Transposon
Name: TnPsy39       (Synonyms: Tn7187)
Family: Tn3        Group: Tn3000
Evidence of Transposition: yes
 Host     

Host Organism:Pseudomonas syringae pv. actinidiae ICMP 9853 Molecular Source:plasmid p9853_A
Date of Isolation:2016

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 39 bp)GGGGTCCGGGGAGCAATGGAACAGCCAACCGACTTAAGG
IRR (Length: 39 bp)GGGGTCCGGGGAGCAATGGAACAGCGAACCGACTTAAGG

 Sequence     
DNA SequenceLength  3939 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCCGGG GAGCAATGGA ACAGCCAACC GACTTAAGGA GCCGCAGGAC TCTCCTGAGC TCACGGTAAT CTGCTCAATA CGCTGTCCGA AAGAGGATCG 100
CTCAACGGAC GCTGAGTAGT TAATCGCTAA TTCTCGTAAA TAGGCTCCAT CAGCCATCTC ATTTAGCTAG TACTAAATCT TTTGCAGTGA GGGTAGGTCT 200
TACGTTACAG TTTTTGCCAT GACGCAAACC CTGATTGGCT ATGCCCGCTG CTCGACCGAC AAACAAGACC TCGCTGCACA GCAGGAGGCC CTGCTGAAAC 300
TCGGTGTGGC ACCAGATCGT ATTTACACTG ACCCTGGGTT TACTGGGACA AACAGAGCGC GCCCAGGCCT CGATCAGGCC CTTGCGGCTG TGCGCAATGG 400
CGACACCCTT GTTGTCTCCA AACTTGATCG ACTTGCCCGC TCCGTTCCTG ATGCTCGCAC GATCGGTGAC AATCTTGCTG CTCGAGGAGT GAAGTTACAG 500
CTTGGGTCCA GCATTCATGA TCCGACTGAT CCCATGGGAA AGCTGTTTTT CAACATTCTC GCTACCTTCG CCGAGTTCGA GGCCGATTTG ATCCGAATGC 600
GTACTCGTGA GGGCATGGCG GTCGCACGAG CTAAGGGAAA ATTAAGAGGT AAGAAGCCCA AGCTCTCCGA TCGGCAACAA AAGGAGCTAC GGCGCATGTA 700
CGACACGAGT AACTATTCGA TCAGTGATCT GGCTGAACTA TTCTCAATCT CACGACCGAC AGTCTATCGC ACCCTCGCCC GGCAGGCGGT TTGATGTCAT 800
GCCAGTTAGC TTCCTGTCCT CTACCCAAAG GGAACGCTAC GGTTGCTATC CAGATAGGCT TTCCAGCGAA GAACTGGCGC GCTACTTCCA CTTGGACGAC 900
GATGACCGCG AGTGGATAAG CACTAAGCGA CGTGACAGCA ACCGACTCGG TTATGCGCTG CAATTGACGA CGGCACGCTT TCTTGGCACC TTTCTGGAAG 1000
ACCCTACTGC TGTTCCCTGC ACAGTGCTAC ATACGCTGTC GTCGCAGCTC GGCATCGCCG ACGCCAACTG CGTGCAGACC TACCGCGAGA GCGAACAGCG 1100
TTGGCGACAC ACGACCGAGA TTCGCGCTCG CTACGGTTAC CGCGAGTTCG TTGAACGTGG CATGCAGTTC CGCCTTGGCC GCTGGCTGTG TGCGCTGTGC 1200
TGGACGGGCA CAGATCGGCC AAGCGCTTTA TTTGACTACG CCAACGGCTG GTTGATCGGC CACAAGGTGT TGCTGCCAGG CGTCACGGTA CTTGAACGCT 1300
TCATCGCCGA GATACGCTCT CGTATGGAGT CGCGTCTGTG GCGTCTGCTA GTGCGTGGCG TGACGGACGA ACAGTGTCAG CGCCTCGATG ATCTGCTCAA 1400
GCTTGCCAGT GGCAGCCGCC AATCGAGGTT GGATCGGTTA CGTAAGGGGC CGGTGCGCGT CAGCGCCCCG GCACTTGTGA TGGCACTACA ACGCATTGAG 1500
