Transposon
Name: TnXax1.2       (Synonyms: Tn7208)
Family: Tn3        Group: Tn4651
Evidence of Transposition: no
 Host     

Host Organism:Xanthomonas axonopodis pv. citrumelo F1
Date of Isolation:2011

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 46 bp)GAGGGTCGGCAGGGATTCGTGTAAAAGACAGCCAAAAGTGAGCTAA
IRR (Length: 45 bp)GAGGGTCGACAGGGATTTGTGTAAAAAACAGCCAAAATTGAGCTA

 Sequence     
DNA SequenceLength  13544 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GAGGGTCGGC AGGGATTCGT GTAAAAGACA GCCAAAAGTG AGCTAACTCG CTGTCATCAA AGAATTTTTC ACAACCTTTC GCCGATCGTC CATGCGGGTC 100
CGGGATCGCC TCCATGTCTG CGCCTCACCC GGTCGTCGAG GGTTGCCAGG ATCACCCGAA GTTGTGTACT GCCATGCGGC CTCGGAAGCT ATGTAGTCGC 200
CCCTGAAAAA CCCCCAGACC ACATCCATTG CAAGGCTTCA TCTGCGTTAT CGGTGTGCTG GAATTGCCAG TTTTCGTTAC GCTACGTCCT GGTTTCTGGC 300
AGTTTTCGCC CATGCGTACA CGGCGTCCTG CCGCCGAGCA GTTGCCTGCC GATGAGCTGT TTCGTTCGCG TCTGGAGAAC CAGATCGACT TGCGCCATCC 400
ACTGGTCCAG CTGATTCATC GGCTGCCGTG GAGTGCGTTG GAGCAGGCGC TGTCGCCGCG GTTGCCGGCT ACCCCCGGCA CAGGCGGTCG GCCCGCACTG 500
CCGGTGCGCC TGATCGCCGG CTTGCTCTAC CTCAAGCACG CCTACGGCCT GTCCGATGAA GCGGTGTGCG AGCGCTGGCT GGAAAATCCT TATTGGCAGT 600
TCTTCACCGG TGAGGTGGTG TTCCAGACCT GCTTGCCGTG CGATCCCAGC TCCCTGACAC GTTGGCGACA GCGCCTGGGC GAAGCCGGGA TGGAAGAGCT 700
GTTGGCGCAC ACCATCAACA CCGCTTATGT GATGAAGGCA GTGGATGGTA ATCCCCCCAT CCCCGGCATC GGAGATGGGG GGATGCGCTA TTTGCCATAT 800
GGCTTGCTAG AGAAACGTCT TCACCATTCA ATTGCTAGGG GCATCACGAT TGTTTCGAGC CTCTGCCCAA CTAAAGTTCC GTGATTTTAG ATACAACACG 900
GGTTGGCACC CCGTCGACAT CAATTTCCCT GCCCACGTCG TCACGCTGCG CGTTGACGAT CACCCCCTTG AGTACACGGC TCTTTGGCTC CGCAACACTC 1000
TTTAATTGCT TGATATCGGA GGGTTGATCG CCGTAAGAGG TTATCGGCAC ATTAGGTTGA ACCGAGAGCC GCTCAAGGCT CTCTGCCAAT CTCGTTGAAT 1100
CTGGTTTTTT GTCGATCCGT TCAATGGTCG TGGAATCCGG ATGGGCGTAA ATTGCTGCCT CTGAAAGAGT AGCCCGTAGT GCTTCTTCGT CACTGCCATT 1200
CAATGAATTG ATAAGTCGCT TCTGCAAATC TTCAGGCATT TGAGAAGGGG GCAAATGCGA CTTTTCAAGG GTGACTTCTT CCGCGCCGGA CACCACGTCA 1300
AAGTAGTGCA TCATGCCAAG ATGATTGATC TCGTTTTCCA ACGACGCCCC CCCGATTTTG AGTAGCACCT CAGTTTGGAG TCCAATTCCC TAACTCGAGG 1400
AGATTGGACG TGAAGAAGCG TTTTTCTGAA GAACAGATCA TCGGCTTCCT GCGCGAAGCT GATGCCGGTG TGGCGATCAA GGACCTGTGC CGGCGGCATG 1500
GCTTCAGCGA GGCTTCCTAT TATCTGTGGC GCAGCAAGTT CGGCGGGATG AGCGTGCCCG ATGCCAAGCG GCTCAAGGAC CTTGAGTCCG AGAACGCGCG 1600
GCTGAAGAAG TTGCTGGCCG AGCAGCTGTT CGAGAACGAC CTGATCAAGG ATGCACTGCG AAAAAAGTGG TGAGCGCACC GGCGCGTCGC ATGCTGGTGC 1700
GCGAGTGGAT CGGGCGTGGT GCCAGCGAGC GTCGTGCGTT GGCAGTGATC GGCATGAGCG CCAGTGCGCT GCGATATTGC CCGCGCGAAG ATCGCAACGT 1800
CGAACTGCGC GAACGCATCT GTGCGTTGGC GCATCGCCAT CGCCGTTATG GTGTGGGGAT GATCTATCTC AAATTACGAC AGGAAGGACG CATCGTGAAC 1900
TACAAGCGTG TGGAGCGGTT GTACCGCGAG CAGCAGCTGC AGGTCCGGCG CCGCAAGCGC AAAAAGGTGC TGATAGGAGA GCGTCAGCCG CTGCTGCGGC 2000
CATCGCAGGC CAATCAGGTG TGGTCGATGG ATTTCGTGTT CGACCGCAGC GCCGAAGGCC GAGTGATCAA GTGTCTGGTG ATCGTGGACG ATGCAACCCA 2100
CGAAGCGATC GCCATCGAGG TGGAGCGCGC AATCTCGGGC CATGGCGTGA CACGCGTGCT GGATCGGCTG GCGCACAGTC GCGGCTTGCC ACAGGTGATC 2200
