCGACCTCAA TGCGCTGGCC CGGCAGCGTG TGAATCTCGA CCGTATCACC CCGCATTGGG ATGATGTGCT 4300
GCGTCTGGTC GGCTCGCTCA AGCTCGGTCT GGTTCCGGCG ATGGGCATCA TGCGCACCTT ACAGGTCGAT GAACGGCCCA CCAGCCTGGC GCAAGCCATC 4400
GCCGAAATCG GCCGTATCGA CAAGACCATC CACACGTTGA ATTTCATCGA CGACGAAGCC CGCCGTCGCG CCACGCTGCT GCAACTGAAT CTCGGTGAAG 4500
GCCGCCACAG CCTGGCGCGC GAGGTTTTCC ACGGCAAGCG CGGCGAGCTG TTCCAGCGCT ACCGCGAAGG GCAGGAAGAC CAGTTGAGCG CGCTCGGCCT 4600
GGTCGTGAAC ATGATCGTGC TTTGGAACAC GCTGTACATG GATGCGGTGC TGACGCAGTT GCGCAGCGAA GGCTACCCCG TGAAGCCAGA AGACGAGGCA 4700
CGGCTGTCGC CGTTCGGCCA CGAGCACATC AACATGCTCG GACGCTATTC GTTCTCGGTG CCGGAAGCTG TCGCGCGCGG CGAGCTGAGA CCGTTGACCA 4800
AACCGAATGA TCCTTAAAAA CCTTGGAGAT TCACCATGCA ACAAATGACG CAACAACCGT TGAACGATGC CCAGCTTGAT CGGCTGGGCG ACTTTCTCGA 4900
AGGAGTCGGC GCACCTGCAA TGAATCTCGA AATGCTCGAT GGGTTCTTTG CCGCACTCAT TTGTGGTCCA GAAACTGAGG TTTCCCCACA TTTCTTCCTG 5000
CGAGATCAAG CGCTTGGTGG GCCAGGCGGT GGAAGAAGGT GCGCGCATGG GGCACGCTTC AAGGTGATTA AGCCAGAGAA GAGTGCCGAC CATGCGCGCC 5100
AGCGAAGTAT TGCAGAAGTG CCTGTCTAAC TCACTCTCCG GGATGCATGC GTTACGCCAA CGTACCTTGC TGGGCGCGGT TGAAGCGCTA GTGCACGGGG 5200
GCCGACTGAC GCTGATCGAC ATCGCACGCG CGTGGCCTGG CGCGACGCGG GTACGTGCGC CCCTCAAGGC ATGCGACCGC CTGCTGTGCA ATCGCACGTT 5300
GCAGGCCGAG CGATCCATGA TCGAGCGGGA CATGGCGCAT TGGCTGTTGC GCGGCGACCA GCCGGTGATC GTCATCGACT GGAGCGATTT GAAGCCGGAC 5400
AAGTCATGGT GTCTGCTGCG CGCAGCCGTG CCGATCGGTG GACGCACACT CACCTTGCTG GACATGGTGG TTGCCGGGAA ACAGCAGGGA TCGCCCGGCG 5500
CGGAAAAACG CTTCTTGCAA CAGCTCAGGC GAATGATTCC AGACGATGTG CGTCCGATCC TGGTCACGGA CGCCGGATTC CGCACGCCAT GGTTTCGCGC 5600
GGTGTCGGCG ATGGGCTGGG ATTGGGTCGG GCGTCTTCGC GGACGCACGC AGGTCAAACC GCAAGACGTG CCCGATGATG CAGCGCAATG GATCGATAGC 5700
CGACGCCTGC ATGCATTGGC GTCCAACCGT GCATGCGAAT TGCCACCGAT GCAGGCCAAT CGCAGTGATC CACTCGATTG CCGTCTGGTG CTCTATGCCA 5800
AGACACGTCT GGGACGTCAG CAACGCAACC GCCGCTCGCC AGCGAAGGTC TCGCGTGCAT CCTCCAGCTT GAAAGCAGCG GCGCGTGAAC GCGAGCCGTG 5900
GTTGATCGTT GCCTCCCCAC AGTTACAAGC ACCCAGCGCG AAACACTTGG TCAATCTGTA CGCACGAAGG ATGCAGATCG AGCTGGCATT TCGTGATCTG 6000
AAGTCGCATC GCTACGGTCA GGCGATGGAA GACAGCCTGA CCCGTCGCGG CGAGCGGTTG CAGATCCTGT TGTTGCTCAA CACACTGGCC ACCTTTGCCA 6100
GTTGGCTGGC AGGACTGGGA TGCGAAGCCA CCGGTATCGC CCAGTGGCTA TCGCCACGCA GCAGTACACG CAAGCTCTAC TCGACACTGC GTGTCGGCCG 6200
CCAGGCGCTG GCCAGGCGCT GGCCGATGGA ACCTGTCTCA CGCTGGCTAG AACGCTTACG TACACTGCCC GAAGCAGTGC GTGAGCAGAT GACGCTGGTG 6300
CTTTAAAAAC GTGGGGATAC CTAAGGTCCA GAAACGGTTT TGCCCAGCGA ACACTTGCCA CAAGTATTCG GGGAAGACCA TTGCTTCGAC AGCAATGACC 6400
AAGCCGCCGA AATTCTTGGC TTGGTCATGC GGCACTGGAA CACGATTGCA TCAGAATTGT TCCGCACTCT GGAGAAAGAC GATGTCTACC TTCCCGTGCT 6500
ACTCGAAGAT GCGGATGGGG CCGTACACGG TAACGACTGG GCACGTGGTT TCATGCGCGG CATTCAATTA CGGCCCAATA GTTGGCAAGA GTTGATCGGC 6600
AGCGAAGAAT TTGGCGGGCC CATGCTGCCA ATCATGATCT TGACCCATGA ACATGATCCT GATCCCGCCA TGCGCCCGCC AGAGATTGCG CCGGACAAAC 6700
GCGATGAGTT GCTTCAGTCC CTGATTGCCG GACTGACGCA CATCTATCGC TACTTTGCCT CACATCGCCA ATTGGCAACC CAAGGGCCTT TACGCAGACA 6800
AGGTCCTAAG ATTGGGAGAA ATGATCAGTG CCCATGTGGC AGTGGGCGGA AGTACAAGCA TTGCTGTGCT ACCAGCGCTC CGACATTTCA TTGATACCGG 6900
CTTAACTGAC TTCCCTGTTC CATTGCTCCC CGAACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 973-1112 140 TTTTGCTTTA CTCGTTAATT TTTAATAATA TCAAACTTTG ATTGTACAAA CCACTATTAC
AGACTGCTTG TTGGCTTACG GACACCTCGC GCCGATCGCC CCATCAGAGT TCATAAAAAC
GATCGTTTTA TTGAACCGTT
res_site_III 973-1001 29 TTTTGCTTTA CTCGTTAATT TTTAATAAT
res_site_II 1005-1040 36 AAACTTTGAT TGTACAAACC ACTATTACAG ACTGCT
res_site_I 1080-1112 33 AGTTCATAAA AACGATCGTT TTATTGAACC GTT

