Transposon
Name: TnPa43       (Synonyms: Tn7176)
Family: Tn3
Evidence of Transposition: yes
 Host     

Host Organism:Pseudomonas aeruginosa
Place of Origin:USA
Other Geographic Information:Walter Reed

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GAGGGTCGGCAGGGATTCATGTAAAAAACCGCAGAAAC
IRR (Length: 38 bp)GAGGGTCGGCAGGGATTCATGTAAAAAACCGCAGAAAC

 Sequence     
DNA SequenceLength  19888 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GAGGGTCGGC AGGGATTCAT GTAAAAAACC GCAGAAACAG GCTTAAGTCC CTGTCACAGT TGGGTTTTTA TCATTCCTCT GTGTCATTTT TTCTGCCCCT 100
TCAACAGGGT CTTTCGCGGA CGCATCAGGA CTGGGCACCG TAGCGCTGAA ACGCTCCAGC ATGCTGACCA CGACCTGCTC TTGCGCCGTG ACGGATGACT 200
TGGCTGCGGT CAGCGCCAGT TCCAGCTGTT GCTTTGCCGT GAGCAGTTCG TTGGCCTTGG CCTCCAACTG TTCGTTCGAG GCGTTGAGTT GCTTGACGGC 300
CGCCTCCTGC TCAACCAGGC GCCGACCCAA CTCCTCGGTG CGCCGTTGTG AGGGCAGCTT GTCGGACTTG TTGGCGTTGA CCTGTTGGTC GACCTGCAGA 400
AGGTTCCACA GGTCATTGTT GGCCCACAGG GAGAACGGAA TAGCGTGGTC GACCGCGAAG CGCTGGTTGA GCGGCCGGCC GGACCAGGTG CACCGGGTGA 500
CGCCGGCTCT TTCGTAGGCC TGGCGGGCGA GCATGGTCGC GCGTTCCGGG TCGGGGCGCG CAAGCAGCAG CGGCAGCACG GCGCCGGATG TGATTCCCTG 600
CCGGTATCCG AAGCGTTCCG TGAGTGCTGC CCATCTCAGC ACGACCGCAT CGGCGATCCA GTGCCCGAGC AGGCTCAGTT CTTTCCAGAT GTCCGCGGGC 700
ATCAGCACGA GGCCTGACGG GCTGTCGTAT TCGAAGACGG TCCCTGACTC CAGGGCTCCG CCCGAGAACT CGACCGGGCC CAAGCGGATG GTCTGGGCGA 800
TCAAGCGAAG CACGGATCTG AGCTGATCTT GCATGCCTCC GCTCAGGCGC CCGGCAAGCC AGTCTAGGTG CCAGGCGCTG AGTCCTCCGT GCGCCCCCTG 900
GTCACGGTAG GGCTGCATGA GGGCGGTGAG CGCTGCGCGA AACTTGACGG GCTTGATGCC CCCTGCCCCT TCGGACTGGG ATTGGGGGGT GAATTGCTGC 1000
GATGCAAAGA TCGGCCAGTA GTACATCAGC CACTTCTCCG CGATGCACAG GAGAGGAACA CCCACCTGGC CGCTGGCCTG CCAGACGGCG GTCTTGCTCT 1100
CGTGCATGGC GATGTCGGCC AGGGCACGGA ACAGGGCCAG CTTGTAGGTG GCCACCTTCT TATCCCGATT GAGCACACCC TCGATCTGGT CGATAGCCCG 1200
GAGGGTGCCG GTGGTGCGCA GTTCCAGCAG CAAGGTGTAC CAGCTGGTGC CAGCCCGGGC CAGGGCGTCG TCGGAATCCC AGCGGCCGAT GCACTGAAAT 1300
CCCAAGCGCT CGAACAGCAG CTGGATCTCT TCGGCGGTGT AGCCCTGGAA CAGCCGACCA CTGGTATCGC GCTGCTCCAC CAGGTTGTCT CCACGGGTCA 1400
GTGGCAGGGA CAGCAGCAGG CGGCCGTGCG GGTTGAGCAG CGCACGGATG GCCAGCGCAG CATCGAACAG TTGGTGGTCT GGAACGTGCA TCAGGACTGC 1500
GCTGCAGAGG ATCCCATCGA ACTTGCCATC AAAGGGCATG CCCAGCTCGG GCAGCGCTGC GCTAGCAAGC CGGTTTTCAA GCTCGGGGTG GGCGACCTTG 1600
GCCGCCGCGC GCAGACCGTC CGTGGGCTCC ACGCCGTAGG CTTCGTAGCC GCTCTTGAGG AGGTGCGCCA AGTCACGACC AGATCCTGCC CCGATATCAA 1700
GCAACCGGGC CCCTGGCACA AATGCCAGCG GGAAGTACTT GGCCACAGGG CTGCCCACCG ATTCGTACCG GGTGGCTATG TCCTGGGCGT TGTCTTCGTA 1800
GAAGCGAGCC GTCGATGCGT CCATGGAGCG GTCACTCAGA AGGGTTATGT ATACCTAAGT TTGTAAACTT CTAAATTTCC CCAGCAACAA TGGGGCTTTT 1900
CTCAATAGGG AGAGCACTGA GAAAAAGTTT ATGTAAACAA ATGCCGACCG ACCAACGAGG TTGTTTACAG TCCTCCACGA ACCCGTGAAG CGTATAGGCT 2000
TGAATGGACA GGCAGGAACT ATACAACTGG CAGATCAAGC TTGACACCGA AGTGCCCCGC ATCCGCAGGT GAACGGTGCC ACCCGCCGAC TATCATTGCA 2100
TCACACTTAC AGACGATCTG CGCATGGCCC AATTGTTTTA ATTGCTTTCG ATAAAGGCGC GCATTCTGTC GCGACAGATA CCCTACTCTC TGTCCTTCAA 2200
TAGTCACTCG AACGGCTCGA TTGTCATGCG GATTGGAATC CTCCAAGTAA AGGATGGCCT CTGTCACATA CTCGGCGCCG TCCTCTGAGC GACCGCCACT 2300
GATGGCACCG CATGCACTCC TCCACAATGG CCCTGGTGGT GTGCCAGTCA TCTGAGGCCG CATTCCAGCG AATTATCTCG TCGGGTGTGG TGTACGCCTC 2400
CCACACCCGT TCAATCGGGG CTCGTACGTT CGTCTCGACG GTGAGTTGCA TAGCGGCTCT CTCCAGTTTG GTGGCAGCGG GTTGTTCACT GCCATTTGCG 2500
GGGGTGAACA GCAGATATTA TCGTGCAAAG GCCTATTGTG ACGTAGGCAG AAAGCGACAC GGGCGGCGCT TGCCAGGCGC TGCGACCATC CTTCTGTGTT 2600
GCATTCCGCG TCCCGCTGTC ATGCCTATGT CATACCGACG ATCTACCATC CTTTCATGAT CGATCTGTAG ATCAAAGTTA ATTATTGATT ACATGATCGA 2700
ATCAGCATGC CGGAAGGAGC CGCAGTTTGC CCTCCCGATT ATTCGTTGGA AGACCTTGGA GCATCACCAT GTTTGCAGAG CAGCAACGCG AATATCTCGA 2800
CAAGGGATAT ACGAAGATTG AAAGCTTTTT CTCCGCGGAG GAAGTAGCGA AGATTCTTGA AGACGTCAAG CAAATTGAAT TGGGAGCTAT TGGCGTAGCT 2900
TCGGACAATG AGACTTACCA GTTCGAAAAG AAGAATGGCG AGACGACGAA GCTACTGCGT CGCGTCGAGA ATCCTCACCT TTATTTCGAT GCAATAGATT 3000
CTTTGGTCAG GTCGGAAAAA ATCGTCGATT TGCTTCGGCA TTTCCTGGGC GAAAACATCC GTTTGCACAA TAGCAAAATC AACTTCAAGC CGCCATCAGG 3100
CGCGCCAGTC CAGTGGCATC AGGACTGGGC ATTCTATCCC CACACAAACG ATGATTTTCT TACTCTCGGA ATTTTCCTCG ACGAGACAAG TGAGAAAAAT 3200
GGCGCGATGG CATGCTTGCC AGGCTCCCAC AAAGGAAAAG TGTACGACCA CCGGAACGTC GAGACGGGCG AGTTTTGCCA CGCGATCTCT CGCTCCAACT 3300