CGCACAGATA ACGGCAAGGA GTTTTGCGGC AAAGCGATGG TGGCCTGGGC ACATGCGCGT GGCGTGCAGT TACGGCTGAT CCAGCCTGGC AAGCCAAACC 2300
AGAACGCCTA CGTCGAATCG TTCAATGGCC GGCTGCGCGA CGAATGCCTC AACGAGCACT GGTTCCCAAC CCTGCTGCAT GCGCGTACCG AGATCGAACG 2400
CTGGCGACGC GAATACAACG AGGAGCGACC CAAGAAGGCC ATTGGCGGCA TGACGCCATC TGCGTATGCC CAACAGCTGG CCAACACCGA TATCATCAAC 2500
CCCGGACTCT AAACCCGGCC GCTACTCAGA GCGGGGGGAC GTCGCCAAAT CGCCATGGCC GCGATTACTG ATCAATATGA CGCGAGAATT CGCATTGCGT 2600
GATTTCTCCA GAATTTCTTT TGCGCCAGGA AGTAGGGAAA GCTCAATATC CGGGAACGGA ACATCTCGAC TATAATTTTT TTTCGAAACT TCCGGCTTTA 2700
CTAGCATTTT ATATTCGCGG ACAAAGTTAG AGTATACGGC ATTATTTATC GACGCTGCTT TATGCTCAGA AATTCCTGGG AGCATTTTCC GAACAAAATC 2800
TTCAATTATG TGGCGCTTAT ATATGCTTTG CCTACCCATC AAATAAGATG AAAAGTCTTT TTGATTTTTC ATCAGCAATG GCGCTTCCTC GTCGACCGGT 2900
TCTGCATCGT TCAACTTGCT GTGCAGGACC GCTACGGCAT CTCCGAGTTC AGGCAATGTC GACGCATGTT CCCTTGCTGT GATAGCCAAC GCGTTATGCA 3000
TAAGCTTATA ATTCAATCCT TTTTCGTCAC GAAGACAGTC GTCCCAATCC AATACGACGA CCTGTTTTAC CTCAGACGCT TGGATTGAGG AACGGCTCGC 3100
CAAACTAACT TGGTCGAGCT CTTTCACGAT TTCATCAGGT GAAGCAGGTT TCATTTTCAA GATAGGAATA AGCGAATCAT GCTCACCTTC GAGAACTTTC 3200
GCATCATCTA CGAAGTGACG CGCAGAATCC GTCCCTGCCA TCTCTTGCAT GGAACTTAGT TTTTGCATTT GCTCAAGCGT ATCTGGCGCG TCCGGGTCTA 3300
TCCCTACATT GTGAAGATGG GCTCTTTTGA ACAAGTTATT TTGAATTGAC TCGAATCTTA AGATTGCCGA ATCGCTGGCC GGATCTATTG CGTAGGCGAT 3400
TAAAATCATC GCTTCGCTGT TGGTTAACTT CTCACGCGGC ATTCCGATTG CGGCAAGGCG TTCAGTAACC TTTCCTTGAG GATCCCAAGC TGCTAGGGTT 3500
TCGTCTAAAA AAGCGCTGAC CTCGGAGGAC ATGGTAAGTT GCGGTGAAAA TGGATGGGCG CTCAGCGTTG CAAGAGCAAG CACGTCCACA CCTGCCTCCT 3600
TGGCTGCTGC TTCCATTGCC AGCATAGATC CTCCTGCCTG AATGTGGTCA TCGGTAATGA CAACTTTATC GCCACGTTTC AGGTCGGATG TAACGAAATA 3700
AGGCTGCTGT ACCAAACGGC CAATCGGACT CGCTTCTGTA CGCGAGGTTC TTGAAAGACC CACGAGGGAC TTATGATCTG TAAATACAAT AGGCTTTCTG 3800
TCCTCCTTCT TAGCTGAAAT AGCTTCTAAG GAGTTCAGTG AACTGGCCAG CTCTGTTTGT TCGCAGAAGG TAAAGAAGTT CAATGTACTA TCTTCGGCAT 3900
AGTGATCACG CGTCGGCCTT AGCAAATGAA CCACACCACC TTCATCGCCT AAAGCCTCAA CTACATGGCG ATGCAGACGT GCGACGTATT CTCCACGAGA 4000
TTTATCGATT GTCGCTGTAG CCGCGAAAGC TCGAATAGCA CGTGTTCCCT GACTCTGAGT ACTTAACAGC GGGCTGGTTT TTAGTCTGCC GAGTTTGCTA 4100
TTTTCGCCCT CGATTGGTTC ATCGGTGAAT AAATCTCGAC CACGCTTTCC CACATGTCTA ACTGCATAAT AGTCCTGCTT TCCCTGCGAG AGGCTTTTCA 4200
CTGATTGTAA AGATGGCTTC TCAGTAGCAA ATTCGCTAAA AAAGAGAGGC GCTTTCCCCG ATTCATTCCG TGAATGGTAG TTTTGCGAAT CTACACGTTC 4300
TGCAGAACCT AGGCTTTGGG TAGAGAGAAG AAACTGACCT TTTCCAACGT CGTTCGAGCG ATTCTCGGCA ATCATCTTAT TGACCGCCTG AAGATCACTG 4400
CTAGAAGTTG GCATTTTAGA TGGCTTACGA TCAAGAGGGC GGAGCCCCTT TAGTTGGGCG CTTAATGCCG CATCCTTTGG AATTTCGCTA TTGCGTCCCA 4500
CTGGAATTGG AGTTTTTGGC TGCAAATCCC CCTGAGGAAA TTGGCCAGTA TAATGAGACT TGCTTGCACT ACTTGTTTTC ATCAAGATTC ACTCCTATTG 4600
ATTAAACTAC CCCCTGATTT GCTTGGCTGT ATAATTCAAA AAATTTTCTT GACTTTATTT AAATGGCCCA TAAGCACTCA ACAACGCCTC AAATAAATTA 4700
TTATTTTCCT GGCGCCCTTG CATGCTTCCG CTAATAAAAA AGGTCCTTGT ATGAAGAACG TAGACGGACT GAAATATTTT AGCTTTGCGG TATCAGTAGA 4800