ACCGTGCGTG GCCTGGGCAT CAAGCTTCCC GGCACCCATG TTCCGCCAAG CCGTATCGCA GCGTTGGCCC GCTTCGCTGG CACCGTCAAG GTGTCCGCCA 1600
TAGCTCGGTT GCCGCAGGTG AGGCGTATCG CCACATTAGT GGCATTCGTC CACTGCCTGG AGGCCAGTGC GCAGGACGAC GCGCTCGATG TGCTCGACTT 1700
ACTACTGCGC GATCTATTCA CCAAAGCTGA GAAGGAAAAC CGTAAGGTCA GGCAGCGTAC GATCAAAGAT CTCGACCGGG CGGCTTCAAC GCTGGCCGAA 1800
GCCTGCCGGA TACTGCTCGA TTGTGGTCTG CCAGACAGCG AACTGCGCGA GCGCGTCTAT GCGACGATTG GGCGCGATGC ACTGGCTCAG GCGCTTGACG 1900
AGGTTCGCGG CCTAGTGCGC CCACCCAACG ATGTGTTCTA CACAGAACTG GAGGGCAAGA AGGGCACCGT GACACGCTTC CTGCCGACGT TACTGCGCGT 2000
CATCCGCTTC GACGCTACCC CGGCCGCGCA GCCTCTGATA CAGGCATTGG AGTGGCTTCG CGAAAAGCCC GATCCCAATC CGTCGACCGC CATCGTCGGC 2100
AAAGCGTGGT TGCGCCATGT CGTGCAGGAC GATGGCCGGA TCAATGCTAC AGCCTATTCC TTCTGCACCC TCGACAAGCT GCGCAGCGCG ATCCGCCGCC 2200
GCGACGTGTT CATCAGTCCG AGTTGGCGCT ATGCGGACCC GCGTACTGGT CTGCTGACCG GTGCCGAGTG GGAGACCGCA AGGCCCATCG TTTGCCGTTC 2300
GCTGGGACTG AGCGTCCAGG CCGACGACAC TTTGACCGCA TTGACCCGCG AGCTGGACGA AACTTATCGG CGCGTTGCAG CACGCCTGCC CAAGAATGAC 2400
GCAGTGCGCT TCGAAACAGT CGACGACAAG ATCGAGCTAG TGCTCAGCCC GTTGGAAGCG TTGGAGGAAC CGCCTTCACT GATCGCGCTG CGCAACGCAA 2500
TCAAAGCACG CCTACCACGT GTCGATCTGC CGGAAATTCT TTTGGAAGTT GCCGGCCGCA CTGGCTGTAT GGATGCATTT ACGCACTTGA CCGAGCGTAC 2600
CGCACGCGCT GGTGATCTGA CTACCAGCCT GTGTGCGGTG CTGATGGCCG AAGCCTGCAA TACCGGCCCC GAGCCACTGG TACGGCAGGA CACGCCGGCG 2700
CTCAAACGAG ACCGGCTGAT GTGGGTCGAC CAGAACTACG TGCGCGACGA CACGCTGATT GCCTGCAACG CTTTGTTGGT GGCCGCGCAG AACCGCATTG 2800
CACTGGCGCA CACCTGGGGC GGCGGCGATG TGGCCTCTGC CGATGGAATG CGTTTCGTGG TGCCGGTACG CACCATTCAT GCCGCGCCGA ACCCGAAATA 2900
CTTCAATCTA GGGCGTGGCG TTACCTGGTA TAACCTGTTG TCTGACCAGC GCACAGGATT GAACGCGATC ACTGTGCCCG GCACCTTACG CGACAGCCTA 3000
GTCTTGCTAG CGGTCGTGTT GGAGCAGCAG ACCGAGTTGC AACCGACACA GATCATGACC GACACCGGAG CCTACAGCGA TTTGGTATTC GGTCTGTTCC 3100
GCCTCTGCAA CTATCGCTTC TGTCCACGTC TGGCCGATGT CGGTGGCACG CGCTTCTGGC GCGTAGATCC CCAAGCTGAT TATGGCGACC TCAACGCGCT 3200
GGCACGGCAG CGCGTCAACC TCGACCGCAT CACACCGCAT TGGGACGACG TACTGCGTTT GATTGGTTCA CTTAAACTTG GCCTGGTGCC CGCGATGGGC 3300
ATCATGCGCA CCTTGCAGGT CGATGAACGG CCGACCAGCC TGGCTCAGGC CATCGCCGAG ATAGGCCGCA TTGAGAAAAC AATCCACATG CTGAATTTCA 3400
TAGACGACGA GGCCAAACGT CGTGCCACAC AGCTGCAACT CAATCTCGGT GAAGGACGCC ACAGTCTGGC GCGCGAGGTC TTCCACGGTA AGCGCGGTGA 3500