GGGACGAAGC GCTCGACCCG ACAGAAGGGG AGTTACTGAC GGGACCCGTA GGAACTGTCA CGTTGCATCA CGTCCGGACC CTTCATGGTT CAGGCCCAAA 3400
CCACTCAACG ATCAGGCGGC GTTTTCTGCT CATCGGCTAT GCCGCGGCTG ATGCCTGGCC ACTTCTGGGC TGTGGCAACT ATGGGGATTA TGAAAGCCTC 3500
ATGGTCTCTG GCCGATCCAC CGTATTCCCG CGCATGGTGG AACTCCCTTT GACTGTCCCG TATCCGTTGT CGATGTACGG TGATCGCATC TTTGAAAGTC 3600
AACGAGCTTT GACTCAAAAG TACTACTGAA GTCTTTAACT CACTGAGGTC ATAATGCAAG TTTTTACTCT GTTTTCGAAA TTCAAGAAGG CGTTAACGCG 3700
CGCCATTCTT GCCTTTATCG CCACAATCAT AGTGTGCACA CCCGCGCAGG CAGCTGAGGT TGTCAATGGT AAACTTCACC TGCGTTTTGC AATTGCGCCG 3800
ATGCGTCCAA CGCCTAGCCA GACCATCAAA GAGTTTGAGC CGATATTCAA GTATCTCGCC GACCAGCTCG GCGCGACCTA TGAAATCGTC TCCCCGGAAA 3900
GCTGGGCGGC AATATCTGTG GCAATGACAA ATGGCCATGT CGATGTGGGC TGGCTCGGAC CCTGGGGCTA TGTCTTGTCG AATAAAAAGG CCGGCACCGA 4000
AGTGCTTGCA ACGGTCAAGT ACCGCGGGGA GCCGTTCTAC AAAGCCCTCA TTGTCGGTCG CGCCGATCTG CCGATCAAAA AATGGCCCGA GGACGCGAAG 4100
GGTTTGAAGC TGTCACTCAG TGATCAGGGC AACACTTCTG GCTGGCTCAT CCCGATGGCG TACTTCAAGA GCATCGGCAT CGACCCTGCG AGCTATTTTG 4200
AATATCGTGA AGGTGCCACG TTTGGCCAGA ACGAATCACA GATTCAGCAC GGACTGATCG ACCTCGGATC CGATATGGAT CGGGGCCGGA ACGGGATGAT 4300
CGAAGCGGGT CAAATCGATC CTTCGAAGTC CAAGATCGTG TGGGAATCCA GCAAGCTGCC GAACGACGCG ATATCCGTGC CGAAGGATTT TGATCCTGCT 4400
CTGAAAGCGC GCATCACGGA AATACTGACG TCCTTGTCCG AAGAGAAAGC ACAGTCGCTG ATGGGCTCGG GCTATAACGG CTTCGTGAAG GCAAAGCACA 4500
GCGATTACAA GGTAATCGAA GACGCCGGCC GCATCCTGGG AAAACTGTAA AGCACGAGGG GTCCGTTCTT GGATGAGGGC AGCGGACGAC AAGGTGGACT 4600
GACGCACGCC AGCTCCTTGT CTCCGCTGCA CGAACATACG GGCGCGCATC GCAATACCAC AGAGGATGAA CCAATGAATC AGCGAATCGA AGAAGTCATG 4700
CTGGCTAATG TCAAGAGGGA CGTAGCCAGG AGAAAGCGGC ATTTTGCAAC GTCGGTCGTA GTACTCAGTT TGCTGGCAGT GGCCTGGTAC GTGTGTCAGA 4800
TAGAATTCCA GAAGCTAGGC GCCGGTTTAC CGAGACTATG GTCATTCGTC GTGCAGATGT TTCCACCCGA CCTGAGCGAC CTGGACGTCA TTCTAAAAGG 4900
GGCTGGCGAG ACGCTCGCCA TGGCGACGAT TGGCACGATA TTCGCCACAA TCATTGCATT TCCGCTGGCA CTCATGGCTG CGCGTAATAC CTGTCCGAAC 5000
AAGTGGACCT ATCGGGTATC CCGCGCCATC CTGAACGCCA GCCGCGGCAC GGAGACATTT GTCTATGCAC TTGTATTTGT AGCAGCAGTG GGCTTCGGTC 5100
CGTTCTCCGG CGTACTGGCC ATTACTTTCC ACATGGTAGG GGCAATCGGC AAAATGTTTG CTGAAGCCAT CGAGCCCGTT GACCAAGGGC CGTTGGATGC 5200
GCTCGCCTTG ACCGGTGCCA GCAGGGCAAA GATTATCCGC TACGGTCTGA TCCCGGATGT TATGCCGCAC CTGATCGCGA GCGTTCTATA CATTTGGGAA 5300
TTCAGTGTCA GAACGTCCAC AGTACTGGGC ATCGTAGGCG CAGGTGGAAT TGGGCAGACC CTGAAAGATA CTGTGGACTT GTTGGAATTC AACAAGATGA 5400
TTACGGTACT GGCGGTTGTA TTGCTGATGG TGTCGGCAAT CGATTTCATC AGTGACCGGC TCAGGTACTT GATATTGGAC ACAAAACGCG AGGGATTCGA 5500
AACTCTCCCT GCGAATAACT GATTGCTTCA CGTATTACTG GAAGGGAGGT TCGCAATGAA AGATGTAGCG TTGCAGTTAA AGAATGTCGG TAAGTCATAC 5600
GGCAATAAAG TTGTCCTGGA ATCGATTGAC TTCGAAGTAC GTCACGGCTC AATGGTTGCC TTGCTCGGCA CAAGCGGGGC AGGGAAGTCG ACGCTTTTCC 5700
GATGTCTCAC TGGCCTTGAG CCGATTGACT CCGGTTCTAT CGTGGCGCTC GGAGAATCCA TACATGAACT GTCTCCGGCG CGTCTGCGGG CAGTACGTGG 5800
CCAGATCGGG TTCGTGTTCC AACAACTGCA CCTGGTGAAA AGGTTCTCAG CACTCGAGAA TGTATTGGGT GCGCGTCTGG CAGAGATGCC CATTTGGCGC 5900
GTCACATTGA AAAGCTTCAG CCGGGCTGAC AAAGTGCTCG CGTTCGAATG TCTGGACCGG GTCGGCATGC TCGATTATGC AAACACGCCT ACGCAACTGC 6000
TGTCAGGCGG TCAGCAACAG CGTATTGCGA TAGCGCGAGC CTTGGCGCAG AAGCCCAAGA TTATTATTGC GGACGAACCC GTCTCCAGCC TCGATCCGCT 6100
GACGGCGCGC TCGGTTCTGC AAACGCTGAA AGCCGCGGCT ACAGATCTTA ATGTCGCGGT CCTGTGCAGC CTGCACCAGG TAGACCTGGC CCGTGAGTTT 6200
GGCGACCGCA TCGTGGGCAT GCGCGACGGA CGTGTCGTTT TCGACGGCAC GCCAGCGGAA TTCACCGACG AGCGCGTGCA TGCGCTTTAC CAGGGTGCCC 6300
GCTGGGAAGA TGCACCAGCG GCCGAGAGCG ACGCGCAGCA CTCGGTGGCC GGTCTGGCTG TGGCATGACC ACATCCACAC GCCCCATACC CGTGCCGCCC 6400
CAGGGCACCG CACTGCACTG GCACCTGAGC GCGCCCTACA ACGCCAAACA TCTGCTGGTG CTGATCGCCG TCATGGTGCT GTTGTTCGTG ACCGGACAAC 6500
GCACCGAAAT GGACCGCATG GTGGCCATGA CGGCACAGGC CGTGGCCAAG ACCGTGGGCC TGGCTGACGA TTCACAAGTC GCGCGCGGCT TGTCGCGCGT 6600
CGGTCAAGCC ATGTGGCCAC CCGCCATCGC AGAAACCGAA GAGGTGGGCC GGATTCAGGA CCTGGATCGC CAGAAGCTGC CCCTGTTCTC GCACATCGAG 6700
ACCCAGGAGC GCGTCGAGCA GAAGATGAAT CTGGACACGC TGAAGATGGA AGCCACGACG GAAACCGTCG AAGTGCTGGT CAAGCCGGTC GGCTATGTCT 6800
GGACGGTTTT CATCAAGATG ATCGAGACCC TGGAGATTGC GCTGTGGGGC ACGATCCTGT CGGTGCTGGT GTCGATTCCC CTGGCGTATT TCGCGGCCCG 6900
CAACTACTAG CCCCAACCGT TTTACCTACA CCGCTGCCCG CGGCACCATC AGTCTGCTGC GTTCAGCGCC GGAACTCATC GTCGCTTTGT TCCTGGTGCT 7000