CGCACACTTA AGAGAAAAAA CCCGTCTGAG AGCGAATATT TGATTCTGCA GGACGGTGAC GCTTTTAACA AAAAAGGGTT CCTGATTAGC CCTGACCTTC 4900
AGCCGCCAGT CGCAGATCTG CGCCGCGCTG GGTGGATGCT GCTGTCACTC TGAAGCCAAC GAGGTGACGT GATGAGCATC AATGCGGTGC AGTTCCAGGC 5000
TGGATTGTCG ATGCCTGAGT TCTTCGCGTT CTACGGCACC GAGGCCAAGT GCTATCGCGC GCTCTACACG TGGCGTTGGC CGCAGGGCTT TCGTTGCCCT 5100
GTTTGTGCCG GGCGCGTGCG CTCGCGTTTC AAGCGGCGTG CTGCGATCTA CTACCAATGC TGCGCGTGCC GGCATCAGAC CAGTCTGATG GCAGGCACGA 5200
TGTTCGAAGG CACCAAACTG CCGCTGCGCA CCTGGATGCT GGCCTTGCAC CTGTTGACCT CGACCAAAAC CAACATGGCC GCACTGGAGC TGATGCGTCA 5300
TCTGGGGGTT AACTACAAGA CGGCCTGGCG GATGAAGCAC AAGATCATGC AGGTCATGGC CGAGCGTGAA GCCACGCGGA AATTGGCGGG TTTCGTGCAG 5400
ATCGACGATG CCTATCTCGG CGGCGAGCGT AACGGTGGCA AGGCCGGACG CGGATCAGAG AACAAACAAG CGTTCCTGAT TGCGGTGCAG ACCGATGCCA 5500
CCTTCACCGC GCCGCGCTTT GTGGTGATTG AGCCGGTGCG CAGCTTCGAC AACACCTCGC TGCAGGACTG GATTGCCCGT CGCCTGGCGC CCGAATGCGA 5600
GGTCTACACC GATGGGCTGG CCTGCTTCCG CCGGCTGGAA GACGCCGGCC ACGCGCACAC CACGCTGGAC ACTGGCGGTG GTCGTGCCGC GACCGAAACG 5700
GCCGGTGCAC GTTGGCTCAA CGTGGTGCTG GGCAATCTCA AACGCGCCAT CAGCGGCGTG TATCACGCTA TCGCGCAAGG CAAATACGCA AGGCGCTACC 5800
TGGGAGAAGC GGCCTATCGT TTTAATCGTC GATTCCGCTT GCGCGAGATG CTGCCGCGAC TTGCCACGGC CATGATGCAA TCCAACCCAT GTCCAGAGCC 5900
GGTCCTGCGT GCAGCGAGCA ATTTTCATGG CTGAGAGTCA GGGCTAATCA GGTAAAATTT TTCATATAAG ATCACCATGT GTTAGGTGGA TATACTGTAG 6000
GAGCAAGTTT AGAGGGGAAC TTTCCGATTC GCTCCGCCTC ACCGAATCCT GGCTGGGAGG ACGAAGGCAC TGACGTGGAG GATTCCCGAG CCTTCGCCAA 6100
GTGGCTGATC ATTTGCCTGC CGGCATTGCA CCGGCTGCGA TGGCGTTTTC GAGTTCGCCA ACGGAGTGCG CCAGCCGCAG CTGCGCCAGG AGTTGTTCCA 6200
ACGTGCTCAG GCGCACCGTG GCCCGCAAGG TGTCCGCCTC GGCGTGTTCC CGGCGCTGGC GCTCTTCGAC CAGTTCGGTC CGCGCCGCCG ACAGTTCGGT 6300
GCGCACGCCT TCCAGCGCAT GGACATCTTG GGTCCAGCGC ACCTGCAGGG CTTGGTGCTC GGCGGCCGCC AGGCGCAGCG CGTCGCGCTC GCGTTGCTGG 6400
GCGTCGGCCC GCTGGCGTGC CTGCGCCAGT TCCCGCTCCA GCCGGGTCTG GCGTTCCAGC CACTGGCCGT TTTCCCGGTT GAGCTGCATC AGGTCGTGGT 6500
TCTTGGCGGT CAATGCCTCG TTGGCCTGCC GTAGGGCGAC CTGCAGCTCC TGCACCTGGT GCTCATGCCG GCGCTGTTCC TGCTCGCGCT GGTCCTTGAC 6600
CGAGGTGCGG TAGTGCTCAA GGGCTTCCCT GGCGTGTTCG TGCTTGTGTT CCAACGATTT CGCATGGGCG TCGTGCTCGG CCAATCGCGC CGTGAGGCCC 6700
GCGATCCGCT CCTCCAGCTG GGCCAGTTCG GTGGTGCGGC GGGCCACTTC GCTCCTGGCA GCGTCGCCCG CCTCGCGTTC GGCCTGCAGC GCGGTCTCGC 6800
AGCGTTGCAG CTGCGTCATG AGTGAGCCGG CCTCGTGTCG GGCCTGCTCC AGCGCTTGGG TGCGTTCCTG CAGCTGCGCC TGGAAGCGCG CCTGGGCCTG 6900
CGCCACGACC GTGTCGGCCT CGCTGTGCAA CCGCTCGGCG AGGCGGGCGA TGAGGTCTTG AAGTGCGTCG CTCACGGCCA TTTTCGCGCC AACGCCTTGC 7000
CCTTCCTCCT CTTCCAACTC CCTCAAATAG CGGTGGATGG TGGTCTTGGA CCCCGTGTTG CCCAGCGCCA CCCGGACCGC GTCCACGGAC GGATGCGTGC 7100
CCGTGGCGCG CAGGCGATCG CGGGCACGTT GCACATCGCT TTTGTACAGC CCGGACCTTG CCATCCGGCA CTCCACGTAT TTCGTAACAT ATTACATACC 7200
ATGTAATTAC ATACTCCTCA ATGCATTAAA TGAACCGTCG ATAGGCGTTG AACTCACGCG GGATAATCTA GAATTATCCC GCCTTATGCG GAATTTTCGG 7300
CTACAGTCGC CCTGCGGTCG TACGAAACGG CGGTTCGGAG CGACGCGGTG AGCTCGGTCA AGCAGTATCT GGAAGCGGCA ACTCGCGCCA ACACCGAGCG 7400
