Transposon
Name: TnPa40       (Synonyms: Tn7173)
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Pseudomonas aeruginosa DK2
Place of Origin:Denmark Date of Isolation:2012
Other Geographic Information:Copenhagen CysticFibrosis Clinic CF patients since 1973

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 37 bp)GGGTGCCCGCAGAATTCGGAAAAAATCGTACGCTAAG
IRR (Length: 37 bp)GGGGAGCCCGCAGAACTCGGAAAAAATCGTACGCTAA

 Sequence     
DNA SequenceLength  6591 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGTGCCCGC AGAATTCGGA AAAAATCGTA CGCTAAGCCG CGCCATGTGC TTGCGCGCGA GCGCTCTCAA GAGGATGGTC CCTCGTACTT CCGAAAAGCG 100
CGCCAAAGCA CAACGTCATA GACGACCTTG AGTAGGCCGC AGGCCACCAG CGGCGCCGCC AGCCAGCCGG CGGCGAATAG GGCGCCGCCA ATGGCGGGGC 200
TCGCTATGGC ATTGAGGCGC TTTACCGCAC CGCCGTAGTT GTTTTCCCAG TGGCTGACGA TCAGCTTCTC GGACAGGCCG GTGAGTTTGG CCGGATCGCA 300
TGAAAGAGGT TTCAGTTCGT AAGGCATCTT GGCTTCCTCA GCAAGGTGGA TCGGAAACGG CGCGACGAAG GCTGACTCGA TCAGGTTCAG CCTTGGTTCG 400
GAAATACCAG CCACCCCGCC AATCCCGCCG CGAGGATCAC GACGACGACG TTGAGCTTGT TCTTCCAGGC ATAAAGGAAT GCCAAGCCTG CGGCGAAAAT 500
CGACATGCCC ACCGTCAACG ATGGGACACG TTCAGCAGTG ACCTGCGCCA AGTCGATGGT GGTTGCGCCG ATCAGGCCGA CTACCCCAGC CGCGACGCCG 600
TCCAGAAAGG CGTGCAGCCG TTTGTTCTCC ACGACCGCCT CCAGCCGGTC GTAGAAAATC AGCGAGAACG CAAAGGCCGG AAGAAAGACA CCCACCGTCA 700
TGGCCACCGC CCCGATCGGC CCCCCCGCCA CATAGCCGAC GAACGTGGCG AAGATGATGA GGGGTGCCGG TAGCACACCG GACAGCGCCA GGCCGTCCAG 800
GAACTGCCCA TCCGTCATCC ATCCGCGCCC GACGGCGTCG TTGCGAACGA ACGGAATCGC TGTGTAGGCG CCGCCGAAGG TGAGCAAGCC GGCCTTCAGG 900
CCCGACGCGA AGATGAGCAG CACCGAGGCC TGGCCCTGAA CGACCGCTTC CACAAGCTTC GCTGTCGGTG CAGCCCACAA AGCCACGGCC GCGGCCAGCG 1000
CCACCGCCGC CAGTGTCACC AAGAGCGCTG AGGCCCGATG ATTCAGCACG AGCAGGGCGT ACACAAGGCC GCCCGCCGGC AGGGTGATCC AGAAGTCGAC 1100
ACGACCTATG GCTGCCAGCG CGCAAACGAT GGCAATGACC CACAACCAGC GATCAAGCAG GATGTGCTCG CCGATACGGT GCACGGCGCG CACGATCAGG 1200
GCGATCACAG CCGCCTGCAC GCCAAGGAAC GCCGCGCCCA GCGCGGTACC CACGAATTCA ATCTGGAAGT ACAACCAGGA CAGCGCGAAC ATCAGCAAGA 1300
ATCCGGGAAG CATGAAACCG AGTCCCGCCA GCACGCCCCC CAGCCGCCCC TTTGCTCGGA TGCCCAAATG AACGCATATT TCATGCGCTT CGGGTCCGGG 1400
CAGCACCTGC ATCACCGCAA GCAGCTTGTT GAAGCGTTTG CTGGAGATCC AGCGTTCCTC GTCCACGAGC TCGCGGCGCA ACATGTCGAT CTGAGCCACA 1500
GGCCCGCCCC ATGCGAGCAA GCCGAACTTG AGGAAGCGCG CGAAGAGCTG TGGGTAGCTC ATGGGTGGAG GGACGGCTTC AGTCGTGGCA TCCGTCGCCT 1600