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnpR TnXc5 42-965 Accessory Gene Resolvase -
RHH_6 TnXc5 1179-1418 Passenger Gene Antitoxin +
PIN_3 TnXc5 1418-1837 Passenger Gene Toxin +
tnpA TnXc5 1842-4817 Transposase   +
secC 5'-end TnXc5 4836-4975 Passenger Gene Plant Pathogenicity +
tnp ISXac1 5092-6306 Transposase   +
secC 3'-end TnXc5 6326-6894 Passenger Gene Plant Pathogenicity +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnXc5 924 42-965 -
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MKIGYARVST REQNPALQVD SLKAAGCERI YQDVASGAKT ARPALDELLG QLRGGDVLVI WKLDRMGRSL KHLVELVGSL MERKVGLLSL NDPIDTTSAQ
GRFVFNLFAT LAEFERELIR ERTQAGLTAA RARGRVGGRP KGLSPQAEAT ALAAETLYRE RKLSVAAIAQ KLHLSKSTLY SYLRHRGVEI GPYKQSAQSP
INVSVVESGN ADQPKVATIL LTLRIENNSK FVRGKKRSIE HVEFFDLAQY DATRRPNGEY ELKVPYDTDE ELDEAVNDLL TDIACGADDR HCFSESHARM
EGTDRHW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
RHH_6 RHH_6 TnXc5 240 1179-1418 +
Class:   Passenger Gene
Sub Class:   Antitoxin
Sequence Family:  RHH_6 (Pfam:PF16762)
Protein Sequence:  
MNTVRWNIAV SPDVDQSVRM FIAAQGGGRK GDLSRFIEDA VRAYLFERAV EQAKAATVGM GETELNDLID EAVQWAREH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
PIN_3 PIN_3 TnXc5 420 1418-1837 +
Class:   Passenger Gene
Sub Class:   Toxin
Target:   single stranded RNA
Sequence Family:  PIN_3 (Pfam:PF13470)
Comment:   tRNA(fMet)-specific endonuclease
Protein Sequence:  
MRVVLDTNVL LAALISSHSP PDIIYRGWLA ARFELVTGTA QLDELRRVSR YPKIKAILPA HRVGTMINNM QRAVVLHVLP PLPDRIEVND PNDAFLLAMA
LASEADYLVT GDRRAGLLQR GSIGRTRIVT PVTFCAEAL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnXc5 2976 1842-4817 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPVSFLSTTQ RERYGRYPDT LSSEELARYF HLDDDDREWI ATKRRDSSRL GYALQLTTAR FLGTFLEDPT AVPSPVLHTL SSQLGIADPS DCVIDYRTTR
QRWQHTSEIR TRYGYREFTG TGVQFRLGRW LCALCWTGTD RPSALFDYAN GWLVGHKVLL PGVTLLERFI AEIRSRMESR LWRLLVHGVT PEQRQRLDDL
LKLVEGSRQS WLDRLRKGPV RVSAPALVAA LLRIETVRGL GIKLPGTHVP PSRIAALARF ASTAKVSAVA RLPEVRRIAT LVAFVHCLEA SAQDDAIDVL
DLLLRELFTK AEKEDRKVRQ RSLKDLDRAA STLAEACRML LDPALPDGEL RERVYAAIGH DELAQALNEV RGLVRPPNDV FYTELEARKA TVSRFLPALL
RVIRFDANPA AQPLAQALQW LHEKPDHDPP TAIVGKAWQR HVVQDDGRIN ATAYSFCALD KLRSAIRRRD VFISPSWRYA DPRAGLLAGA EWEASRPIVC
RSLSLSAQPE ATLSELTREL DETYRRVAAR LPQNDAVRFE NVGDKTELVL SPLEALEEPP SLIALRNEIK ARMPRVDLPE ILLEVAGRTG CMEAFTHLTE
RTARAADLTT SLCAVLMAEA CNTGPEPLVR PDTPALKRDR LMWVDQNYVR DDTLTACNAV LVAAQSRIAL ARTWGGGDVA SADGMRFVVP VRTIHAGPNP
KYFNRGRGVT WYNLLSDQRT GLNAITVPGT LRDSLILLAV VLEQQTELQP TQIMTDTGAY SDLVFGLFRL SNYRFCPRLA DVGGTRFWRV DPDADYGDLN
ALARQRVNLD RITPHWDDVL RLVGSLKLGL VPAMGIMRTL QVDERPTSLA QAIAEIGRID KTIHTLNFID DEARRRATLL QLNLGEGRHS LAREVFHGKR
GELFQRYREG QEDQLSALGL VVNMIVLWNT LYMDAVLTQL RSEGYPVKPE DEARLSPFGH EHINMLGRYS FSVPEAVARG ELRPLTKPND P

