Transposon
Name: TnMCR5ECO26H11       (Synonyms: Tn7163)
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Escherichia coli O26:H11 10875 Molecular Source:scaffold40
Date of Isolation:2017

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 39 bp)GGGGTCGTCTCAGAAAACGGAAAAAATCGTACGCTAAGC
IRR (Length: 41 bp)GGGGTCGTCTCAGAAAACGGAAAATAAAGCACGCTAAGCCG

 Sequence     
DNA SequenceLength  7334 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCGTCT CAGAAAACGG AAAAAATCGT ACGCTAAGCA CCGCAAAGAA ACTCGTGATG GACAGGCACG CTACGGTCGC GGGTCGTGCC TGCCCATTGC 100
TCAGTTGCCC TTGACGCGCA ACAGTGTCAG CGTACCGGCA GCCATCAACA CGGCCGCCAG CCCGAAACCG ACCACAGGCG AGACCGCCGT CCACACCACG 200
CCGACCGAGG CGCTGGAAAT GAACTTGGCA GCGCCATTGA CGGTGCCCAG CGCGCCATAG CTCATCGCCA GCGTGTCCGG CTGCACCATC TCGGCCGTCA 300
CGGTGGACTC CAGCGCTTCC TGGACCGCCA CGTACAGACC GGCAATGAAG AACACCCCGG CCAGCAGCGG CACGCTGGCT ATGCCCAGCC AGAATGCGAG 400
CGCCGTCAGC ACCGCCGTCA GTGTGCCCAG CACATAACCG GCAATCAGCA CCGGCAAGTG GCCGACACGA TCCGCCAGCA CGCCCACTGG GTAGGAAACA 500
GCGACCTGCA CGAGGTTGCG CCACACATAG AGAAGGCCAG CCACCTGTGC CGCCTGGATA ACGCCCAGCG AGGGGGTCAG CAAGGTCGTG GCCGCCAGGA 600
TCAACAGGCT GTGCGAGAAA TCACCGATGC CAAAGATGCC GACCGCGCCG AGATAGCGTT TGAACCGGGC GGGCAGGCCA CGCAGCGAGC TGAAGAACTT 700
CAGGGCCGGG TTGGGCGAAT GCTCCGGGTC TTTGACCAGC GTGAGAAACG CCAGCACGGC TAAGACACCC GGAATCACCG ACAGCCATAA TACGAGCCGG 800
AAGGGTCCAG CCGCGTCGCT CCAATGAATG CCTTGCGCCC AACCCAGCAG CGCGACGCCC AGCAAGGGGC CGACACCGCA CCCACGGTGT CGGCAGCCCG 900
GTGAAAGCCG AAGGCGCGGC CACGCGTTTC CGGCGACACG GCCTGGATAA CGATGGCATC ACGCAGCGGG CCGCGCAGCC CTTTGCCGAA CCAGGACACG 1000
ATGCGCCCCA GCAGCAGGAG GGGCCAGCCA GCCGCCAGCG CGATCAGCAC CTGCCCCAAC GGGGTCAGTC CGTAGCCGAC CATCACAAAG AGCTTGCGGT 1100
GTCCCAGCTT GTCGGCGATG TAGCCAGACA CCATCTTGGT GAATGCGGCG ATGGCGTCGG CAATGCCTTC GATGAGGCCA AGCACGGCGG CGGGAATGCC 1200
GAGTACGGCC AGAAAGCCAG GCAGGATGAC CGTGGTGGTT TCGTAGCAGA AATCCCCCAA TGAGCTCGTG ATCCCCGCAC CTGCGACGGT GCGGTTGAGC 1300
CAGCGTTTCG GCGGATCATC CGTTGACGTC GTCATTGTGG TTGTCCTTTT CTGCATGTTG CCAGAAGGTC CAACTCTGGC GTGTAGGCAG CGGTTTTCAC 1400
GTCGAACATC CCGAGCAAGG TGTGAAACAG GTGATCGTGA CTTACCGGTG CCCGAGAGGC ATGAGTTTGC ATACAGGCTT GGTCGGCATA AACCTGACTC 1500
