Transposon
Name: TnSod9       (Synonyms: Tn7199)
Family: Tn3        Group: Tn21
Evidence of Transposition: yes
 Host     

Host Organism:Shewanella oneidensis MR-1 Molecular Source:MR-1 megaplasmid
Date of Isolation:2002
Other Geographic Information:American Type Culture Collection no 700550

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 39 bp)GGGGTCGCCTCAGAAAACGGAAAAAATCGTACGCTAAGC
IRR (Length: 39 bp)GGGGTCGCCTCAGAAAACGGAAAAAATCGTACGCTAAGC

 Sequence     
DNA SequenceLength  4412 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCGCCT CAGAAAACGG AAAAAATCGT ACGCTAAGCA TGCGCAGAGG CAGGGAGCCA GCGGTATAGC GTAGGAACCG ACACGCCAAG ATTCTTAGCC 100
ACATCCTTGG GGGGGACTCC ACTGGCTAAT AGCTTTTTGG CTGATTCGAT CTTGCTGTCG GTCATCTTCG GCTTGCGACC GCCTTTACGA CCGAGTTGTC 200
TGGCAACGTC CAACCCCGCA CGGGTTCTTT CGACGATCAA GTCTCGTTCC ATCTCTGCGA GGCTTGCCAT GACATGAAAA AAGAATCGGC CCGATGGCGT 300
GCCGGTATCG ATAGAATCGG TGAGACTCTT AAACTGGACG TTTTGTTTGT GCAGATCGCT GACCAGCTCT ACCAGTTGTT TGACTGACCG GCCCAATCTA 400
TCCAGCTTCC AAACAACCAA TGTATCCCCT TCGCGCAGTA TTTCAAGGGC TTTGCTCAAA CCAAGCCTGT CAGCCCGAGT ACCACTGATT GTATCTTCAA 500
ACACTTTTTC GCACCCCGCT TTAAGCAAGG CTTCTCGCTG AAGTTCTAGG TGCTGATCTT GTGTTGATAC TCTTGCATAA CCGATCAGCA TAAATCATGA 600
CCTTCATTTT TATCTACATC ATATCTAACC GCTGCCAGCT GCGATAATAA TGTTGGCAGC GCCGTTTGTA CCGTATCCCA AACCACATCA AGGTTTATAT 700
CGAAATAACC ATGAGCAATG CGATTGCGCA TTCCACGCAT ACTACGCCAT GGAACGTCTG AATGGGCAAT GACAAACTCA GAATAACCGT CCATCACCTT 800
AGTTGATGCT TCACCAATTA CGATCAGACT CATGATGACA GCCTGTTGGG TACGTTTATC CACTAAAAAT TCATCTTTAT CCAACCCTTC AACAAAATAA 900
CACGCATCGG AAGCGGCTTG GTGCATGTGG TCAAGATAAT CAGGTAAACG GTTCACCTTC ATACAGGTCG TGCCTCCGCG AGTACTTGGG CTCGAAATTT 1000
CGGTGGTAAA TCGCCAGGGG TCAGTAGATC AACTTGAAGG CCGAGCAGCG ATTCAAGTTC ATCTTGTAAA CCTCCCAAGT CAAAAAGTGT CGCTCCAGGG 1100
AGGGCATCAA CTAATAAGTC CAGATCACTA CCATCGAGAT CTGTCCCATC GAGCACTGAA CCAAAAACAC GTGGATTGGT TACGCGAAAA CGACTCGCGG 1200
TCTCACGAAT AACGCTTCGC TTAAGAGCGA GCACTGCGGA TGGTCTCATA ATGGCTATTT CCTTATTATC AAAACTCGTT GAAATGATAT GCAACTGAGA 1300
ATAATATTTC AAGAATGATT TTTGAGAATC ATAACCCCTT GATCTGCTGT TGTGTCCGAG AGCTCTTGTC GTTGCTCTTA CAAACCTACG TTTTCAAGAA 1400
GAAGGAAACC GCATGCCTCG CCGCTCAATC CTATCCGCCG CAGAGCGAGA CAGCCTGCTG GTGTTACCCG ATACCCAAGA CGAACTGATC CGCCACTATA 1500
CGTTTAGCGA ACCCGATCTA TCACTGATAC GGCAGCGGCG CGGTGATGCT AACCGCTTGG GGATCGCGGT ACAGTTATGC TTGCTGCGCT TCCCAGGCCA 1600
GGGCTTGTTG CCCGACGCTA CGGTGCCAAT GCCTCTGCTG CAATGGATAG GACAACAGTT ACAGCTCGAT CCTGTATGTT GGCCGCAGTA TGCCGAGCGA 1700
GAGGAGACAC GGCGCGAGCA CTTGCTCGAA CTGCGGGTGT ATCTTGGCAT GGAACCATTT AGTCAAGTGC ACCATCGGCA GGCTGTCCAT ACCACGACCG 1800
AACTGGCCTT GCAGACTGAC AAGGGCATAG TGTTGGCCAA CAGCGTAGTC GAGACGCTGC GTCATAAACA CATCATTTTG CCAACGTTAG ATGTTGTCGA 1900
GCGCGTCTGT GCCGAGGCTC TAACCCGTGC AAACCGGCGT ATCTACGACA CCTTGACCGA ACCACTATCA GGCTCGCACC GCCACCGGCT CGATGATCTG 2000
CTCAAGCTTC GGGACAACAA CAAAACGACT ACGCTGGCTT GGCTTCGCCT GTCTCCGGTC AAACCCAATT CGCGGCACAT GCTTGAGCAC ATCGAACGAC 2100
TCAAGGTATG GCAGGCGCTT GATCTTCCTA TTGGTGTCGA TCGTCTGATC CACCAAAACC GATTGCTCAA GATCGCCCGA GAAGGCGGAC AGATGACCCC 2200
CGCCGATTTG GCCAAGTTCG AGCCACAACG CCGCTATGCG ACTTTGGTTG CGCTAGCCAT CGAGGGGATG GCCACTGTTA CAGATGAAAT TATTGATCTG 2300
CATGACCGCA TCATGGGCAA GCTGTTCAAT GATGCCAAGA AGCGACATCA GAAACAGTTT CAGGCATCGG GGAAGGCTAT CAATGCCAAG GTGCGCCTGT 2400