GGCCTACGGC TTTGGCCCCA TCGCTGGCGT GCTGGCGCTG GGCCTGCATG CGGCCGGCTT CCTGGGCAAG TTCTACGCCG AGGACATCGA GAACGCCGAC 7100
AAGAAGCCGC AAGAGGCGCT GGAGGCCATC GGCGCGGGCA AGCTCAAGAC GCTGTGGTAC GGCGTCATCC CCCAGGTCTT GCCGCAATAC ATCGCCTACA 7200
CCGCCTACAT CCTGGACCGC AACCTGCGCA TGGCCACCGT CATCGGTCTG GTGGGCGCGG GCGGCATCGG CCAGGAACTC AAGGGCCGTT TTGACATGTT 7300
CCAGTACGGC CATGTCATGA CCATCCTGAT CGCGATCTTC GTCTTTGTGT TCGTGCTGGA CCAGTTGCAG GCGCGCATCC GCGCCAAGCT GATCTGAGGC 7400
GACCGCTGAC AACAAGGAAC AACATGACAA ACACTTCTGA AGCACCGGAT CGTGCGCAGT GGCTGCGGCT GTGGTCGGCC TTGCCGGCCG CAGCGGTCAA 7500
GGCCCTGGCG GCCGATCTGG CGGGCCAGCA CCGGGTCGAA GACCTGGCGT TGCCGCAATC CGGTCTGGGC CTGCTGCCGC TGACCGACAG CGCCCTGGGC 7600
GATACCTATT TCATCGGTGA GATTCCCTTG GCACAAGCGC ATGTGCGGGT CACGACCACC CAAGGGCAGT CGATCGAAGG CGCGGCCATT CTGGTGGACG 7700
ACCGTGCCGG TGTGGCCCGT TCCATGGCCA TCCTGGACGC GGTGCTGGCG GCCCGCATGC CAGGTTGTGA AGCGGCCCTG CGGTTGCTCA CCCAGGGTGC 7800
GACCGCCGTG GCGGAACAAG GCCGCCAGCG CCGCGCCTTA CTCGCGGCCA CGCGGGTGGA CTTTGCCCTG CTGGGAACGA ACGAGGAGGA CGATGATGAA 7900
TGAGACTGGG ATGGCGGCGG CACCGGCAGA AGCCGCGTGG CGCATCTGGC AAGCGCCGCG CCAGCAAACG GCGTTTCGCC AGTTGATGAC CGCGTTTTCC 8000
TATCCGGGCC GCGTGGTGCC ACTGGCCGAT GGCGCTGAAT CGGCGCTCCT GCTGGTGTTG ACCACCCTGG TGGACAGCGC CTGTGCGCTG GCCGATCCGC 8100
TGCACGCGCT ATCAAGCGAC GATCTGCGCC GACTGGGCGT GCGCTCGGCC AGTGTGGAGG CGGCCGAGTT CGTGCTGGCC GATGGCAACC GTTTGCTGGA 8200
GGCCACGCCG CGCCTGGGAT CGCTGGAAAA CCCCGAACAA GGCGCGACCG TGGTGATGCG CGTCTCCCGT TTCGGTGAGG GTCCCCATCT GCGGCTCACC 8300
GGGCCGGGTA TTCAACACGA GCAGGTGCTG CAGGTCAGCG GCATCGATCC GGGCTGGTGG AAGCAACGGT CCGAATGGAA TGCCCACTTC CCGCTGGGCG 8400
TGGACCTGAT TCTGGTGAGC GGGCACGAGG TCGCGGTATT GCCCCGAACC ACCCACATCA ACCTCAAAGG AGCCCACTGA TGGGATACGT TGCCATCAAG 8500
GGCGGTGGCC GGGCCATCGC CGGTGCCGAA GCCGCCGTCG AAGCCCTGCG CTGCGCCGAA GGGCCAGCGG GTACGCCGCT CACGCTGTCG GCCATCGAAC 8600
AGCAGTTGCG GTTGCTGACA TCGCGCGTCG TGTCGGAAGG GGGCCTCTAC CACCCACGCC TGGCCGCTCT GGCCATCAAA CAGATGCAGG GCGACACACT 8700
GGAAGCGGCG TTCGCTCTGC GCGCCTACCG CTCCACCAAG CCACGCCTGA TGGATGTGCC GGTGCAGGAC ACGAGCCGCA TGCGCCTAAT CCGCCGGATT 8800
TCGAGCGCTT TCAAGGACAT CCCCGGCGGA CAGATGCTGG GCCCGACCAC CGACTACGCG CTGCGCCTGA TGCGTCTGGA TTTGGCCAAC GAGTCGCCCG 8900
AGGACTTTCG CGCGGTCTCG CGGCGGTTTC TGGACAGCGT GGCCGACACC GACCTGCCCG ACAGCTTCCC CAAGGTGGTC GATGCCTTGC GTGACGAAGG 9000
CTTGCTGCCG CCGCTGACCC GGCGCGCCCA TGCGGCGTTC GACATCACCC GCGACCCGCT GGTTTTCCCA GTGCCGCGTT CGGCGGCCCT GGCCACCATG 9100
GCACGCGCCG AAACCGGCTC GCTCTTGGCG ATTGCGTATT CCAACATGCG TGGCTATGGC GACGTGCACC CCACCATCGC CGAGCTGCGC GTGGGCTATG 9200
TGCCGGTGAT GCTGCCGCAC CCGGTGACAG GCGAGCCCAT CGAAGCCGGT GAGGTACTGA TGACCGAATG CGAAGTGGTG GCCATGTTTG AGGGTGATGC 9300
TACCGACGGC CCACCCACTT TCACCCTAGG CTATGGCGCC TGTTTCGGTC ACAACGAAGT CAAGGCCATC GCCATGGCCA TCCTCGACCG CGCCCTGCAA 9400
AAGGGTATGC GCGACGGTCC CAGCAACCCG TCGGAAGACC CGGAATTCGT GCTGCTGCAC GTCGATGGCG TGGATTCGAT GGGCTTTGCC AGTCACTACA 9500
AGATGCCGCA CTACGTGACC TTCCAGTCCG ACATGGACCG GCTGCGCACC ACGCAGGACA AGGCAACCGC ACAACCGACC CAAGAAGGAG CGCCATCATG 9600
AACCCGGGCT ACGAACTGCC CCTGGACGAG GCGGGCTACA GCTTCGGCTT CCTGGACGAA TACGCCAAGC GCGAGGTGCG CCGCACCATC CTCAAGGCGA 9700
TCAGCATCCC CGGTTACCAG ACGCCCTATG CCTCACGCGA AATGCCTATG GGGCGCGGCT TTGGCACCGG CGGTCTGCAG GTTACGCTGT CGCTGATTGG 9800
CGAGGGCGAC ACCCTGAAGG TGATCGACCA GGGCGCGGAC GACTCCGTCA ACGCGGTGAA CCTGCGTCAC TTTGTGGAAC TGACCTGCCC GGGCGTGGAC 9900
ACCACAGAAC ACACGCTTGA TGCCACTCTG ATCCAGTCGC GCCACCGCAT TCCGGAAACG CCGCTGACCG AAGCGCAGGT GTTGATCCTG CAAGTGCCGT 10000
ATCCGGACCC ACTGGTGGTG GTGGAACCCT CCGAGGCTCG ACGCAAGGTC ATGCACGGCG AAGGCGACTA TTCGCGGCTG CTGACCAAGC TGTACGAGGA 10100
CATCGTGCAG TTTGACGAGA TCACCATCTC GCACCGCTAC CCCACGCGCA TCAACGGCCA CTATGTGATC GACCCCAGCC CGATCCCGCG CTACGACGTG 10200
CCGCAGTTGC ACCAGAGCCC GGCGCTGATC CTGCTGGGTG CGGGGCGCGA GAAAAAAATC TATGCGGTGC CGCCGTACAC CCGCGCCGAC CCGCTGGCGT 10300
TCGACGACGT GCCATTCCGC ACCGAAGACT TCACCAACGA ACACGGCCAG CGCCGCGCCT GCGAACGGTG CGGCGCCACC GACAGCTTCC TCGACGAGCT 10400
CATTGCCGAC GATGGCGGCA AGCACTGGCA TTGCTCGGAC TCGGATTTTT GCAATAGCCG TATGGCCCGC CAGGCTGAAC AAGCTCAGGA GACCACGGTA 10500
TGAAAAAAAT TCTGGAAGTA CGCGGACTGA CCAAGATCCA CGGCCGGGGT TGCGAACTCT GCCTGGAGAG CACTGGCCCC GACATGGACA CCAACATCTG 10600
CCCACACTGT GGCTCGGTGG TGGCCTGCCA CAACATCAGC CTGGACCTGC ACGAGGGCGA GATCCTCGGC ATCATGGGCG AGTCCGGCAG CGGCAAGTCC 10700