GACTGCCACC AGATCATCGG CACCTTGATC TGCTCATCCG GCGCGATGAC GTAAGGTATG CCATGGAGAT ACAGGCCTTT CTCGCCGAGC GATTCCCCAT 1600
GATCGGAAAC GTACAGCAGC GCCGTGTCGT GTGAGCGGAT GCCGGACAGC AGGTCAATGG TACGGGCAAG CACATGATCG GTGTAAAGCA CGGCGTTGTC 1700
GTAGGTGTTC ACCAAGGCTT CATGCGAACA GCTGGCCAGA TCGGTGGTGT CGCAGGTTGG CGACCAGCGT CGGTAGCTTG CGGGATAGCG CTGGAAATAC 1800
GCTGGGCCGT GATTGCCCAG CATATGCAGA ACGATCAGCA TATCGCTGCG GCTTGTTGTT ATCTTCTCGG CCAACCCTTC GAGCAGAATT TCATCCAGGC 1900
AGCGCTCGCC ATGGCACAGT GTGGGATGGC CTGCCGAAGA CAGGTTTTCA AAGGGCAGTC CATCACAGAC GCCTTTACAG CCCGACTGGT TATCGCGCCA 2000
GAGAATGTTG ACGTCACTAC GGTTTAAAAC GTGCAGCACG GACTCGCGCC GACGAATCTG GCGTTCGTCG TAGTCGCGCC GACCATTGAG GGAAAACATG 2100
CAGGGAAGGG ATGTAGCCGT ATCCGTCCCG CAACTGGTGA CATCGGAAAA ATTGATCACG TCGCGTGCGG CCAACTCAGG GGTGGTTTGT CGTTCATAGC 2200
CGCTCAACCC CCAATTAGCC GCCCTGACGG TTTCCCCGAC AACCAGTACG AGAGCACGAG GACGGCGGCC TTGTTCTTGA GGCCCTCGAT GCGCATCGGC 2300
TGCAACGACT TCCCTTGCTT CGTCTGCTGA CGATGACGCC TGTTCAGTCA AAACCCGAAT GCCCGAGATG ACGTAGTTTG CAGGAGTGAT CAAATAGCGA 2400
AGCGGCTTGT TTTCACGAAG CGTGGGTATC AGCACATCCA TGACTGGCCA CAGACCCATG GAAATCATGG CGAGAGCGCC AGCCAGACAA GCGCTGCGCA 2500
TCATTACCGC TTGTTTCCAG CCCGTTCGTA AAACCCTGAC TCTCGCAATC CACCACACGG ATACGGCTGC AACCAACAAG TAGGGCAGCA TTCTCCATTG 2600
CAACAGCTCA CTGGCTTCCC TGACGTCCGT CTCCATCAGA TTCCGCAGCA TGGCCTTGTC GAGATAAACC CCGTAGTTGC GCATGAAATA AACGGCGGCG 2700
GGCGTCATGA CAGCAAGCAG AATCAGTAGT GGCTTGACAC TCCAGCGCGT GGCCACCAGA AGGAGCAACA ACCATTGCAG CCCGGTGATC AGCAACCCAG 2800
TGCAAAGGAG CATTAGCCAT GTTCCAGAAG TTAGGGAGTC GCGTCCAGCA AGAAGGGCAT TCCAAAACAC GCCATTGCAC AGCAGGGTGA ACACAAGGCT 2900
GATGAACAGA GTCAAAAATT CAGTGCGCAC TTGCGGGCGC ATTTTCAAGA AAGTGATAAA TGCAGACAAC CGCATGAAAT ATGTCCTCTT CTTTCAACGG 3000
TTTTCATCGT GAGCGTCGAG CACCCGTTGC GCGTAGGCGT CCAGCAAGGC TTCGCAGCCT TTGAGCCGTT CGGCTGCCTC TGCGGCCAGC GTGGCACCGT 3100
AGAAGTCGAG CTTGGCGATT TTTTCCAGCC AGGACAGGAG CTTCTTCAGA TCGACATCGT TTTCTTCCAA CTCGGCGTAG GTGAAGTGCT GAACTTCGGT 3200
TTCGTGGGCG ATCTCGGCCT CGAAGTCGGC GCACTTGCCA AGGAGTTCTT TGTATTCCTC GTCGCGGTCT GCCTTGAAGC GGGCAATGAC TTTGTCTTCC 3300