CGCGTATGCA GGGGCGATCC GTCACTTCGA AGTCGAATGG GGTGGTCATC TGCCGGCGAC TGCGGAGCAG GTGGCGTGCT ACTTGGCCGC CTACGCCGGG 7500
CAACTCGCGC TCAACACACT CAGGCACCGG CTCGCAGCAC TGGCGCAGTG GCACCAGGTG CACGGCTTTG CCGACCCGAC CCGGGCACCG GTGGTGCGCC 7600
AAGTGCTCAA GGGCATCCAG ACCTTGCATC CGAGTGTCGA AAAACGCGCC ACGCCCCTGC AGCTCACTCA ACTGGGCCAG GTCACGACAT GGCTGGAAGA 7700
CGCTGCGGCC GCAGCCCGGT CTCGCGGCGA TCGTGCCTCG GAGCTGCGGC ATCTGCGCGA TCGTGCCTTT CTACTGCTGG GCTTCTGGCG CGGCTTCCGA 7800
GGCGATGAAC TGGCCCGCCT ACAGGTAGAC CACCTGCGCC TCGTGCCAGG CGAAGGCATG ACCTGCTTCC TGCCGCACAG CAAGGGTGAT CGCCGACACG 7900
CCGGTACGAC CTACAAGGTC CCTGCGCTGT CGCGATGGTG CCCGGTAGCA TCGACTTCTA GCTGGATCGC TGCAGCCGCG TTGACCGATG GCCCGGTGTT 8000
CCGTGCGATC AACCAGTGGG GCGGTGTCGC CGACACTGCC TTGCACCCCA ACAGCCTGGT GCCGCTGCTG CGGCGCATCT TCGGTGAGGC CGGCTTGGCG 8100
TCACCGAATA CCTACAGTGG GCATTCGCTG CGGCGCGGCT TCGCCGGCTG GGCCAACGCC AACGGCTGGG ACGTCAAGGC GCTGATGGAG TACGTCGGCT 8200
GGCGCGACGT GCACTCGGCG ATGCGTTACC TAGACGGGGC CGATCCGTTC GCCCGCCAGC GCATTGAGGC GAGCCTGTCG CCAGCCACAC CACCGCTGCT 8300
GGCCCTGGCG GCGCCGGCTC CCGATCCAGT GCCGACCACG GCGGTCGAAG CGACTGTCAC CCTGACGCGC TTCAACTCGC GTGTGCGCGG ACTGGCCAAA 8400
GCGCATCGGC TGATCGAGCA AATCTGCCTG CAACCGCATC AGGCGCAGCG ACTCAACGCC GACGGCACGC GCTACCGGTT GGCGATCGCC GCCGTTGACG 8500
AGGCGGCCTT TGAAGAAACC ATCGCAATGC TGCTCGACGA GATGCACCGC ATCGCCGACA ACCACCAGTG CTTCCTCGCC GTCGCCTTGC GCGATGAAGC 8600
GGGCGGGCGC CATTGGGACT GAGCTGGGCA TGACGACGCT GCACGAAACC GCCTACCCGC GCCTCAAGCC CGATCCCACC GCCAAAGAAC TCCAGGATAT 8700
CTACACGCCT ACTGCGGCGG AGCTGCAGTG CGTCCGGAAC ATCGCTACCG GCCCGGCCAC ACGGCTGGCC CTGCTACTGC ATCTGAAGCT GTTCCAGCGC 8800
CTGGGTTATT TCACGACCCT GATCGAGGTG CCCGAACGTA TCGTGCAGCA TGTCGCTCAG ACGCTGGGAA TGCGCCGCGT GCCCGCCGAC CGGTTGGCGG 8900
GCTACGACGC CTCCGGCGCC AAGCGCGGGC ATCTGGCCCA ACTGCGGGCG TTCCTCAACG TCTGTCCGCT CGATGCGGCT GGGCGAGACT GGCTCGGCAC 9000
CGTGGCTGAA ACGGCTGCGC GGACCAAGCA CATCGTGCCC GATATCGTGA ACGTGATGCT TGAAGAGCTG GTGCATCACC GCTTTGAGTT GCCGGCCTTC 9100
AGCACGCTCG AACGCATCGC GATCGCCGCC CGCGAACGTG TCCACGATGC GCACTACCGC CAGATCGCCG ATGCGTTGTC ACCGACCATG CGGACGCTGA 9200
TCGATAACCT GCTGCTGACA CCACCAGGCA GCCACCACAG TGATTGGCAC ACGCTCAAGC GCGAGCCCAA ACGCCCAACC AACAAGGAAG TGCGCCATTA 9300
CCTGCGGCAC ATCCAGCGCC TGCGCATCCT GGCCGAGCAG CTGCCGCCGA TCGATGTTTC GGTGCCTAAG CTCAAGCAAT TCCGGGCGAT GGCCCGCGCA 9400
CTTGATGCCG CCGAGTTGGC CGAACTGGTC CCGATCAAGC GCTATGCGCT GGCCGCGATC TTCATCCGCT CCCAGTATCG CAAGACGCTC GACGATGCGG 9500
CCGACCTGTT CATCCGCCTG ATCCAGAACC TGGAGAACAC TGCGCAGCAA AAGCTGATCG CTTATCAGCT CGAACACAGC AAACGGGCCG ATGCCCTGAT 9600
CGGCCAGCTC CGGGAGATCC TGCAGGCCTA TCAGGTCGAG GGCACAGACA CCGAGCGTGT GGGCGCGATC GCGGGCGTGC TGGTCGCCGA CATCGCTCTG 9700
CTGACGGCTG AGTGCGACGA GCACATGGCC TACGCCGGCC GCAACTATCT GCCATTCCTG CTGGCACCAT ACGGGACGTT GCGTCCGCTG CTGTTCAACT 9800
GCCTGGAAAT CATGGGCCTG CGTGCCGCCA GCCAGGACCC CAGCATGGAG CGCATGATCG GCGCTGTCCT GGCGCTGCGC AGTCAGCGCC GCGAGACGAT 9900
CGACGCCGCT AGCCTGGGCG TGGCTACAAC CGACCTGACG TGGTTATCGT CAGCCTGGCG CAAGCATGTG ATGCCCAAAG CCTTGGCCGC CGCCAGCCCC 10000