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
secC 5'-end N TnXc5 140 4836-4975 +
Class:   Passenger Gene
Sub Class:   Plant Pathogenicity
Comment:   interrupted by ISXac1 insertion
Protein Sequence:  
MQQMTQQPLN DAQLDRLGDF LEGVGAPAMN LEMLDGFFAA LICGPE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp Tnp ISXac1 1215 5092-6306 +
Class:   Transposase
Function:   transposition
Transpoase Chemistry:   DDE
Protein Sequence:  
MRASEVLQKC LSNSLSGMHA LRQRTLLGAV EALVHGGRLT LIDIARAWPG ATRVRAPLKA CDRLLCNRTL QAERSMIERD MAHWLLRGDQ PVIVIDWSDL
KPDKSWCLLR AAVPIGGRTL TLLDMVVAGK QQGSPGAEKR FLQQLRRMIP DDVRPILVTD AGFRTPWFRA VSAMGWDWVG RLRGRTQVKP QDVPDDAAQW
IDSRRLHALA SNRACELPPM QANRSDPLDC RLVLYAKTRL GRQQRNRRSP AKVSRASSSL KAAAREREPW LIVASPQLQA PSAKHLVNLY ARRMQIELAF
RDLKSHRYGQ AMEDSLTRRG ERLQILLLLN TLATFASWLA GLGCEATGIA QWLSPRSSTR KLYSTLRVGR QALARRWPME PVSRWLERLR TLPEAVREQM
TLVL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
secC 3'-end N TnXc5 569 6326-6894 +
Class:   Passenger Gene
Sub Class:   Plant Pathogenicity
Comment:   interrupted by ISXac1 insertion
Protein Sequence:  
VQKRFCPANT CHKYSGKTIA STAMTKPPKF LAWSCGTGTR LHQNCSALWR KTMSTFPCYS KMRMGPYTVT TGHVVSCAAF NYGPIVGKS* SAAKNLAGPC
CQS*S*PMNM ILIPPCARQR LRRTNAMSCF SP*LPD*RTS IATLPHIANW QPKGLYADKV LRLGEMISAH VAVGGSTSIA VLPALRHFI

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
ISXac1-NC_003919 ISXac1 Insertion Sequence 4976-6325 1350

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRL ISXac1 4976-5025 TGAGGTTTCC CCACATTTCT TCCTGCGAGA TCAAGCGCTT GGTGGGCCAG
IRR ISXac1 6276-6325 TCACGCACTC GTCTACTGCG ACCACGAAAT TTTTGCACCC CTATGGATTC

 References