TGCTCGGGCG ATACGACTCT TCATTCGCAA CGCTCATAGA TCTTCTCCTT GTAGTTCAAC AGTAACCAGT CAAATACGGA AGTTGGCCAA CAAGCCGTCG 1700
AATACGGCCG AAGCCTGCGG CCAGCAGCAG GTCGTCTTGG GTGATGTCCC AGAAAGACGG ACGGGCCGGG CGTGGTTGCG CGGCGGTCTG AGGACTGGTC 1800
GGGGCGTTCA CGTTGTTTTG TCCTCGTAAC TCTTCAATAG CCAATCAAAA ATTTCGCACG CGCGGGCAAG CAGCGCGTCG TCATCGGGTT CCGATGCGCG 1900
CAAGCCGGCG AGCAGCGATT CGATGCCCAG CGCTTCTGCT ACCGGCAGCC CGCCCAAATC CAGGCAATGC ACGAGCTTGC CCAGGCGTAC CAGTGCAGGG 2000
GCGGAATCAA GTCCGAAACT CGCCAGCAGC GTCTCGAAGG TGACCTTGGT GCCCACATGA CTGAAGGCGG CGCCGTCGAA ATCGAAGCCG AGCCAGCCAT 2100
TGCGGCAGTC GGAGGGACTC GCCAGCCAGA CGATGCGCGC GCTCGGGTCG ATGAACCGCC GGATCAGCCA GGCCGAAGCG AGTCGGTCCA CCCACGGGCG 2200
CGCCCGCGTG GCCCAGGTCC GACCCTGATA GTCGGCGCGG TTCAGCCGCG GAATATCCGT CTGCCGGGCG GTCGGCTCGT CGGGAGACAT ACGGCGGGTG 2300
ATCGCGTCGC GCAGGTCGTC CAGCAGGCTC AAGGTCTGCC GCTGCGCCTC GCCGGGGAAG AAGTCGATGC GGTTCACCTG CTCGAAGCGG CGCACGAGCG 2400
GCTGGAGCTT GCGCATGGCA TCGGCGCCGT CCGGGGATGC CAGGTTACGC CCGAGCGCTT TGATCTCCTC GGCGATGCTG GCGTACTCCT CGCCCCGGTC 2500
GAACAGGGCG CGTAGCGCGG CCTTCTGAGC TTCGTCACAC CCCGACAGTC GATAGACCTG GCCGCTGCCC CCGACTTCCA CCGCCTGCGC CGCCACTTCG 2600
CCCAGCGTCG CCGCACTGTC CGCCGAGTCG GGCAGCAGAT AGACCCCGTC GCGCAGCGTT GCGCAGCCCT GCGCTTTGAC AGAACGCCAG ACGCGCATGC 2700
GGCCGGTCGA TGCCTTGGTG GGCAGGCTGA CGAATAGGGC AAGAAAGCTC AAGCACGGGC TCCTTCGTCA AAAAGATGAT TAATGTTACA AATACTACAA 2800
TAAGTTATAT CTAATACACA ACTCATGTCG GAGCGTCAAT TTAAGGCATA CCCTAACTGG ATGTCAGGAA TGGCCACGCT GCGCCGTCAG AATAGAGTCT 2900
GCTTTCACAT TCTTTGACAC ATGCTTGCCA AGGTCATAGA TTCCAACCTG ACAAATTCAA GGCTTAGGGC GCAATGGAAC CAAAAACCAA CGTAAGCCCT 3000
ACCGCCCATC CAGCCTATGG AGGCATCTTG CAGGGACAAC GCATCGGTTA CGTTCGGGTC AGCAGTTACG ACCAGAACCC GGAACGCCAA CTTGAGCAGG 3100
TCGAGATCGG CAAGCTGTTC ACCGACAAGG CCTCGGGCAA GGACACCCAG CGCCCGCAGC TGGAAGCCAT GCTCGGATTC GTCCGCGAAG GCGATACCGT 3200
GGTGGTGCAC AGCATGGATC GCCTGGCGCG CAACCTCGAC GATCTGCGCC GTCTGGTGCA AAGGCTGACC AAGCGCGGCG TGCGCATCGA GTTCTTGAAG 3300
GAGGGGTTGG TGTTCACCGG CGAGGACTCG CCCATGGCCA ACCTCATGTT GTCGGTCATG GGGGCCTTTG CCGAGTTCGA GCGCGCCCTG ATCCGCGAGC 3400
GGCAGCGCGA GGGCATCGCC CTGGCCAAGC AGCGCGGTGC TTACCGGGGC CGCAAGAAAG CTCTCTCCGA CGATCAAGCC ATCACGTTGC GGCAGCGGGC 3500
CGCTGCCGGC GAGCCGAAGG CTCAGCTCGC ACGCGAGTTC GGCATCAGCC GTGAAACCCT CTACCAGTAC CTTCGCACGG ACGACTGAAC CATGCCGCGT 3600
CGCTCGATTC TCTCGGCTAC GGAGCGCGAC ACCCTGCTTG CGCTGCCAGA AAGCCAGGAT GACCTGATCC GCTACTACAC CTTCAACGAC TCCGACCTAT 3700