GGCTGGATCC ATCGCAAGTA CTTCGAACTG GCGGTGCTCG CGCAGATCAA GGACGAACTC AAATCCGGCG ACCTGTACAT CCCGCACGGC GAGCGTTACG 10100
ACGACTACCG CGAGCAACTA GTCGACGAGG CGACACTCGC GCAGGAACTG GACGCCTACG GCGAGGTCTC GGGCGTCGCC ACCGACGCGG CTGACTTCGT 10200
GCAGGGTCTG CGCACCGAAC TGACGACATT GGCCGATGCC GTGGACGCTC GGTTCTCGGA CAACCTGCAC GCCAGCATGC TCGACGGGCG GCTGGTGCTC 10300
AAGCGCCTGC AGGGCGCACA GGTGACCCAG GCCATCGCCA CAGTGGACAG CGCGATCACC GACCGGCTGC CGCCGACCAG CATCGTCGAT GTCCTGGTCG 10400
ACACCACCCG CTGGCTGGAC CTGCACGTGC ACTTCCGCCC GATCGCCGGC ACCGACGCGC GAGTCGACGA TCTGCTGCGG CGCGTGATCA CCACCTTGTT 10500
CTGCTACGGC TGCAATCTGG GGCCGACCCA GACCGCGCGT TCGGTCAAGG GCTTCAGCCG GCGCCAGATC TCGTGGTTGA ACTTGAAGTA CGTCACCGAT 10600
GAAACGCTCG ACAAGGCGAT CGTCCAGGTG ATCAACATGT ACAACAAGTT CGAGTTACCC GGCTACTGGG GCAGTGGCAA GAGCGCCTCG GCCGACGGCA 10700
CGAAGTGGAA CGTGTACGAG CAGAACCTAC TGTCGGAATA CCACATTCGC TACGGCGGCT ATGGTGGCAT CGGTTACTAC CATGTGTCCG ACAAGTACAT 10800
CGCGTTGTTC AGCCACTTCA TCCCGTGTGG CATACACGAA GCGGTCTACA TCCTCGACGG GATGCTGGCC AACCGGTCCG ACATCCAGCC CGACACCGTA 10900
CACGGCGACA CCCAGGCGCA GAGCTTCCCG GTATTCGGGC TGGCGCATCT GCTGGGCATC AACCTCATGC CGCGCATCCG CAACATCAAG GACCTGGTGT 11000
TTTCCCGGCC GGAGCCAGGT CGGACCTACG AGAATATCCA GGCGCTGTTT GGGGACAGCA TCGACTGGAC ACTCATCGAG ACCCACGTGC ACGACATGCT 11100
GCGGGTCGCC ATCTCGATCA AACTGGGCAA GATCACCGCT TCCACCATCC TGCGCCGGCT CGGCACCTAC AGCCGCAAGA ACAAGCTGTA CTGGGCATTT 11200
CGCGAACTGG GCAAGGCGGT ACGCACACTG TTCCTGTTGC GCTACATCGA CGATGTCGAA GTGCGCAAGA CCATCCACGC CGCCACCAAC AAGAGCGAGG 11300
AGTTCAACGG CTTCGTCAAA TGGGCCTTCT TCGGCGGTGA AGGGATCATC GCCGAGAACG TCCAGCACGA ACAGCGCAAG ATCGTGCGTT ACAACCAGTT 11400
GGTGGCCAAC CTGGTCATCC TGCACAACGT GGAGCAGATG ACCCGCGTGC TGGCCGAGCT GCGGGACGAG GGCTCAAACA TCAGCCCGGA AGTGCTGGCC 11500
GGCCTGTCGC CGTATCGGAC CAGCCATATC AACCGGTTCG GTGACTACAC CTTGGACCTC AAGCGGCAGG TCGAGCCAAT CGATTTCTCG CGGAGAATTC 11600
TTGCGGCGAC AACGCGTTAG GACGCAATCA GCTGTTTTTT TTTACCGGGC GAATTCCTGC TTGCCCATCG CGGTCAAAAA CGCATAACTG CAATAATTAC 11700
ATCCTGGGAA CAGGAGGACT AGAGTGGCCG CTCAACCACC ACCTCGGGTA TCTCATGATC ATGCCTTCGC GCCTTTTGCG TTTAACGCTC GGTGTCAGCG 11800
TCTGTGTGGC CGCAACCAGC GTAGCAGCGC AAGCCATCGC TCCCGAAACA ACCGCATCCT CCGCAACCGA CGCCGGTGGG CAACAGCAGG ATCCCGCACC 11900
CACTTCGAGC TTCGAACAGT GGCTGGCAGA CTTCCGCCAA CGTGCGCTTG CCGCCGGCAT TGGAGCCACC ACGCTGGATA ACGCATTGGC TGGTGTCACA 12000
CCCGATCCAG CGGTGCATGA ACTGGATCAG CGGCAACCCG AATTCACCCA GTATCTATGG GACTATCTCG ACGCGCGTGT CACACCTGCG GCCATCCAGG 12100
AAGGACAGCA GCTGCTGATC AGCCAGCACG CCCTCTTCGA GAAGTTGCGG CAGCACTACG GTGTGGATCC GGGCATTCTG ACCGCCATCT GGAGCATGGA 12200
AAGCGGGTAC GGCAAGCAGA TCGGGGACTT TTATGTCATT CGCTCCCTGG CGACACTGGC CCATGAGGGA CGGCGCACCA CGTATGGCAA CACGCAGCTG 12300
CTTGCGGCCC TGCAGATCCT GCAGACGGAA AAAAGCATTG ATCGCTCGCA ACTGGTGGGT TCGTGGGCCG GCGCCATGGG ACAGACGCAA TTCATTCCGA 12400
GCACCTATCG CGACTACGCC GTCGACGAGG ATGGCGACCA GAAGCGGGAT GTCTGGAATT CCAAGGCGGA CGCTTTGGGC TCTGCGGCGA ATTATCTCAA 12500
GCAGAACAAT TGGACCAGCG CTGTTCCCTG GGGCCAGGAA GTCCAGCTGT CAGCCGGCTT CGACTACGCG CAAGCCGACC TGACGATCAA GAAGACCGTC 12600