ACCGTGGTCA AGACGCTGTT CTTCGACGAT GAGCCCACCG CTGGTGAAGC CCATGTTCGC GCTCAACGCC GCGCAGCAGC GCTGGCTGCG CAACCACCGC 10800
TTTGGCATGG TGTACCAGAA CCCGCATCTG GGACTCAATT TCAACGTCTC GGCCGGCGGA AACATTGCCG AGCGCCTGCT GATGAGCGAC CTGGCCCACT 10900
ACGGCGAAAT CCGCGAACGG GCGCGCAGCT TGTTGGCGCG CACTGAGGTG TTGGCAGAAC GCATGGACGA GTCGCCCAAG AAGTTCTCGG GCGGCATGCA 11000
GCAGCGCGTG CAGATCGCCA AGGCACTGGC CACCCAGCCG CCGCTGCTCT ACCTCGACGA GGTCACCACC GGCCTGGACC TTTCGGTGCA GGCGCGCATC 11100
CTGGACCTGA TTCTGGAAAT CCAGCAGGAG CTGGGCACCG CCATGATCGT GGTCACCCAC GATCTGGGTG TCATCCGCCT GCTGACCGGA CGCACGATCG 11200
TCATGAAATA CGGCCGCGTC ATCGAGTCCG GGCTGACCGA CCAGATCCTC GAAGACCCCC AGCACGCCTA CACCCAGCGC CTGGTCGCGT CGGCTCTCTG 11300
AGGAAACCTG AATCATGCAA GAAGCCATCC TCAAAATCGA AGGTCTCTCC AAACAGTTCC AGCTGCACGA CCAGAACAAA CTGATCCCGT CGTGTGCACA 11400
GGTTCAACTG GAGGTGTTTG CCGGCGAGCT GACCGCGCTG ATCGGCCCGA CCGGCGCCGG CAAATCGTCG GTGCTCAAGG CCATTTACCG CACCTACCTG 11500
CCCAGCAGTG GGCGCATCCT TTACCGGGAC GCCAACGGTG CCATCACCGA TCTGGCCCAG GCCAGCGAAC ACCGCATGCT GGAGCTGCGC AAGCAGGACC 11600
TGGGTTTCGT CACCCAATTT CTGCACTGTC TACCGCGCAA GTCGGCGGTC GAGGTAGTGG CCGAGCCGCT GGTGCAGCGG GGCAGCCCGC GCGAAGCTGC 11700
TGCCGAGCGC GCGCGCGAAC TGCTGGCCCT GCTCAACGTG CCGGAACGCT TGTGGGCGGT ACCACCCGCC ACCTTCTCGG GCGGCGAGAA ACAGCGCGTC 11800
AACCTGGCAC GCGGGCTGAT CGCCCGGCCT CGGCTGCTGT TGCTTGACGA ACCCACGGCC AGCCTAGACC CGTCCACCAC CGACCGCGTG GTGGAGCTGT 11900
TGAAGTCCAT CAAGGCCGAA GGCGTGGCCA TGCTGGCCAT CTTCCACGAC CCCGAACTTG TCCGACGCCT GGCCGATCGC GTCGTAACCC TCACGCCCCC 12000
GGTGTCTGCG GCGGCATTGC TGGAGACCTG TGCCTCATGA ATCCCATTTT GCTGACCCAT GCCCGCGTGG TGTTCCCCAC CGAAGTCCGT GACAACGTGG 12100
CCATCCTGAT CGAAGGCGAC ACCATCACAG CCATCGACCC GGCCAGCAGC GCAGGTGCCA CCGAGATCGA CCTGCGCGGT CGCACCCTGA TGCCAGGTCT 12200
GATCGACCTG CACTGCGACG CAATGGAGAA AGAGGTGGAG CCGCGGCCCG GCGTGCACTT CCCGCTGGAG TTCGCCTGTG CCCAGGCCGA CAAGCGCAAT 12300
GCGGCGGCCG GCATCACGAC GGTGTTTCAT GCCCTGTCCT TTGCCAACCA CGAGCTGGGC GTGCGCAACA ACGCCTTCGC CGCCGAGATC GCCCGTTCGA 12400
TTGGCGACTG GCAGGCCCAT GCCCTGATCG ACAACCGGGT GCATGTGCGT TACGAGGTGA CGGACGAAAC GGCGCCGCCG GTGCTGTCGG CGCTGCTGCA 12500
GGACGGTCAT GCGCACCTCA TGTCTTTCAT GGATCACAGC CCCGGTCAGG GTCAGTTCCG CGATGTCGAG GCGTACCGCG CCTACCTGGC CAAGACCTAC 12600
AAGACCGATG AGGCGCAGAT CGACGACATC CTGGCGCGCA AAGCCGGGGC CGCACAGGGC GCCATGCGGC GCATGGAGCA GCTTGCGGAA CTGGCCCGTG 12700
CGTGCGGCGT GTCCATTGCC AGCCACGACG ACGACAGCCC GCAGAAAGTG GCGACCGTCA AGGCCCTGGG CGCTGTGGTG TCGGAGTTTC CGGTGAACCT 12800
GGAGACGGCA CAGGCCGCCC GTGCACAAGG CCTGGCCACC TTGTTTGGCG CTCCCAACAT CCTGCGCGGC AAGTCCCAGT CGGGCAACAT GCGTGCCCTC 12900
GATGCCGTGC TGGCCGGTGT CGCCGACTGC CTGTGCGGTG ACTACTCGCC AGCGGCGCTG TTGCCGTCGG TCATGCGCTT GCCCGATCTG GCCGGCATCC 13000
CCCTGGCCGA GGCTGTGGCC CTCGTCACGT GCAACCCAGC TCGTGCTGCA GGTTTGCACG ACCGGGGCGA GATCGCCGTG GGCAAGCGCG CAGACCTGAT 13100
TGCGGTCAAA ACCATGGGCG GACTGCCACA GGCCGAGCGG GTCTGGTCGG GCGGTAAAGC TTCGCTGGTC GCGCATTTTG ACCACGCCTG AGAGGGACTG 13200
GCACATGCGA ACTCGCCTCA TCTACGTGGT CGGCGCCTCG GGCAGCGGCA AGGACACGCT CATGGGCCAT GCCCGCCAGA AGCTGGCGGG TGATCCCAGG 13300
GTGTGTTTTG CCCATCGCTA CATCACCCGA CCCGCAACGG CAGGCGGCGA AAACCATGTG GCCTTGACCA CGGAGGAATT CACCGCTCGC CAGAACGGCA 13400
AGCTCTTTGC CATGCACTGG TCCAGCCACG GCCTGCATTA CGGAATCGGC ATCGAGATCA ACCAGTGGCT GGGCAAAGGC ATCACGGTGG TGATCAACGG 13500
CTCGCGGGAA TACCTGGACG AGGCCCGCCA ACGTTACCCG GAGCTGCTGC CGGTGACGAT TGACGTGGCC ACCACCGTGC TGCGTGATCG GCTGCTGGCC 13600
CGTGGCCGCG AGGATGCCGA ATCCATTGAG CAGCGCCTGC ACCGCCATGA AACGTTGCGC CTGCAGCCCG TGCCCGGTGT GCTCATCCAG AACAACGGAC 13700
CCGTCGAGGT GGCCGGCGAA GCGCTGATCC GGTTGATCGC AGAACACACC CAAGGAGCGC CAGTATGCGT GTGAGTTTTC TGGGCACGGG CGCTGCGGGC 13800
GGGGTTCCGC TCTACGGTTG CACCTGCCGG GCCTGTGAAC GCGCAAGGAC CGAGCCACAC TTCGTCCGCC GCCCTTGCAG CGCCCTGATT GAATCCGGAG 13900
GTACCCGGGT GCTACTGGAT GCCGGGCTGA TGGACCTTCA CGAACGGTTT GCGCCGGGTA GCCTGGACGC GATTGTTCTC ACGCACTACC ACCCCGACCA 14000
CGTGCAGGGA CTCTTTCATC TGCGCTGGGG TAAGGGGACG CCCATCACAG TCTATGGCCC ACCAGACAGC GAAGGCTGCG CCGATTTGTT CAAGCACCCT 14100
GGTGTACTGG CCTTCGAGAC GGTGCACAAG TTCGAGGCCT TCACCGTCGG GGCGCTGCGC CTGACGCCCC TGCCGCTGCT TCACTCCAAA CCCACGCTGG 14200
GCTATGCCAT CGAGGGCACC CAGGGCCAAC GCTTCGCCTA CCTCACAGAC ACCCTGGGTT TGCCGCCGAA GTCGGCCAAG TTCCTGCGCG CCTGGGGCGA 14300