ACTGTTCCAA CGTTACCGCG AAGGGCAGGA AGACCAGCTG AGCGCACTCG GCCTGGTCGT GAACATGATC GTGCTATGGA ATACGGTGTA CATGGATGCG 3600
GTGCTGATGC AATTGCGCAG CGAGGGCTAC CCAATACGTC CGGATGACGA GGCGCGGTTG TCGCCGTTCG GCCATGAGCA CATCAACATG CTCGGGCGCT 3700
ACTCGTTCTC AGTGCCGGAA GACGTCGCAC GTGGTGAACT GCGGCCACTC AACGGCGGCG GCGAATCATG ACGTATTCAA GAGCAGCCGC CACGATCTTC 3800
AGCTACATGA GTTGCTGGCC CACAGATTGG GCACACACCC TACGGACTGG CGAGCACGTG TGGCCCAACA CTTAGCGTGT CATTTAGCCG GAAACGCCCC 3900
CCTTAAGTCG GTTCGCTGTT CCATTGCTCC CCGGACCCC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnpR TnPsy39 219-794 Accessory Gene Resolvase +
tnpA TnPsy39 799-3771 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnPsy39 576 219-794 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MTQTLIGYAR CSTDKQDLAA QQEALLKLGV APDRIYTDPG FTGTNRARPG LDQALAAVRN GDTLVVSKLD RLARSVPDAR TIGDNLAARG VKLQLGSSIH
DPTDPMGKLF FNILATFAEF EADLIRMRTR EGMAVARAKG KLRGKKPKLS DRQQKELRRM YDTSNYSISD LAELFSISRP TVYRTLARQA V

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnPsy39 2973 799-3771 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPVSFLSSTQ RERYGCYPDR LSSEELARYF HLDDDDREWI STKRRDSNRL GYALQLTTAR FLGTFLEDPT AVPCTVLHTL SSQLGIADAN CVQTYRESEQ
RWRHTTEIRA RYGYREFVER GMQFRLGRWL CALCWTGTDR PSALFDYANG WLIGHKVLLP GVTVLERFIA EIRSRMESRL WRLLVRGVTD EQCQRLDDLL
KLASGSRQSR LDRLRKGPVR VSAPALVMAL QRIETVRGLG IKLPGTHVPP SRIAALARFA GTVKVSAIAR LPQVRRIATL VAFVHCLEAS AQDDALDVLD
LLLRDLFTKA EKENRKVRQR TIKDLDRAAS TLAEACRILL DCGLPDSELR ERVYATIGRD ALAQALDEVR GLVRPPNDVF YTELEGKKGT VTRFLPTLLR
VIRFDATPAA QPLIQALEWL REKPDPNPST AIVGKAWLRH VVQDDGRINA TAYSFCTLDK LRSAIRRRDV FISPSWRYAD PRTGLLTGAE WETARPIVCR
SLGLSVQADD TLTALTRELD ETYRRVAARL PKNDAVRFET VDDKIELVLS PLEALEEPPS LIALRNAIKA RLPRVDLPEI LLEVAGRTGC MDAFTHLTER
TARAGDLTTS LCAVLMAEAC NTGPEPLVRQ DTPALKRDRL MWVDQNYVRD DTLIACNALL VAAQNRIALA HTWGGGDVAS ADGMRFVVPV RTIHAAPNPK
YFNLGRGVTW YNLLSDQRTG LNAITVPGTL RDSLVLLAVV LEQQTELQPT QIMTDTGAYS DLVFGLFRLC NYRFCPRLAD VGGTRFWRVD PQADYGDLNA
LARQRVNLDR ITPHWDDVLR LIGSLKLGLV PAMGIMRTLQ VDERPTSLAQ AIAEIGRIEK TIHMLNFIDD EAKRRATQLQ LNLGEGRHSL AREVFHGKRG
ELFQRYREGQ EDQLSALGLV VNMIVLWNTV YMDAVLMQLR SEGYPIRPDD EARLSPFGHE HINMLGRYSF SVPEDVARGE LRPLNGGGES