TGAGCACGAT CAAGCGCAAC CGTTTCCAGC AGGACGGAAT CGCCCGCCAT TTCGTTGATC TCGTTCTCGA TGATCTTGAG TCGCCGGGTG TGATCGTCGG 3400
TCTTGGGCAG CAAGCAGACG CCGTTTTGTA GATAGACAGC GCCCATGCCT TTGAGCTTGC GCCACAGCGC GATGCGCTTC TTGGCCGGTT CGGGTGGCAC 3500
CTTGTAGGTG AGCAATAACC AGTTTTGTGC GTTCATTCAA ACATCTTCAT GCATTAGATG TGAACAACTA TAACGTAACG GCCGTTTCAT TTCAATAGAA 3600
ACATAAAGCA AAGCACCCTA CGCGCTGGCC AATGCCGTCC GGTTGAGGCA TACCCTAACC TGATGTCAGA TGCCATGTGT AAATTGCGTC AGGATAGGAT 3700
TGAATTTTGA ATTTATTGAC ATATCTCGTT GAAGGTCATA GAGTCTTCCC TGACATTTTG CAGGGAATTC CATGACTGGA CAGCGCATTG GGTATATCAG 3800
GGTCAGCACC TTCGACCAGA ACCCGGAACG GCAACTGGAA GGCGTCAAGG TTGATCGCGC TTTTAGCGAC AAGGCATCCG GCAAGGATGT CAAGCGTCCG 3900
CAACTGGAAG CGCTGATAAG CTTCGCCCGC ACCGGCGACA CCGTGGTGGT GCATAGCATG GATCGCCTGG CGCGCAATCT CGATGATTTG CGCCGGATCG 4000
TGCAAACGCT GACACAACGC GGCGTGCATA TCGAATTCGT CAAGGAACAC CTCAGTTTTA CTGGCGAAGA CTCTCCGATG GCGAACCTGA TGCTCTCGGT 4100
GATGGGCGCG TTCGCCGAGT TCGAGCGCGC CCTGATCCGC GAGCGTCAGC GCGAGGGTAT TGCGCTCGCC AAGCAACGCG GGGCTTACCG TGGCAGGAAG 4200
AAATCCCTGT CGTCTGAGCG TATTGCCGAA CTGCGCCAAC GTGTCGAGGC TGGCGAGCAA AAGACCAAGC TTGCTCGTGA ATTCGGAATC AGTCGCGAAA 4300
CCCTGTATCA ATACTTGAGA ACGGATCAGT AAATATGCCA CGTCGTTCCA TCCTGTCCGC CGCCGAGCGG GAAAGCCTGC TGGCGTTGCC GGACTCCAAG 4400
GACGACCTGA TCCGACATTA CACATTCAAC GATACCGACC TCTCGATCAT CCGACAGCGG CGCGGGCCAG CCAATCGGCT GGGCTTCGCG GTGCAGCTCT 4500
GTTACCTGCG CTTTCCCGGC GTCATCCTGG GCGTCGATGA ACTACCGTTC CCGCCCTTGT TGAAGCTGGT CGCCGACCAG CTCAAGGTCG GCGTCGAAAG 4600
CTGGAACGAG TACGGCCAGC GGGAGCAGAC CCGGCGCGAG CACCTGAGCG AGCTGCAAAC CGTGTTCGGT TTCCGGCCCT TCACCATGAG CCATTACCGG 4700
CAGGCCGTCC AGATGCTGAC CGAGCTGGCG ATGCAAACCG ACAAAGGCAT CGTGCTGGCC AGCGCCTTGA TCGGGCACCT GCGGCGGCAG TCGGTCATTC 4800
TGCCCGCCCT CAACGCCGTC GAGCGGGCGA GTGCCGAGGC GATCACCCGT GCTAACCGGC GCATCTACGA CGCCTTGGCC GAACCACTGG CGGACGCGCA 4900
TCGCCGCCGC CTCGACGATC TGCTCAAGCG CCGGGACAAC GGCAAGACGA CCTGGTTGGC TTGGTTGCGC CAGTCTCCGG CCAAGCCAAA TTCGCGGCAT 5000
ATGCTGGAAC ACATCGAACG CCTCAAGGCA TGGCAGGCAC TCGATCTGCC TACCGGCATC GAGCGGCTGG TTCACCAGAA CCGCCTGCTC AAGATTGCCC 5100
GCGAGGGCGG CCAGATGACA CCCGCCGACC TGGCCAAATT CGAGCCGCAA CGGCGCTACG CCACTCTCGT GGCGCTGGCC ACCGAGGGCA TGGCCACCGT 5200