CTTTGACATG GCCATCGACT GTTCCTATCC GCCGCACCCG ACCCCGAAAA ACCACAACGA TTGGGACGAA GCACATCGGT GTGCCATCGA ATCTGGTGCC 14400
CGCATCACCT GGCTCACCCA TGCCGGTCAT GCGCTGGACG ACTGGATGAT GGAAGAGACG CCGAGCGTCG CAAGTCATAT CCGGCTGGCC CGGGACGGCA 14500
GCACGGCCGA CATACCGTCC CAAACGCAAT GAACGCGCCG CTGGCACTGG CCCTGTCGGT GGCCATGCAC GTCACCTGGA ACCTGATGGC ACGGCATTTG 14600
CCCAGGGAAT CGAACCCGCT GTGGTGGGTG TTGCTCGCCC ATCTGGTGCT GTTTGCGCCC TGGGGGTTCT GGGAGCTGGC GACAACCGTC GTTTGGTCAC 14700
TGGAGATGAC GCTGCTACTG ATCGTATCGG CCACTGCGAA TGTGGTTTAT TTCTCCGGTC TGGCCAGGGC CTACGAGCAC GCACCGGTCG CACTGGTCTA 14800
TCCTCTGGTG CGCAGTTCAC CTCTTTTCAT TGCGATCTGG GGCACGCTGT TCTTCGGTCA AAATCTCCCG CCCATTGCCT GGCTGGGCAT TGGCATCAGC 14900
GTGCTGGGCT TGCTCGTCAT GGCATCGAGT GCTCAACAGG GGTCGGATCG ACGAGCATTC CGATGGGCCA TGCTGGCCAT GTTGGCGACA AGCGTTTATT 15000
CCCTGAGTGA CAAGGCGGCC ACCGAACACA TCCCAAGCTT CATGGGGCTC GTGGGTTTTC TGTCCGTCGG CTACCTGGCA TCCTGGATCA GCATGACCTT 15100
GCGCATGCAT CGGCACACCC GCAGTTGGGT GCCGGCACAG CGCATTGATC TCGCGTCGCT GGCTCTTGGC GGAACCTGTA TCGGTCTCGC CTACGCCTTG 15200
GTTATCCACG CCATGCGCCA GTTGCTGCGG CGGAGGTCGT GTCGTACACC AACGCCGGTA TCGTGCTCGC TGCAGTTCTC TCCATTTTTT TGTTCAATGA 15300
CAAAGTCGGA TGGCAAAAGA GAATCATGGG GGTCGTGATC ATCACGAGTG GTTTGGGGGT GCTTGCCATG AGGTGAGCGA CACAATACCA ACCATCGCAC 15400
ACCAGCATTC CAACCCGGCT CGCGACCTGC CGGTGAAGTA AAAGCGACTT CCGATATGTC CCAAATTTCC CGATACGTCG AGGCCGCCGA GCGTGACAAC 15500
ACGCGTCGAA GCTATGCCGC AGCCATTCGC CATTTCGAGG TGGAGTGGAA AGGCTTGCTG CCAACGACCG CTGATGCAAC CTCCCGTTAC CTGGCTGACC 15600
ACGCGGCCAC GCTGGCGATC AGCACCCTCC GTCAGCGGCT CGCCGCGCTC TCGCGCTGGC ACATCGACCA TGGTTTTGCA GACCCGACCA AGGCACCCTT 15700
GGTGCGCCAG GTTCTCAAAG GCATTCGCTC CATTCACTCG GTTGCAGAAA AGCGGGCACG CCCCCTTGAA ATCGATGTCG TCCAGCAGAT CGATCAATGG 15800
CTGGGGGTGG CCATCGGCAA CGCAGAACGC AGCGATGACC GATTGGCGCT GCTTCGCCAC ACCCGCAACC GCAGTTTGCT GCTGCTGGGT TTCTGGCGGG 15900
GATTTCGATC GGACGAGTTG GTCAACCTGC GGGTGGAGAA CGTGGAAGTC TCGCCTGGCG AAGGGCTGTC GTGCTACCTG AGCCGCAGCA AGGGCGATCG 16000
GCAGATGCTG GGCCGCGTAT ACAAATGTCC GGCGCTGTCC CGCCTGTGTC CTGTGACGGC TTTCACGGCA TGGGTCAGTC TGGTCGGCCT GACCCAAGGC 16100
CCGGTGTTTC GCAAGATCGA CCGCTGGGGG CGAATCGGTC AAGAAGGGCT GCATGCCAAC AGCCTGATCC CATTGTTGCG CAGCCTTTTG GCTGAGGCCG 16200
GGGTCGCCGC TTCCGAGGCA TACAGCAGCC ACTCCCTGCG TCGCGGATTT GCCGGTTGGG CTCGCGCCAG CGGTTGGGAC ATCAAGGAAC TCATGGAGTA 16300
CGTGGGCTGG AAGGATGTCA AATCGGCCAT GCGTTATCTG GATGCCTCCG GCAGCGCACT TCAGGCCCGG TTTGAGGCGG GTCTCGCAAC ACTGGCCCCA 16400
GCAGATCGAG CGGATCGGTC ACCACCGCCT TCGATGCACG CGCCGGCCGA GCAAACCAAG GAACAGGCCC AGAGGCCCCG TCTGCCTGAG CTCGCAACAC 16500
CATCGGCAAT CCTGCGCGTC ACAGTGTTGC TGGCCCGGTT CAGCCCACAA TCGCGCGGGC TGACGAGAGG CCGGCGGCTG ATCGAGCAGA CCTGCTTCGA 16600
GCGCTACGCC ATGCAGCGCT TGAATACCGA GGGCACACAG TACGAACTGA CAGTGCCCTA CGAATCCAGG GATTCACTGG AAGAGGCGAT TGCCGCTTTG 16700
CTCGATGACA TGTACCGCAT CGCCGAGGAC AACCAGTGCC TGCTGGAGGC TGCGTTTCAC GAGCCGGCCA CCGACTCGTA TTGGGACTGA AGGGCTGGGA 16800
TGATGACGGC GGATGGCACG ACGCACCAGC GGGGGAGGCC TCACGAATGA CTACGCTTCA TGAGACGGCC TATCCCCATC TGAAGCCCGA CCCCACTGAG 16900
AGGGAGCTGG CAGAACTCTT CACACCCACC GAGGCGGAAC GGGCGCTGGT GGCGGGAGTC GGCAAACGGC CTTTACCTCG CGTGGCCGCC CTCATTCACC 17000
TGAAGGTTTT CCAGCGCCTG GGGTATTTTC TGACACTGTC CGATGTGCCG CAGGTGATCA GGGAACACGT TGCACAGCAC GCGGGTGTTC CGCGGGCGCC 17100
AGCGCTGGCG GACCTCAAGC GCTTTGAGGC CTCGGGCTCG CGCATGGTGG TCTTCACAGC ATTGCGTCGC TATCTGAACG TCAAACCACT CAACCCGGCG 17200
GGGTACGCCT GGCTGGGCGT TGTGGCGGAC ACCGCGGCCG AGACGAAACA CGCCGTGGCC GACATCATCA ACGTGATGCT GGAGGAGTTG GTCCACCATC 17300
GCTGCGAATT GCCCGCCTTC TCGACGCTGG ATCGGATGGC GTTTCGTGCC CGGGAAAAGA GCAACAACCA GCATTTCTCC GCCATCGCTG GGCAACTGAC 17400
GTCACAGACG AAGACATTGA TCGATGGCTT GCTCAAGACG GCCACGGGCG AGTCGGCGTC ACCCTGGCAA ATGCTCAAGC GCGAGCCCAA GCGGCCCACC 17500
AACAAAGAAA CACGGACCTA CATCCAGCAC ATCCGGCGTC TGCAGCACCT GGTGGAGCAA CTTCCCAAGC CCGACGTGCC CGTGCCCAAG CTCAAGCAGT 17600
TCCGGCTGCT GGCGCGCGCG CTCAATGCCA CTGAGATGGC TGAACTCAAG CCACAAAAGC GCTATGCGCT GGTGGTGATC TTCATTCGGG CGCAGCATGC 17700
CCAATCGCTG GACGACGCTG CCGACCTGTT CATCCGTCTC ATGCAGAACC TGGAGAACAA TGCCCGGCAG AAACTGTTGT CCTTCCAGCA GGAGCGCGTC 17800
CACAAGACCG ACATGCTGGT CGGGCAGCTC AAGGACATCC TGGGTGCCTA CCAGTTGGTT GGGACCGACA CCCAACGCGT CGAAGCCATC AGCACGACCC 17900
TGGTGGCCGA AGTGGACGAG CTGCTGAACG AATGCGAACA GCATCTGGCC TATGCCGGGC GCAACCACCT GCCGTTCCTG CTGCAGCCGT ACAAGATGGT 18000