TCGGCCGTAT CGGCCAAGTG TTGATCGACG CTAAGCAAGC GGGTGATGAT CCGTTTGCTG CTATCGAGGG CGTCATATCC TGGGAGGCCT TTGCCAAGAG 2500
CGTGACAGAG GCACAATCGC TCGCGCAGCC CGAGGAATTC GATTTCCTGT ACCGTCTCGG TGAGAGCTAC GCCACACTAC GCCGTTACGC ACCGACCTTC 2600
CTCACCGCGC TAAAGTTGCG GGCCGCACCG GCTGCCAAAG GTGTATTGGA GGCCATCGAA GTACTGCGCA GCATGAACAA CGACAACGCC CGAAAAGTAC 2700
CTGCAGATGC GCCAATTGAT TTCATCAAGC CGCGTTGGCA GAAGCTGGTG ATAACCGATA CCGGCATCGA CCGGCGTTAC TACGAGCTAT GCGCGCTGTC 2800
GGAGATGAGG AACGCATTGC GTTCCGGTGA CATCTGGGTA CAGGGATCGC GCCAGTTCAA GGACTTCGAG GACTACCTTG TACCACCCGC GAAATTCGTC 2900
AGTCTCAAGC AGACCAATCA ATTGCCGCTG GCCGTAGCCA CCGACTGTGA GCAGTATCTG AATGAACGGC TGACGCAATT GGAAACGCAG CTCGCCACCG 3000
TCAACAGCAT GGCGCAGGCT AACGAATTAC CGGATGCCAT CATCACGGCC TCTGGCCTAA AGATAACGCC GCTGGATGCA GTAGTACCAG ATACCGCGCA 3100
GCGCCTTATC GATCAGGCTG CTAGGATCCT GCCGCACGTC AAGATCACTG AGTTACTGCT TGAAGTGGAC GAATGGACGG GCTTTACCAG GCACTTCGCA 3200
CACCTGAAAT CTGGTGTTCT GGCCAAGGAC AAGAACCTGC TACTGACGAC TATCCTTGCC GATGCGATCA ATCTGGGTCT GACCAAGATG GCAGAATCGT 3300
GTCCAGGAAC GACTTATGCC AAGCTCGCTT GGCTGCAAGC CTGGCATATC CGTGACGAAA CCTATGGCGC GGCCTTGTCC GAGCTGGTCA ATGCGCAGTA 3400
CCGGCATCCG TTTGCCGAAC ATTGGGGCGA TGGTTCTACA TCCTCCTCTG ACGGCCAGAA TTTTCGCACC GGCAACAAGG CGGAGAGTAC GGGGCACATC 3500
AATCCGAAAT ATGGCAGTAG TCCAGGACGG ACCTTTTACA CGCATATTTC CGACCAGTAC GCACCATTTC ATACTAAGGT GGTCAATGTC GGTGTGCGCG 3600
ACTCAACCTA CGTGCTCGAC GGCCTGCTCT ACCATGAATC TGACTTACGG ATCGAAGAGC ACTACACCGA CACGGCTGGC TTCACCGATC ACGTTTTCGC 3700
GTTGATGCAC CTGTTGGGGT TTCGCTTCGC ACCGCGTATC CGCGACTTGG GTGAGACCAA GCTCTACATT CCAAAGCGCG ATGTCACCTA CGAGGGATTG 3800
AAATCAATGA TTGGCGGGAC GCTCAACATC AAGCTAATCC GTACACATTG GGACGAGATC TTGCGGCTGG CTACCTCGAT AAAACAGGGA ACGGTGACGG 3900
CCTCACTCAT GCTGAGGAAG CTTGGCAGCT ACCCACGTCA GAATGGCTTG GCGGTCGCCT TGCGCGAATT GGGGCGTATC GAGCGCACGC TGTTCATTCT 4000
GGATTGGCTG CAAAGTGTCG AGCTCCGCCG CCGGGTACAT GCCGGACTGA ATAAGGGGGA GGCTCGTAAC GCCTTGGCTC GTGCCGTGTT TTTCAATCGA 4100
CTGGGGGAGA TCCGTGACCG CAGTTTTGAG CAACAGCGTT ACCGGGCAAG TGGCCTTAAC TTGGTGACTG CCGCCATCGT GCTATGGAAC ACCGTCTATC 4200
TGGAAAGGGT GGCACATGGG TTACGTGCCA AGGGACATGC CGTCGATGAA GAGTTATTGC AGTACCTATC GCCGCTAGGC TGGGAGCACA TCAACCTGAC 4300
AGGGGATTAT CTGTGGCGCA GCAGCGCCAA GATAGGTTCA GGTAAATTCA GGCCTCTACG ACCTCTATCA CCGGCTTAGC GTACGATTTT TTCCGTTTTC 4400
TGAGGCGACC CC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnpR TnSod9 34-591 Accessory Gene Resolvase -
HEPN TnSod9 585-962 Passenger Gene Toxin -
mnt TnSod9 959-1249 Passenger Gene Antitoxin -
tnpA TnSod9 1413-4379 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnSod9 558 34-591 -
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MLIGYARVST QDQHLELQRE ALLKAGCEKV FEDTISGTRA DRLGLSKALE ILREGDTLVV WKLDRLGRSV KQLVELVSDL HKQNVQFKSL TDSIDTGTPS
GRFFFHVMAS LAEMERDLIV ERTRAGLDVA RQLGRKGGRK PKMTDSKIES AKKLLASGVP PKDVAKNLGV SVPTLYRWLP ASAHA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
HEPN HEPN TnSod9 378 585-962 -
Class:   Passenger Gene
Sub Class:   Toxin
Function:   antitoxin
Target:   RNA
Sequence Family:  HEPN (PDB:5YEP)
Protein Sequence:  
MKVNRLPDYL DHMHQAASDA CYFVEGLDKD EFLVDKRTQQ AVIMSLIVIG EASTKVMDGY SEFVIAHSDV PWRSMRGMRN RIAHGYFDIN LDVVWDTVQT
ALPTLLSQLA AVRYDVDKNE GHDLC