CCCTGATCCG TCAACGGCGG GGCGATGGCA ACCGCCTCGG CTTCGCCGTG CAGCTCTGCC TGCTGCGCTA CCCTGGTTAT GCGCTGGGCA ACGACACGGC 3800
GCTACCCGAG CCCGTGATCC AGTGGGTGGC CAAGCAAGTC CAAGCCGACC CCGCGAGTTG GGCGAAGTAC GGTGAGCGCG ACGTGACCCG CCGCGAGCAC 3900
GCTCTGGAAC TGCGCACCTA CCTGCAACTG GCCCCGTTCG GTCTGTCGGA CTTCCGCGCC CTGGTGCGCG AGTTGACCGA GCTGGCCCAG CAGACCGACA 4000
AGGGCTTGCT GCTGGCCGGG CAGGCGCTGG AGAGCTTGCG CCAGAAGCGG CGCATCCTGC CGACGCTGAG CGTTATTGAC CGGGCGTGTT CGGAGGCCAT 4100
TGCACGCGCC AATCGGCGGG TCTATCGCGC CCTGATCGAG CCGTTGAACC CATCGCATCA CGCCAAGCTC GACGAACTGC TCACCATTAA GGCCGGCAGC 4200
AACAGCACTT GGTTGACCTG GTTGCGGCAA TCACCGCTGA AGCCGAACTC GCGGCACATG ATCGAGCACA TCGAGCGGCT GAAGATTTTC CAACTGGTGG 4300
GCCTTCCCGA CAGCCTCGGC CGGCACATCC ACCAGAACCG ATTGCTGAAG CTCGCCCGCG AGGGCGGGCA GATGACGCCA CAAGACCTCG GCAAGTTCGA 4400
ACCGGAGAGG CGCTATGCCA CGCTGGTCGC CGTGGTACTG GAAAGCACCG CGACCGTGAT CGATGAACTG GTTGATCTGC ACGACCGCAT CCTGGTCAAG 4500
CTGTTCAGTG GCGCGAAACA CAAGCATCAG CAGCAGTTCC AGAAGCAGGG CAAAGCGATC AATGACAAGG TGCGCCTGTA CTCGAAGATC GGCCAGGCCC 4600
TGCTGGACGC TAAAGAGTCC GGTGACGATC CGTTCGCCGC CATCGAGGCG GTCATTCCCT GGGACGAGTT CACCCAGAGT GTCACTGAGG CCGAGCTGCT 4700
GGCCCGGCCG GAAGCCTTCG ACCACCTGCA CCTGGTCAGC GAGAACTTCG CTACGCTACG CCGCTACACC CCAGCCTTTC TGGAGGTGCT TCAGCTCCGA 4800
GCCGCGACGG CAGCGCAAGC CGTGCTGGAT GCCGTTCAGA CCCTACGCGA GATGAATGCC GATAATCTGC GCAAGGTGCC CTCCGACGCA CCGACCGCCT 4900
TCATCAAGCC GCGCTGGAAA CCGCTGGTGA TCACCCCGGA AGGCATCGAC CGGCGCTTCT ACGAAATCTG CGCCTTGTCC GAGTTGAAGA ACGCGCTGCG 5000
CTCCGGCGAC ATCTGGGTCA AAGGCTCGCG GCAGTTCCGC GACTTCGATG ACTACCTACT GCCTCCCGAG AAATTCGCCG CACTCAAGCG GGAACAGGCG 5100
CTGCCACTCG CGATCAACCC GAACAGCGAC CAGTACCTGG AAGAGCGTTT GCAGCTGCTG GACGAGCAGC TGGCCACTGT CACCCGACTG GCAAAGGACA 5200
ACGAACTACC CGATGCCATC CTCACCGAGT CCGGGCTAAA AATCACCCCG CTGGATTCCG CGGTGCCCAA CACCGCGCAG GCGCTGATCG ACCAGACCAG 5300
CCAGCTACTG CCGCGCATCA AGATCACCGA GCTGCTGATG GATGTGGATG AATGGACGGG CTTCACCCGC CACTTCACGC ACCTGAAGGA TGGCGCACAG 5400
GCGAAAGACC GGACGCTACT GCTAACGGCG ATCCTGGGCG ATGCCATCAA CCTCGGCCTG ACCAAAATGG CCGAGTCGAG TCCGGGCATG ACCTACGCCA 5500
AGCTGTCCTG GTTGCAAGCC TGGCACATCC GTGACGAAAC CTACTCGACG GCCCTGGCCG AGCTGGTCAA CAGCCAGTTC CGGCATGCCT TCGCCGCCAA 5600
CTGGGGTGAC GGCACCACCT CATCCTCCGA TGGCCAGCGT TTCCGTGCCG GCGGTAAAGG CGAGAGCACC GGCCACGTCA ACCCGAAGTA CGGTAGCGAG 5700
CCAGGACGGC TGTTCTACAC CCACATCTCT GACCAGTACG CGCCGTTCAG CACCCGCGTG GTGAATGTAG GCGTGCGTGA TTCCACCTAC GTGCTCGACG 5800