GCGAGCGCAG CTGCTCAACT GCATCGACAT CGCGTCGCCC AAGGCCAGCA GCGAGGACCT GGTGGTGGAG CGGCTGATGG AAGCCCTCTC CAAACTGCGC 18100
GACAACCGTG CCGACACCGT ACCGCTGGAC ATGCTGGGCC TGAGTGAAGA CACGGATTTG CGCTGGATGT CGGCCCAGTG GAGAAAGCTT GTGCTGGTCA 18200
AACCGGCAGG CAAGGGCCGC GCGGAGTCCG TCCGCCGCCG GTATTTTGAG CTGGCCGTCA TGCACGCCGT CAAGGACGAT CTGAAGTCCG GAGACCTCTT 18300
CATCAAGTTC GGGGAGCGCT ACGACGACTA CCGCGAGCAG TTGGTCGATG ACGAAACCTT TGAACGCGAG CTGGGCGACT ATGGGCAGGT CACGGGCATC 18400
GAGACGGAGC CCGGCGCCTT CGTGTCGAAG CTGAAATCGT CCATGGCGCT GCGAGCCATG GAAATCGATG CCGGATTTCC AGAAAACGCC CATGCTGAAA 18500
TCGTCGATGG ACGCCTGATC CTCAGAAAAC CGCCTCGCTC AGACATTGTC GAGGCCGCCG CGCGCATCGA CGGCATGATC ACCGAGCGGA TGGAGGCGGC 18600
CAGCATTGTG GACGTGATGA TCGACACCGA GCGGTGGCTG GACCTTCACA AGCTGTTTCG TCCGCTGGCG GGGACCGACA GTCGCCTTGA GGACTTGCGC 18700
ATGCGCGTGA TCACGACCTT GTTCTGCTAT GGCTGCAACC TGGGACCCGT TCAGACCGCC AAATCGATCA AAGGTCTGAG TCGGCGTCAG ATTTCCTGGC 18800
TGAACCTGAA ATACGTCAGC GAAGACCTTC TGGACAAGGC CATCGTCAAG GTGATTAACG CCTACAACAA GTTCGAACTG CCCGGTTACT GGGGCACCGG 18900
CAAACACGCA TCGGCCGATG GCACCAAGTG GAACCTGTAC GAGCAGAACC TACTGTCCGA GCACCACATC CGCTATGGCG GCTACGGCGG CATCGGCTAC 19000
TACCATGTCT CCGACAAGTT CATCGCACTG TTCAGTCACT TCATTTCTTG TGGCACCTAT GAGGGGATCC ACATCCTGGA TGGGCTGATG AGCAACGAGT 19100
CCGACATTCG GCCCGACACG ATCCACGGTG ACACGCAGGC ACAGAGCTAC CCGGTTTTTG CGCTGGCTCA CTTGCTTGGC ATCCAGCTCA TGCCGCGCAT 19200
CCGAGGCATC CAGGACCTGA AATTCCATCG CCCGCAGGTG GGCACCGTGT ACCAGAACAT CAATACGCTG TTCAGCGACG TGATCGACTG GCAGTTGATT 19300
GAACTGCATC TGCCGGCGAT GCTGCGGGTG GCTGTGTCTA TCAAGACGGG AAAGATCACG CCATCGGCCA TCCTGCGCCG ACTTGGCACT TACAGCCGCA 19400
AGAACAAGCT GTACTTCGCC TTCGTCGAAC TCGGCAAAGT GATCCGGACC ATGTTTCTGC TGAGCTACAT CGGGGACGTC GGACTGCGCA AGGTGATCCA 19500
CGCCGAAACC AACAAGAGCG AACAATTCAA CGGCTTTGCC GGCTGGTCGT TTTTCGGGGG AGAGGGGATC ATTGCCGAAA ACATCCGGCA CGAGCAGCGC 19600
AAGGTCATCA AGTACAACCA CCTCGTGGCC AACATGATCA TCCTGCACAA CGTGGTGGGC ATGACACGTG TACTGCGAGA GCTTCGCGAC GAAGGCACCG 19700
AGATCACGCC GGAGATATTG GGCGGCCTTG CGCCGTTCCG CACGGCCCAT ATCAACCGAT TTGGAGACTA CACACTCGAC TTCCGCCGGA AGATCGGTCC 19800
GCTGGATTTC GAAGTCACCA TTATTCCAAT ATAATCATAA GGTTAGGTTC GTTTCTGCGG TTTTTTACAT GAATCCCTGC CGACCCTC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
methyltransferase domain-containing protein TnPa43 43-1824 Passenger Gene Other -
phyH TnPa43 2769-3629 Passenger Gene Other +
htxB TnPa43 3654-4550 Passenger Gene Other +
htxC TnPa43 4674-5522 Passenger Gene Other +
htxD TnPa43 5556-6368 Passenger Gene Other +
phnE TnPa43 6365-6910 Passenger Gene Other +
phnG TnPa43 7424-7903 Passenger Gene Other +
phnI TnPa43 8375-9601 Passenger Gene Other +
phnJ TnPa43 9598-10503 Passenger Gene Other +
phnK TnPa43 10729-11301 Passenger Gene Other +
phnL TnPa43 11315-12040 Passenger Gene Other +
phnM TnPa43 12037-13191 Passenger Gene Other +
phnN TnPa43 13205-13774 Passenger Gene Other +
phnP TnPa43 13765-14532 Passenger Gene Other +
eamA family transporter TnPa43 14529-15338 Passenger Gene Other +
tnpR TnPa43 15456-16790 Accessory Gene Resolvase +
tnpA TnPa43 16847-19834 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
methyltransferase domain-containing protein methyltransferase domain-containing protein TnPa43 1782 43-1824 -
Class:   Passenger Gene
Sub Class:   Other
Protein Sequence:  
MDASTARFYE DNAQDIATRY ESVGSPVAKY FPLAFVPGAR LLDIGAGSGR DLAHLLKSGY EAYGVEPTDG LRAAAKVAHP ELENRLASAA LPELGMPFDG
KFDGILCSAV LMHVPDHQLF DAALAIRALL NPHGRLLLSL PLTRGDNLVE QRDTSGRLFQ GYTAEEIQLL FERLGFQCIG RWDSDDALAR AGTSWYTLLL
ELRTTGTLRA IDQIEGVLNR DKKVATYKLA LFRALADIAM HESKTAVWQA SGQVGVPLLC IAEKWLMYYW PIFASQQFTP QSQSEGAGGI KPVKFRAALT
ALMQPYRDQG AHGGLSAWHL DWLAGRLSGG MQDQLRSVLR LIAQTIRLGP VEFSGGALES GTVFEYDSPS GLVLMPADIW KELSLLGHWI ADAVVLRWAA
LTERFGYRQG ITSGAVLPLL LARPDPERAT MLARQAYERA GVTRCTWSGR PLNQRFAVDH AIPFSLWANN DLWNLLQVDQ QVNANKSDKL PSQRRTEELG
RRLVEQEAAV KQLNASNEQL EAKANELLTA KQQLELALTA AKSSVTAQEQ VVVSMLERFS ATVPSPDASA KDPVEGAEKM TQRNDKNPTV TGT

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phyH phytanoyl-CoA dixoygenase TnPa43 861 2769-3629 +
Class:   Passenger Gene
Sub Class:   Other
Function:   Peroxisomal enzyme catalyzes the first step of phytanic acid alpha-oxidation.