GCCGAATGGC AGCGCCTGGG CGTGGCGCCC CGCAGGCCGA TTGCGCCCGC ACTGGCGCAG CAGTTGGCAT CGGTGTTGTT GCCCACCGGA TACCGCGGCC 12700
CGGCCTTCCT AGTGTTCGAT AACTTCCGCA GCATTCTGCG CTACAACAAT TCCACCGCCT ATGCCCTGGC GGTCGGCTTG CTGGCAGACG GCTATGCGGG 12800
CAGGGCCGGG GTCGAGCAAC CCTGGCCCAA AGACGATCCG CCGCTCAATA GCACGGCCCA GATCACCGAG CTGCAGCAGA GGCTGACCGA CAAGGGATTC 12900
GACGTGGGCG GCATCGACGG TGTGCTGGGG GCGCAAACTC GCCAGGGAAT CCGTGCATTC CAGCGTAGCC AGCAATTGCC GCAGGACGGT TACGCCAGTA 13000
CGTCGCTGCT GGCCCGTCTG CGGGCCCCCT GATCGGGGAT ATCCCTCACC TTGGCCATGC TTCAAAATAT TTAAATGTTA ACCAACAACG AGGCATTAAG 13100
CATGCTAAGA AAATCAATAA TTTTAGCTAA AATATCGTCA TTTCTCGCTG CAATAGCATT CGGATTCCTT TTTTTATCGA TATCGGCCCC AAGCCAGGCA 13200
GACGATTTGG GGGCAGTTTC TGTGCATGGT GACATTCAAC CCGCCAATCC TACAGATAAT CAGGTGCGGA GCGCGCACCA GCAGCAAGCT TTGGGTAAAT 13300
GCAAACAACA GTTTGTAAAT TCCAGCTCTG CATATTTAGC GAGTTGGGCC GTTACTGCAG GGGGGAAGCA TCCCGATTAC TGGAATATCA ATAGCGTCTG 13400
GATTTGCTCA AGTGGCTAAG ATGAATTGCC CATCTTGATG GTCGATAGGG GTTGAGGGCC GGCAGGAAGT TGTGAAAAAC TTCTTTTCTA ACAGAGATTT 13500
AGCTCAATTT TGGCTGTTTT TTACACAAAT CCCTGTCGAC CCTC

 Recombination Sites     

Name Coordinates Gene Sequence
res_acc_IR2 7197-7205 9 TACCATGTA
res_acc_IR2 7254-7267 14 TCACGCGGGA TAAT
res_acc_IR1 7273-7286 14 ATTATCCCGC CTTA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnp_p ISXca5 312-747 Transposase   +
orfAB IS1404A 1410-2512 Transposase   +
orfA IS1404A 1410-1673 Accessory Gene Regulator +
orfB IS1404A 1691-2512 Transposase   +
xopC N-ter TnXax1.2 2522-4582 Passenger Gene Plant Pathogenicity -
tnp IS1595 4972-5934 Transposase   +
tnpT TnXax1.2 6109-7164 Accessory Gene Resolvase -
tnpS TnXax1.2 7348-8622 Accessory Gene Resolvase +
tnpA TnXax1.2 8594-11620 Transposase   +
mltB TnXax1.2 11755-13032 Passenger Gene Plant Pathogenicity +
AEO42412.1 TnXax1.2 13075-13419 Passenger Gene Hypothetical +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp_p Tnp_p ISXca5 436 312-747 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MRTRRPAAEQ LPADELFRSR LENQIDLRHP LVQLIHRLPW SALEQALSPR LPATPGTGGR PALPVRLIAG LLYLKHAYGL SDEAVCERWL ENPYWQFFTG
EVVFQTCLPC DPSSLTRWRQ RLGEAGMEEL LAHTINTAYV MKAVD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfAB OrfAB IS1404A 1103 1410-2512 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   produced by -1 translational frameshifting between orfA and orfB
Protein Sequence:  
VKKRFSEEQI IGFLREADAG VAIKDLCRRH GFSEASYYLW RSKFGGMSVP DAKRLKDLES ENARLKKLLA EQLFENDLIK DALRKKW*AH RRVACWCASG
SGVVPASVVR WQ*SA*APVR CDIARAKIAT SNCANASVRW RIAIAVMVWG *SISNYDRKD AS*TTSVWSG CTASSSCRSG AASAKRC**E SVSRCCGHRR
PIRCGRWISC STAAPKAE*S SVW*SWTMQP TKRSPSRWSA QSRAMA*HAC WIGWRTVAAC HR*SAQITAR SFAAKRWWPG HMRVACSYG* SSLASQTRTP
TSNRSMAGCA TNASTSTGSQ PCCMRVPRSN AGDANTTRSD PRRPLAA*RH LRMPNSWPTP ISSTPDS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfA OrfA IS1404A 264 1410-1673 +
Class:   Accessory Gene
Sub Class:   Regulator
Comment:   regulatory protein
Protein Sequence:  