CACCGACGAA ATCATCGACC TGCACGACCG CATCCTGGGT AAGCTGTTTA ACGCTGCCAA GAATAAGCAT CAGCAGCAGT TCCAGGCGTC AGGCAAGGCC 5300
ATCAACGCCA AGGTACGTCT GTACGGGCGC ATCGGTCAGG CGCTGATCGA CGCCAAGCAA TCAGGCCGCG ATGCGTTTGC CGCCATCGAG GCCGTCATGT 5400
CCTGGGATTC CTTTGCCGAG AGCGTCACCG AGGCGCAGAA GCTCGCGCAA CCCGATGACT TCGATTTCCT GCATCGCATC GGCGAGAGCT ACGCCACCCT 5500
GCGCCGCTAT GCACCGGAAT TCCTTGCCGT GCTCAAGCTG CGGGCCGCGC CCGCCGCCAA AAACGTGCTT GATGCCATTG AGGTGCTGCG CGGCATGAAC 5600
ACCGACAACG CCCGCAAGCT GCCAGCCGAT GCACCGACCG GCTTCATCAA GCCGCGCTGG CAGAAACTGG TGATGACCGA CGCCGGCATC GACCGGCGCT 5700
ACTACGAACT GTGCGCGCTG TCCGAGTTGA AGAACTCCCT GCGCTCGGGC GACATCTGGG TGCAGGGTTC ACGCCAGTTC AAGGACTTCG AGGACTACCT 5800
GGTACCGCCC GAGAAGTTCA CCAGCCTCAA GCAGTCCAGC GAATTGCCGC TGGCCGTGGC CACCGACTGC GAACAATATC TGCATGAGCG GCTGACGCTG 5900
CTGGAAGCAC AACTTGCCAC CGTCAACCGC ATGGCGGCAG CCAACGACCT GCCGGATGCC ATCATCACCG AGTCGGGCTT GAAGATCACG CCGCTGGATG 6000
CGGCGGTGCC CGACACCGCG CAGGCGCTGA TAGACCAGAC AGCCATGGTC CTGCCGCACG TCAAGATCAC CGAACTGCTG CTCGAAGTCG ATGAGTGGAC 6100
GGGCTTCACC CGGCACTTCA CGCACTTGAA ATCGGGCGAT CTGGCCAAGG ACAAGAACCT GTTGTTGACC ACGATCCTGG CCGACGCGAT CAACCTGGGC 6200
CTGACCAAGA TGGCCGAGTC CTGCCCCGGC ACGACCTACG CGAAGCTCGC TTGGCTGCAA GCCTGGCATA CCCGCGACGA AACGTACTCG ACAGCGTTGG 6300
CTGAACTGGT CAACGCTCAG TTTCGGCATC CCTTTGCCGG GCACTGGGGC GATGGCACCA CATCATCATC GGACGGACAG AATTTCCGAA CCGCTAGCAA 6400
GGCAAAGAGC ACGGGGCACA TCAACCCAAA ATATGGCAGC AGCCCAGGAC GGACTTTCTA CACCCACATC TCCGACCAAT ACGCGCCATT CCACACCAAG 6500
GTGGTCAATG TCGGCCTGCG CGACTCAACC TACGTGCTCG ACGGCCTGCT GTACCACGAA TCCGACCTGC GGATCGAGGA GCACTACACC GACACGGCGG 6600
GCTTCACCGA TCACGTCTTC GCCCTGATGC ACCTCTTGGG CTTCCGCTTC GCGCCGCGCA TCCGCGACCT GGGCGACACC AAGCTCTACA TCCCGAAGGG 6700
CGATGCCGCC TATGACGCGC TCAAGCCGAT GATCGGCGGC ACGCTCAACA TCAAGCACGT CCGCGCCCAT TGGGACGAAA TCCTGCGGCT GGCCACCTCG 6800
ATCAAGCAGG GCACGGTGAC GGCCTCGCTG ATGCTCAGGA AACTCGGCAG CTACCCGCGC CAGAACGGCT TGGCCGTCGC GCTGCGCGAG TTGGGCCGCA 6900
TCGAGCGCAC GCTGTTCATC CTCGACTGGC TGCAAAGCGT CGAGCTACGC CGCCGCGTGC ATGCCGGGCT GAACAAGGGC GAGGCGCGCA ATGCGCTGGC 7000