Sequence Family:  PhyH (Pfam: PF05721)
Comment:   phytanoyl-CoA dioxygenase
Protein Sequence:  
MFAEQQREYL DKGYTKIESF FSAEEVAKIL EDVKQIELGA IGVASDNETY QFEKKNGETT KLLRRVENPH LYFDAIDSLV RSEKIVDLLR HFLGENIRLH
NSKINFKPPS GAPVQWHQDW AFYPHTNDDF LTLGIFLDET SEKNGAMACL PGSHKGKVYD HRNVETGEFC HAISRSNWDE ALDPTEGELL TGPVGTVTLH
HVRTLHGSGP NHSTIRRRFL LIGYAAADAW PLLGCGNYGD YESLMVSGRS TVFPRMVELP LTVPYPLSMY GDRIFESQRA LTQKYY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
htxB HtxB TnPa43 897 3654-4550 +
Class:   Passenger Gene
Sub Class:   Other
Function:   ABC transporter, phosphonate, periplasmic substrate-binding protein
Sequence Family:  Phosphonate-bd (PF12974)
Comment:   phosphite transport system-binding protein
Protein Sequence:  
MQVFTLFSKF KKALTRAILA FIATIIVCTP AQAAEVVNGK LHLRFAIAPM RPTPSQTIKE FEPIFKYLAD QLGATYEIVS PESWAAISVA MTNGHVDVGW
LGPWGYVLSN KKAGTEVLAT VKYRGEPFYK ALIVGRADLP IKKWPEDAKG LKLSLSDQGN TSGWLIPMAY FKSIGIDPAS YFEYREGATF GQNESQIQHG
LIDLGSDMDR GRNGMIEAGQ IDPSKSKIVW ESSKLPNDAI SVPKDFDPAL KARITEILTS LSEEKAQSLM GSGYNGFVKA KHSDYKVIED AGRILGKL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
htxC HtxC phosphonate ABC transporter permease TnPa43 849 4674-5522 +
Class:   Passenger Gene
Sub Class:   Other
Function:   phosphonate ABC transporter
Sequence Family:  BPD_transp_1 (Pfam:PF00528)
Comment:   phosphonate ABC transporter permease
Protein Sequence:  
MNQRIEEVML ANVKRDVARR KRHFATSVVV LSLLAVAWYV CQIEFQKLGA GLPRLWSFVV QMFPPDLSDL DVILKGAGET LAMATIGTIF ATIIAFPLAL
MAARNTCPNK WTYRVSRAIL NASRGTETFV YALVFVAAVG FGPFSGVLAI TFHMVGAIGK MFAEAIEPVD QGPLDALALT GASRAKIIRY GLIPDVMPHL
IASVLYIWEF SVRTSTVLGI VGAGGIGQTL KDTVDLLEFN KMITVLAVVL LMVSAIDFIS DRLRYLILDT KREGFETLPA NN

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
htxD HtxD TnPa43 813 5556-6368 +
Class:   Passenger Gene
Sub Class:   Other
Sequence Family:  ABC_tran (Pfam: PF00005)
Comment:   phosphonate ABC transporter ATP-binding protein
Protein Sequence:  
MKDVALQLKN VGKSYGNKVV LESIDFEVRH GSMVALLGTS GAGKSTLFRC LTGLEPIDSG SIVALGESIH ELSPARLRAV RGQIGFVFQQ LHLVKRFSAL
ENVLGARLAE MPIWRVTLKS FSRADKVLAF ECLDRVGMLD YANTPTQLLS GGQQQRIAIA RALAQKPKII IADEPVSSLD PLTARSVLQT LKAAATDLNV
AVLCSLHQVD LAREFGDRIV GMRDGRVVFD GTPAEFTDER VHALYQGARW EDAPAAESDA QHSVAGLAVA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phnE PhnE TnPa43 546 6365-6910 +
Class:   Passenger Gene
Sub Class:   Other
Function:   hypothetical protein
Comment:   Phosphonate ABC transporter PhnE WP_023121727.1
Protein Sequence:  
MTTSTRPIPV PPQGTALHWH LSAPYNAKHL LVLIAVMVLL FVTGQRTEMD RMVAMTAQAV AKTVGLADDS QVARGLSRVG QAMWPPAIAE TEEVGRIQDL
DRQKLPLFSH IETQERVEQK MNLDTLKMEA TTETVEVLVK PVGYVWTVFI KMIETLEIAL WGTILSVLVS IPLAYFAARN Y

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phnG PhnG TnPa43 480 7424-7903 +
Class:   Passenger Gene
Sub Class:   Other
Function:   Phonsphonate metabolism protein
Sequence Family:  PhnG (Pfam: PF06754)
Comment:   phosphonate C-P lyase system protein
Protein Sequence:  
MTNTSEAPDR AQWLRLWSAL PAAAVKALAA DLAGQHRVED LALPQSGLGL LPLTDSALGD TYFIGEIPLA QAHVRVTTTQ GQSIEGAAIL VDDRAGVARS
MAILDAVLAA RMPGCEAALR LLTQGATAVA EQGRQRRALL AATRVDFALL GTNEEDDDE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phnI PhnI TnPa43 1227 8375-9601 +
Class:   Passenger Gene
Sub Class:   Other
Function:   carbon-phosphorous lyase complex subunit PhnI
Sequence Family:  PhnI (Pfam: PF05861)
Comment:   carbon-phosphorus lyase
Protein Sequence:  
MECPLPAGRG PDSGERARGR GIAPNHPHQP QRSPLMGYVA IKGGGRAIAG AEAAVEALRC AEGPAGTPLT LSAIEQQLRL LTSRVVSEGG LYHPRLAALA
IKQMQGDTLE AAFALRAYRS TKPRLMDVPV QDTSRMRLIR RISSAFKDIP GGQMLGPTTD YALRLMRLDL ANESPEDFRA VSRRFLDSVA DTDLPDSFPK
VVDALRDEGL LPPLTRRAHA AFDITRDPLV FPVPRSAALA TMARAETGSL LAIAYSNMRG YGDVHPTIAE LRVGYVPVML PHPVTGEPIE AGEVLMTECE
VVAMFEGDAT DGPPTFTLGY GACFGHNEVK AIAMAILDRA LQKGMRDGPS NPSEDPEFVL LHVDGVDSMG FASHYKMPHY VTFQSDMDRL RTTQDKATAQ
PTQEGAPS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phnJ PhnJ TnPa43 906 9598-10503 +
Class:   Passenger Gene
Sub Class:   Other
Function:   Phosphonate metabolism protein
Sequence Family:  PhnJ (PF06007)
Comment:   Phosphonate metabolism protein PhnJ
Protein Sequence:  
MNPGYELPLD EAGYSFGFLD EYAKREVRRT ILKAISIPGY QTPYASREMP MGRGFGTGGL QVTLSLIGEG DTLKVIDQGA DDSVNAVNLR HFVELTCPGV
DTTEHTLDAT LIQSRHRIPE TPLTEAQVLI LQVPYPDPLV VVEPSEARRK VMHGEGDYSR LLTKLYEDIV QFDEITISHR YPTRINGHYV IDPSPIPRYD
VPQLHQSPAL ILLGAGREKK IYAVPPYTRA DPLAFDDVPF RTEDFTNEHG QRRACERCGA TDSFLDELIA DDGGKHWHCS DSDFCNSRMA RQAEQAQETT
V

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phnK PhnK TnPa43 573 10729-11301 +
Class:   Passenger Gene
Sub Class:   Other
Function:   phosphonate ABC transporter ATPase
Sequence Family:  ABC_tran (Pfam: PF00005)
Comment:   phosphonate ABC transporter ATPase
Protein Sequence:  
MSPPLVKPMF ALNAAQQRWL RNHRFGMVYQ NPHLGLNFNV SAGGNIAERL LMSDLAHYGE IRERARSLLA RTEVLAERMD ESPKKFSGGM QQRVQIAKAL