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
mnt Mnt TnSod9 291 959-1249 -
Class:   Passenger Gene
Sub Class:   Antitoxin
Function:   toxin
Sequence Family:  mnt (PDB:5YEP_A)
Protein Sequence:  
MRPSAVLALK RSVIRETASR FRVTNPRVFG SVLDGTDLDG SDLDLLVDAL PGATLFDLGG LQDELESLLG LQVDLLTPGD LPPKFRAQVL AEARPV

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnSod9 2967 1413-4379 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRSILSAA ERDSLLVLPD TQDELIRHYT FSEPDLSLIR QRRGDANRLG IAVQLCLLRF PGQGLLPDAT VPMPLLQWIG QQLQLDPVCW PQYAEREETR
REHLLELRVY LGMEPFSQVH HRQAVHTTTE LALQTDKGIV LANSVVETLR HKHIILPTLD VVERVCAEAL TRANRRIYDT LTEPLSGSHR HRLDDLLKLR
DNNKTTTLAW LRLSPVKPNS RHMLEHIERL KVWQALDLPI GVDRLIHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LAIEGMATVT DEIIDLHDRI
MGKLFNDAKK RHQKQFQASG KAINAKVRLF GRIGQVLIDA KQAGDDPFAA IEGVISWEAF AKSVTEAQSL AQPEEFDFLY RLGESYATLR RYAPTFLTAL
KLRAAPAAKG VLEAIEVLRS MNNDNARKVP ADAPIDFIKP RWQKLVITDT GIDRRYYELC ALSEMRNALR SGDIWVQGSR QFKDFEDYLV PPAKFVSLKQ
TNQLPLAVAT DCEQYLNERL TQLETQLATV NSMAQANELP DAIITASGLK ITPLDAVVPD TAQRLIDQAA RILPHVKITE LLLEVDEWTG FTRHFAHLKS
GVLAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHIRDET YGAALSELVN AQYRHPFAEH WGDGSTSSSD GQNFRTGNKA ESTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG ETKLYIPKRD VTYEGLKSMI
GGTLNIKLIR THWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERVAHGLRAK GHAVDEELLQ YLSPLGWEHI NLTGDYLWRS SAKIGSGKFR PLRPLSPA

 References