MKKRFSEEQI IGFLREADAG VAIKDLCRRH GFSEASYYLW RSKFGGMSVP DAKRLKDLES ENARLKKLLA EQLFENDLIK DALRKKW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfB OrfB IS1404A 822 1691-2512 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MLVREWIGRG ASERRALAVI GMSASALRYC PREDRNVELR ERICALAHRH RRYGVGMIYL KLRQEGRIVN YKRVERLYRE QQLQVRRRKR KKVLIGERQP
LLRPSQANQV WSMDFVFDRS AEGRVIKCLV IVDDATHEAI AIEVERAISG HGVTRVLDRL AHSRGLPQVI RTDNGKEFCG KAMVAWAHAR GVQLRLIQPG
KPNQNAYVES FNGRLRDECL NEHWFPTLLH ARTEIERWRR EYNEERPKKA IGGMTPSAYA QQLANTDIIN PGL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
xopC N-ter XopC N-ter TnXax1.2 2061 2522-4582 -
Class:   Passenger Gene
Sub Class:   Plant Pathogenicity
Protein Sequence:  
MKTSSASKSH YTGQFPQGDL QPKTPIPVGR NSEIPKDAAL SAQLKGLRPL DRKPSKMPTS SSDLQAVNKM IAENRSNDVG KGQFLLSTQS LGSAERVDSQ
NYHSRNESGK APLFFSEFAT EKPSLQSVKS LSQGKQDYYA VRHVGKRGRD LFTDEPIEGE NSKLGRLKTS PLLSTQSQGT RAIRAFAATA TIDKSRGEYV
ARLHRHVVEA LGDEGGVVHL LRPTRDHYAE DSTLNFFTFC EQTELASSLN SLEAISAKKE DRKPIVFTDH KSLVGLSRTS RTEASPIGRL VQQPYFVTSD
LKRGDKVVIT DDHIQAGGSM LAMEAAAKEA GVDVLALATL SAHPFSPQLT MSSEVSAFLD ETLAAWDPQG KVTERLAAIG MPREKLTNSE AMILIAYAID
PASDSAILRF ESIQNNLFKR AHLHNVGIDP DAPDTLEQMQ KLSSMQEMAG TDSARHFVDD AKVLEGEHDS LIPILKMKPA SPDEIVKELD QVSLASRSSI
QASEVKQVVV LDWDDCLRDE KGLNYKLMHN ALAITAREHA STLPELGDAV AVLHSKLNDA EPVDEEAPLL MKNQKDFSSY LMGRQSIYKR HIIEDFVRKM
LPGISEHKAA SINNAVYSNF VREYKMLVKP EVSKKNYSRD VPFPDIELSL LPGAKEILEK SRNANSRVIL ISNRGHGDLA TSPRSE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp Tnp IS1595 963 4972-5934 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MSINAVQFQA GLSMPEFFAF YGTEAKCYRA LYTWRWPQGF RCPVCAGRVR SRFKRRAAIY YQCCACRHQT SLMAGTMFEG TKLPLRTWML ALHLLTSTKT
NMAALELMRH LGVNYKTAWR MKHKIMQVMA EREATRKLAG FVQIDDAYLG GERNGGKAGR GSENKQAFLI AVQTDATFTA PRFVVIEPVR SFDNTSLQDW
IARRLAPECE VYTDGLACFR RLEDAGHAHT TLDTGGGRAA TETAGARWLN VVLGNLKRAI SGVYHAIAQG KYARRYLGEA AYRFNRRFRL REMLPRLATA
MMQSNPCPEP VLRAASNFHG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpT TnpT TnXax1.2 1056 6109-7164 -
Class:   Accessory Gene
Sub Class:   Resolvase
Protein Sequence:  
MARSGLYKSD VQRARDRLRA TGTHPSVDAV RVALGNTGSK TTIHRYLREL EEEEGQGVGA KMAVSDALQD LIARLAERLH SEADTVVAQA QARFQAQLQE
RTQALEQARH EAGSLMTQLQ RCETALQAER EAGDAARSEV ARRTTELAQL EERIAGLTAR LAEHDAHAKS LEHKHEHARE ALEHYRTSVK DQREQEQRRH
EHQVQELQVA LRQANEALTA KNHDLMQLNR ENGQWLERQT RLERELAQAR QRADAQQRER DALRLAAAEH QALQVRWTQD VHALEGVRTE LSAARTELVE
ERQRREHAEA DTLRATVRLS TLEQLLAQLR LAHSVGELEN AIAAGAMPAG K

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpS TnpS TnXax1.2 1275 7348-8622 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Tyrosine
Sequence Family:  Tyrosine Site-Specific Recombinase
Protein Sequence:  
MSSVKQYLEA ATRANTERAY AGAIRHFEVE WGGHLPATAE QVACYLAAYA GQLALNTLRH RLAALAQWHQ VHGFADPTRA PVVRQVLKGI QTLHPSVEKR
ATPLQLTQLG QVTTWLEDAA AAARSRGDRA SELRHLRDRA FLLLGFWRGF RGDELARLQV DHLRLVPGEG MTCFLPHSKG DRRHAGTTYK VPALSRWCPV
ASTSSWIAAA ALTDGPVFRA INQWGGVADT ALHPNSLVPL LRRIFGEAGL ASPNTYSGHS LRRGFAGWAN ANGWDVKALM EYVGWRDVHS AMRYLDGADP