ATQPPLLYLD EVTTGLDLSV QARILDLILE IQQELGTAMI VVTHDLGVIR LLTGRTIVMK YGRVIESGLT DQILEDPQHA YTQRLVASAL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phnL PhnL TnPa43 726 11315-12040 +
Class:   Passenger Gene
Sub Class:   Other
Function:   phosphonate C-P lyase system protein PhnL [Proteobacteria]
Comment:   phosphonate C-P lyase system protein
Protein Sequence:  
MQEAILKIEG LSKQFQLHDQ NKLIPSCAQV QLEVFAGELT ALIGPTGAGK SSVLKAIYRT YLPSSGRILY RDANGAITDL AQASEHRMLE LRKQDLGFVT
QFLHCLPRKS AVEVVAEPLV QRGSPREAAA ERARELLALL NVPERLWAVP PATFSGGEKQ RVNLARGLIA RPRLLLLDEP TASLDPSTTD RVVELLKSIK
AEGVAMLAIF HDPELVRRLA DRVVTLTPPV SAAALLETCA S

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phnM PhnM TnPa43 1155 12037-13191 +
Class:   Passenger Gene
Sub Class:   Other
Function:   alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase [Proteobacteria]
Comment:   alpha-D-ribose 1-methylphosphonate 5-triphosphate WP_003118407.1
Protein Sequence:  
MNPILLTHAR VVFPTEVRDN VAILIEGDTI TAIDPASSAG ATEIDLRGRT LMPGLIDLHC DAMEKEVEPR PGVHFPLEFA CAQADKRNAA AGITTVFHAL
SFANHELGVR NNAFAAEIAR SIGDWQAHAL IDNRVHVRYE VTDETAPPVL SALLQDGHAH LMSFMDHSPG QGQFRDVEAY RAYLAKTYKT DEAQIDDILA
RKAGAAQGAM RRMEQLAELA RACGVSIASH DDDSPQKVAT VKALGAVVSE FPVNLETAQA ARAQGLATLF GAPNILRGKS QSGNMRALDA VLAGVADCLC
GDYSPAALLP SVMRLPDLAG IPLAEAVALV TCNPARAAGL HDRGEIAVGK RADLIAVKTM GGLPQAERVW SGGKASLVAH FDHA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phnN PhnN TnPa43 570 13205-13774 +
Class:   Passenger Gene
Sub Class:   Other
Function:   phosphonate metabolism protein
Comment:   phosphonate metabolism protein
Protein Sequence:  
MRTRLIYVVG ASGSGKDTLM GHARQKLAGD PRVCFAHRYI TRPATAGGEN HVALTTEEFT ARQNGKLFAM HWSSHGLHYG IGIEINQWLG KGITVVINGS
REYLDEARQR YPELLPVTID VATTVLRDRL LARGREDAES IEQRLHRHET LRLQPVPGVL IQNNGPVEVA GEALIRLIAE HTQGAPVCV

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phnP PhnP TnPa43 768 13765-14532 +
Class:   Passenger Gene
Sub Class:   Other
Function:   phosphonate metabolism protein PhnP [Proteobacteria]
Comment:   phosphonate metabolism protein WP_003118405.1
Protein Sequence:  
MRVSFLGTGA AGGVPLYGCT CRACERARTE PHFVRRPCSA LIESGGTRVL LDAGLMDLHE RFAPGSLDAI VLTHYHPDHV QGLFHLRWGK GTPITVYGPP
DSEGCADLFK HPGVLAFETV HKFEAFTVGA LRLTPLPLLH SKPTLGYAIE GTQGQRFAYL TDTLGLPPKS AKFLRAWGDF DMAIDCSYPP HPTPKNHNDW
DEAHRCAIES GARITWLTHA GHALDDWMME ETPSVASHIR LARDGSTADI PSQTQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
eamA family transporter EamA family transporter TnPa43 810 14529-15338 +
Class:   Passenger Gene
Sub Class:   Other
Function:   EamA-like transporter family
Sequence Family:  EamA (Pfam: PF00892)
Comment:   listed as hypothetical protein in Blast, Most likely EamA family transporter
Protein Sequence:  
MNAPLALALS VAMHVTWNLM ARHLPRESNP LWWVLLAHLV LFAPWGFWEL ATTVVWSLEM TLLLIVSATA NVVYFSGLAR AYEHAPVALV YPLVRSSPLF
IAIWGTLFFG QNLPPIAWLG IGISVLGLLV MASSAQQGSD RRAFRWAMLA MLATSVYSLS DKAATEHIPS FMGLVGFLSV GYLASWISMT LRMHRHTRSW
VPAQRIDLAS LALGGTCIGL AYALVIHAMR QLLRRRSCRT PTPVSCSLQF SPFFCSMTKS DGKRESWGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnPa43 1335 15456-16790 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MSQISRYVEA AERDNTRRSY AAAIRHFEVE WKGLLPTTAD ATSRYLADHA ATLAISTLRQ RLAALSRWHI DHGFADPTKA PLVRQVLKGI RSIHSVAEKR
ARPLEIDVVQ QIDQWLGVAI GNAERSDDRL ALLRHTRNRS LLLLGFWRGF RSDELVNLRV ENVEVSPGEG LSCYLSRSKG DRQMLGRVYK CPALSRLCPV
TAFTAWVSLV GLTQGPVFRK IDRWGRIGQE GLHANSLIPL LRSLLAEAGV AASEAYSSHS LRRGFAGWAR ASGWDIKELM EYVGWKDVKS AMRYLDASGS
ALQARFEAGL ATLAPADRAD RSPPPSMHAP AEQTKEQAQR PRLPELATPS AILRVTVLLA RFSPQSRGLT RGRRLIEQTC FERYAMQRLN TEGTQYELTV
PYESRDSLEE AIAALLDDMY RIAEDNQCLL EAAFHEPATD SYWD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnPa43 2988 16847-19834 +
Class:   Transposase
Transpoase Chemistry:   DDE
Sequence Family:  DDE_Tnp_Tn3 (Pfam: PF01526)
Protein Sequence:  
MTTLHETAYP HLKPDPTERE LAELFTPTEA ERALVAGVGK RPLPRVAALI HLKVFQRLGY FLTLSDVPQV IREHVAQHAG VPRAPALADL KRFEASGSRM
VVFTALRRYL NVKPLNPAGY AWLGVVADTA AETKHAVADI INVMLEELVH HRCELPAFST LDRMAFRARE KSNNQHFSAI AGQLTSQTKT LIDGLLKTAT
GESASPWQML KREPKRPTNK ETRTYIQHIR RLQHLVEQLP KPDVPVPKLK QFRLLARALN ATEMAELKPQ KRYALVVIFI RAQHAQSLDD AADLFIRLMQ
NLENNARQKL LSFQQERVHK TDMLVGQLKD ILGAYQLVGT DTQRVEAIST TLVAEVDELL NECEQHLAYA GRNHLPFLLQ PYKMVRAQLL NCIDIASPKA
SSEDLVVERL MEALSKLRDN RADTVPLDML GLSEDTDLRW MSAQWRKLVL VKPAGKGRAE SVRRRYFELA VMHAVKDDLK SGDLFIKFGE RYDDYREQLV
DDETFERELG DYGQVTGIET EPGAFVSKLK SSMALRAMEI DAGFPENAHA EIVDGRLILR KPPRSDIVEA AARIDGMITE RMEAASIVDV MIDTERWLDL
HKLFRPLAGT DSRLEDLRMR VITTLFCYGC NLGPVQTAKS IKGLSRRQIS WLNLKYVSED LLDKAIVKVI NAYNKFELPG YWGTGKHASA DGTKWNLYEQ
NLLSEHHIRY GGYGGIGYYH VSDKFIALFS HFISCGTYEG IHILDGLMSN ESDIRPDTIH GDTQAQSYPV FALAHLLGIQ LMPRIRGIQD LKFHRPQVGT
VYQNINTLFS DVIDWQLIEL HLPAMLRVAV SIKTGKITPS AILRRLGTYS RKNKLYFAFV ELGKVIRTMF LLSYIGDVGL RKVIHAETNK SEQFNGFAGW
SFFGGEGIIA ENIRHEQRKV IKYNHLVANM IILHNVVGMT RVLRELRDEG TEITPEILGG LAPFRTAHIN RFGDYTLDFR RKIGPLDFEV TIIPI