GTCTGCTGTA CCACGAGTCC GATCTGCGGA TCGAGGAGCA CTACACCGAC ACCGCTGGCT TCACCGATCA CGTCTTCGCC CTGATGCACC TGCTGGGCTT 5900
CCGCTTCGCG CCGCGCATCC GCGACCTCGG TGAAACCAAG TTGTATGTGC CCAATAGCGT CCAAGACTAC CCGACGCTGC GTCCAATGCT CGGCGGAACC 6000
CTGAACATCA AGCACGTCTG CGCTCACTGG GACGAGATTC TGCGGCTGGC CGCGTCGATC AAGCAGGGCA CCGTCACCGC ATCGCTGATG CTGCGCAAGC 6100
TTGGCAGCTA CCCGCGCCAG AACGGCCTGG CCGTGGCTCT GCGCGAGCTG GGTCGGATCG AGCGCACGCT GTTCATCCTC GATTGGCTGC AAAGCGTGGA 6200
ACTGCGTCGC CGCGTGCATG CCGGATTGAA CAAGGGCGAG GCGCGTAACT CCCTGGCCAG GGCGGTGTTC TTCAACCGCC TCGGCGAGAT CAGGGATCGG 6300
AGTTTCGAGC AGCAGCGCTA CCGGGCCAGC GGCCTCAACC TGGTGACGGC CGCCATCGTG TTGTGGAACA CCGTGTACTT GGAGCGCGCG ACCCAGGCCC 6400
GAGAAGAGGC AGGCAAGCCA GTTAATCCTG AGTTACTGCA ATACCTTTCG CCATTGGGCT GGGAGCACAT CAACCTGACC GGCGATTACG TTTGGCGGCA 6500
AAGCCGCAAG CTGGAAGACG GGAAATTCAG GCCGCTGCGG CAGCTCGGAA AACCTTAGCG TACGATTTTT TCCGAGTTCT GCGGGCTCCC C

 Recombination Sites     

Name Coordinates Gene Sequence
res_site_II 2893-2919 27 TAGAGTCTGC TTTCACATTC TTTGACA
res_site_III 2922-2953 32 TGCTTGCCAA GGTCATAGAT TCCAACCTGA CA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
sod TnPa40 67-327 Passenger Gene Heavy Metal Resistance -
chrA TnPa40 387-1637 Passenger Gene Heavy Metal Resistance -
chrR TnPa40 1808-2698 Passenger Gene Heavy Metal Resistance -
tnpR TnPa40 2974-3588 Accessory Gene Resolvase +
tnpA TnPa40 3592-6558 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
sod Sod TnPa40 261 67-327 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Chromate
Comment:   superoxide dismutase chromate restistance
Protein Sequence:  
MPYELKPLSC DPAKLTGLSE KLIVSHWENN YGGAVKRLNA IASPAIGGAL FAAGWLAAPL VACGLLKVVY DVVLWRAFRK YEGPSS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
chrA ChrA TnPa40 1251 387-1637 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   chrA
Target:   Chromate
Comment:   efflux protein
Protein Sequence:  
MSVANEESYR PSKATDATTE AVPPPMSYPQ LFARFLKFGL LAWGGPVAQI DMLRRELVDE ERWISSKRFN KLLAVMQVLP GPEAHEICVH LGIRAKGRLG
GVLAGLGFML PGFLLMFALS WLYFQIEFVG TALGAAFLGV QAAVIALIVR AVHRIGEHIL LDRWLWVIAI VCALAAIGRV DFWITLPAGG LVYALLVLNH
RASALLVTLA AVALAAAVAL WAAPTAKLVE AVVQGQASVL LIFASGLKAG LLTFGGAYTA IPFVRNDAVG RGWMTDGQFL DGLALSGVLP APLIIFATFV
GYVAGGPIGA VAMTVGVFLP AFAFSLIFYD RLEAVVENKR LHAFLDGVAA GVVGLIGATT IDLAQVTAER VPSLTVGMSI FAAGLAFLYA WKNKLNVVVV