FARQRIEASL SPATPPLLAL AAPAPDPVPT TAVEATVTLT RFNSRVRGLA KAHRLIEQIC LQPHQAQRLN ADGTRYRLAI AAVDEAAFEE TIAMLLDEMH
RIADNHQCFL AVALRDEAGG RHWD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnXax1.2 3027 8594-11620 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MKRAGAIGTE LGMTTLHETA YPRLKPDPTA KELQDIYTPT AAELQCVRNI ATGPATRLAL LLHLKLFQRL GYFTTLIEVP ERIVQHVAQT LGMRRVPADR
LAGYDASGAK RGHLAQLRAF LNVCPLDAAG RDWLGTVAET AARTKHIVPD IVNVMLEELV HHRFELPAFS TLERIAIAAR ERVHDAHYRQ IADALSPTMR
TLIDNLLLTP PGSHHSDWHT LKREPKRPTN KEVRHYLRHI QRLRILAEQL PPIDVSVPKL KQFRAMARAL DAAELAELVP IKRYALAAIF IRSQYRKTLD
DAADLFIRLI QNLENTAQQK LIAYQLEHSK RADALIGQLR EILQAYQVEG TDTERVGAIA GVLVADIALL TAECDEHMAY AGRNYLPFLL APYGTLRPLL
FNCLEIMGLR AASQDPSMER MIGAVLALRS QRRETIDAAS LGVATTDLTW LSSAWRKHVM PKALAAASPG WIHRKYFELA VLAQIKDELK SGDLYIPHGE
RYDDYREQLV DEATLAQELD AYGEVSGVAT DAADFVQGLR TELTTLADAV DARFSDNLHA SMLDGRLVLK RLQGAQVTQA IATVDSAITD RLPPTSIVDV
LVDTTRWLDL HVHFRPIAGT DARVDDLLRR VITTLFCYGC NLGPTQTARS VKGFSRRQIS WLNLKYVTDE TLDKAIVQVI NMYNKFELPG YWGSGKSASA
DGTKWNVYEQ NLLSEYHIRY GGYGGIGYYH VSDKYIALFS HFIPCGIHEA VYILDGMLAN RSDIQPDTVH GDTQAQSFPV FGLAHLLGIN LMPRIRNIKD
LVFSRPEPGR TYENIQALFG DSIDWTLIET HVHDMLRVAI SIKLGKITAS TILRRLGTYS RKNKLYWAFR ELGKAVRTLF LLRYIDDVEV RKTIHAATNK
SEEFNGFVKW AFFGGEGIIA ENVQHEQRKI VRYNQLVANL VILHNVEQMT RVLAELRDEG SNISPEVLAG LSPYRTSHIN RFGDYTLDLK RQVEPIDFSR
RILAATTR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
mltB MltB TnXax1.2 1278 11755-13032 +
Class:   Passenger Gene
Sub Class:   Plant Pathogenicity
Target:   cell wall
Comment:   Membrane-bound lytic murein transglycosylase B precursor
Protein Sequence:  
MIMPSRLLRL TLGVSVCVAA TSVAAQAIAP ETTASSATDA GGQQQDPAPT SSFEQWLADF RQRALAAGIG ATTLDNALAG VTPDPAVHEL DQRQPEFTQY
LWDYLDARVT PAAIQEGQQL LISQHALFEK LRQHYGVDPG ILTAIWSMES GYGKQIGDFY VIRSLATLAH EGRRTTYGNT QLLAALQILQ TEKSIDRSQL
VGSWAGAMGQ TQFIPSTYRD YAVDEDGDQK RDVWNSKADA LGSAANYLKQ NNWTSAVPWG QEVQLSAGFD YAQADLTIKK TVAEWQRLGV APRRPIAPAL
AQQLASVLLP TGYRGPAFLV FDNFRSILRY NNSTAYALAV GLLADGYAGR AGVEQPWPKD DPPLNSTAQI TELQQRLTDK GFDVGGIDGV LGAQTRQGIR
AFQRSQQLPQ DGYASTSLLA RLRAP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
AEO42412.1 AEO42412.1 TnXax1.2 345 13075-13419 +
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MLTNNEALSM LRKSIILAKI SSFLAAIAFG FLFLSISAPS QADDLGAVSV HGDIQPANPT DNQVRSAHQQ QALGKCKQQF VNSSSAYLAS WAVTAGGKHP
DYWNINSVWI CSSG

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
ISXca5_p-CP002914 ISXca5 Insertion Sequence 196-747 552
IS1404A-U45994 IS1404A Insertion Sequence 1342-2544 1203
IS1595-AF249895 IS1595 Insertion Sequence 4881-5952 1072

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRL ISXca5 196-214 GTCGCCCCTG AAAAACCCC
IRint TnXax1.2 838-876 GGGGCATCAC GATTGTTTCG AGCCTCTGCC CAACTAAAG
IRL IS1404_TnXax1.2 1342-1370 CGACGCCCCC CCGATTTTGA GTAGCACCT
IRR IS1404_TnXax1.2 2517-2544 CCGGCGATGA GTCTCGCCCC CCTGCAGC
IRL IS1595 4881-4904 CCTGATTAGC CCTGACCTTC AGCC
IRR IS1595 5929-5952 CCGACTCTCA GTCCCGATTA GTCC

 References