CCGTGCCGTG TTCTTCAACC GCCTTGGTGA AATCCGTGAC CGCAGTTTCG AGCAGCAGCG CTACCGGGCC AGCGGCCTCA ACCTGGTGAC GGCGGCCATC 7100
GTGCTGTGGA ACACGGTCTA CCTGGAGCGT GCGGCGCATG CGTTGCGCGG CAATGGTCAT GCCGTCGATG ACTCGCTATT GCAGTACCTG TCGCCACTCG 7200
GCTGGGAGCA CATCAACCTG ACCGGTGATT ACCTATGGCG CAGCAGCGCC AAGATCGGCG CGGGGAAGTT CAGGCCGCTA CGGCCTCTGC AACCGGCTTA 7300
GCGTGCTTTA TTTTCCGTTT TCTGAGACGA CCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res_site_II 3683-3726 44 ATTGCGTCAG GATAGGATTG AATTTTGAAT TTATTGACAT ATCT
res_site_III 3730-3761 32 TGAAGGTCAT AGAGTCTTCC CTGACATTTT GC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
msf TnMCR5ECO26H11 775-1335 Passenger Gene Other -
MCR-5.1 (ARO:3004332) TnMCR5ECO26H11 1332-2975 Passenger Gene Antibiotic Resistance -
chrB TnMCR5ECO26H11 2994-3536 Passenger Gene Heavy Metal Resistance -
tnpR TnMCR5ECO26H11 3772-4332 Accessory Gene Resolvase +
tnpA TnMCR5ECO26H11 4335-7301 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
msf Msf TnMCR5ECO26H11 561 775-1335 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   permease
Protein Sequence:  
MTTSTDDPPK RWLNRTVAGA GITSSLGDFC YETTTVILPG FLAVLGIPAA VLGLIEGIAD AIAAFTKMVS GYIADKLGHR KLFVMVGYGL TPLGQVLIAL
AAGWPLLLLG RIVSWFGKGL RGPLRDAIVI QAVSPETRGR AFGFHRAADT VGAVSAPCWA SRCWVGRKAF IGATRLDPSG SYYGCR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
MCR-5.1 (ARO:3004332) MCR-5.1 TnMCR5ECO26H11 1644 1332-2975 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target alteration (ARO:0001001)
Target:   peptide antibiotic (ARO:3000053)
Sequence Family:  MCR phosphoethanolamine transferase (ARO:3004268)
Comment:   strict match to reference sequence for ARO:3004332 (bitscore: 1127)||Synonyms:
Protein Sequence:  
MRLSAFITFL KMRPQVRTEF LTLFISLVFT LLCNGVFWNA LLAGRDSLTS GTWLMLLCTG LLITGLQWLL LLLVATRWSV KPLLILLAVM TPAAVYFMRN
YGVYLDKAML RNLMETDVRE ASELLQWRML PYLLVAAVSV WWIARVRVLR TGWKQAVMMR SACLAGALAM ISMGLWPVMD VLIPTLRENK PLRYLITPAN
YVISGIRVLT EQASSSADEA REVVAADAHR GPQEQGRRPR ALVLVVGETV RAANWGLSGY ERQTTPELAA RDVINFSDVT SCGTDTATSL PCMFSLNGRR
DYDERQIRRR ESVLHVLNRS DVNILWRDNQ SGCKGVCDGL PFENLSSAGH PTLCHGERCL DEILLEGLAE KITTSRSDML IVLHMLGNHG PAYFQRYPAS