ILAAGLAGWL VFPNQG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
chrR ChrR TnPa40 891 1808-2698 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Chromate
Protein Sequence:  
MRVWRSVKAQ GCATLRDGVY LLPDSADSAA TLGEVAAQAV EVGGSGQVYR LSGCDEAQKA ALRALFDRGE EYASIAEEIK ALGRNLASPD GADAMRKLQP
LVRRFEQVNR IDFFPGEAQR QTLSLLDDLR DAITRRMSPD EPTARQTDIP RLNRADYQGR TWATRARPWV DRLASAWLIR RFIDPSARIV WLASPSDCRN
GWLGFDFDGA AFSHVGTKVT FETLLASFGL DSAPALVRLG KLVHCLDLGG LPVAEALGIE SLLAGLRASE PDDDALLARA CEIFDWLLKS YEDKTT

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnPa40 615 2974-3588 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MEPKTNVSPT AHPAYGGILQ GQRIGYVRVS SYDQNPERQL EQVEIGKLFT DKASGKDTQR PQLEAMLGFV REGDTVVVHS MDRLARNLDD LRRLVQRLTK
RGVRIEFLKE GLVFTGEDSP MANLMLSVMG AFAEFERALI RERQREGIAL AKQRGAYRGR KKALSDDQAI TLRQRAAAGE PKAQLAREFG ISRETLYQYL
RTDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnPa40 2967 3592-6558 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRSILSAT ERDTLLALPE SQDDLIRYYT FNDSDLSLIR QRRGDGNRLG FAVQLCLLRY PGYALGNDTA LPEPVIQWVA KQVQADPASW AKYGERDVTR
REHALELRTY LQLAPFGLSD FRALVRELTE LAQQTDKGLL LAGQALESLR QKRRILPTLS VIDRACSEAI ARANRRVYRA LIEPLNPSHH AKLDELLTIK
AGSNSTWLTW LRQSPLKPNS RHMIEHIERL KIFQLVGLPD SLGRHIHQNR LLKLAREGGQ MTPQDLGKFE PERRYATLVA VVLESTATVI DELVDLHDRI
LVKLFSGAKH KHQQQFQKQG KAINDKVRLY SKIGQALLDA KESGDDPFAA IEAVIPWDEF TQSVTEAELL ARPEAFDHLH LVSENFATLR RYTPAFLEVL
QLRAATAAQA VLDAVQTLRE MNADNLRKVP SDAPTAFIKP RWKPLVITPE GIDRRFYEIC ALSELKNALR SGDIWVKGSR QFRDFDDYLL PPEKFAALKR
EQALPLAINP NSDQYLEERL QLLDEQLATV TRLAKDNELP DAILTESGLK ITPLDSAVPN TAQALIDQTS QLLPRIKITE LLMDVDEWTG FTRHFTHLKD
GAQAKDRTLL LTAILGDAIN LGLTKMAESS PGMTYAKLSW LQAWHIRDET YSTALAELVN SQFRHAFAAN WGDGTTSSSD GQRFRAGGKG ESTGHVNPKY
GSEPGRLFYT HISDQYAPFS TRVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG ETKLYVPNSV QDYPTLRPML
GGTLNIKHVC AHWDEILRLA ASIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNSLAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERATQAREEA GKPVNPELLQ YLSPLGWEHI NLTGDYVWRQ SRKLEDGKFR PLRQLGKP

 References     

1.Yang L, Jelsbak L, Marvig RL, Damkiær S, Workman CT, Rau MH, Hansen SK, Folkesson A, Johansen HK, Ciofu O, Høiby N, Sommer MO, Molin S. Evolutionary dynamics of bacteria in a human host environment. Proc Natl Acad Sci U S A. 2011 May 3;108(18):7481-6. doi: 10.1073/pnas.1018249108. Epub 2011 Apr 25. PubMed ID: 21518885