YRRWSPTCDT TDLASCSHEA LVNTYDNAVL YTDHVLARTI DLLSGIRSHD TALLYVSDHG ESLGEKGLYL HGIPYVIAPD EQIKVPMIWW QSSQVYADQA
CMQTHASRAP VSHDHLFHTL LGMFDVKTAA YTPELDLLAT CRKGQPQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
chrB ChrB TnMCR5ECO26H11 543 2994-3536 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Chromate
Protein Sequence:  
MNAQNWLLLT YKVPPEPAKK RIALWRKLKG MGAVYLQNGV CLLPKTDDHT RRLKIIENEI NEMAGDSVLL ETVALDRAQE DKVIARFKAD RDEEYKELLG
KCADFEAEIA HETEVQHFTY AELEENDVDL KKLLSWLEKI AKLDFYGATL AAEAAERLKG CEALLDAYAQ RVLDAHDENR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnMCR5ECO26H11 561 3772-4332 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   )
Protein Sequence:  
MTGQRIGYIR VSTFDQNPER QLEGVKVDRA FSDKASGKDV KRPQLEALIS FARTGDTVVV HSMDRLARNL DDLRRIVQTL TQRGVHIEFV KEHLSFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKSLSSER IAELRQRVEA GEQKTKLARE FGISRETLYQ YLRTDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnMCR5ECO26H11 2967 4335-7301 +
Class:   Transposase
Function:   transposition, DNA-mediated (GO:0006313)
Transpoase Chemistry:   DDE
Comment:   identical to TnAs3 tnpA
Protein Sequence:  
MPRRSILSAA ERESLLALPD SKDDLIRHYT FNDTDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEL PFPPLLKLVA DQLKVGVESW NEYGQREQTR
REHLSELQTV FGFRPFTMSH YRQAVQMLTE LAMQTDKGIV LASALIGHLR RQSVILPALN AVERASAEAI TRANRRIYDA LAEPLADAHR RRLDDLLKRR
DNGKTTWLAW LRQSPAKPNS RHMLEHIERL KAWQALDLPT GIERLVHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LATEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLY GRIGQALIDA KQSGRDAFAA IEAVMSWDSF AESVTEAQKL AQPDDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKN VLDAIEVLRG MNTDNARKLP ADAPTGFIKP RWQKLVMTDA GIDRRYYELC ALSELKNSLR SGDIWVQGSR QFKDFEDYLV PPEKFTSLKQ
SSELPLAVAT DCEQYLHERL TLLEAQLATV NRMAAANDLP DAIITESGLK ITPLDAAVPD TAQALIDQTA MVLPHVKITE LLLEVDEWTG FTRHFTHLKS
GDLAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHTRDET YSTALAELVN AQFRHPFAGH WGDGTTSSSD GQNFRTASKA KSTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGLRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERAAHALRGN GHAVDDSLLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA