Transposon
Name: TnCfrpOZ172       (Synonyms: Tn7154)
Family: Tn3        Group: Tn21
Evidence of Transposition: yes
 Host     

Place of Origin:China Date of Isolation:2001

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGAACCGCAGAATTCGGAAAAAATCGTACGCTAAG
IRR (Length: 37 bp)GGGGAGCCCGCAGAATTCGGAAAAAATCGTACGCTAA

 Sequence     
DNA SequenceLength  14706 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGAACCG CAGAATTCGG AAAAAATCGT ACGCTAAGCT AACGGTGTTC TCGTGACAGC TCTTTGACTA GGCTTTCTAA GGCCATTCTG ATAGCCCTGA 100
CTTCCTGAAA AGCCATGGCT AAAATTTGTG CGGCTAAAAG GGATAACCGA TGGTAAAGTA AGTTATCCCT GTCGAGATAC TGAAAAGCGT TATCCTCGTT 200
TTTCCCAAAA CTGTTTTGCC AGTTCGCTCA GAGCGCTAGT TAACTGAGCG ACAGATTTCG CACTTTGCAA ATTATTCTGC CCGGTCTGTA CATTGGTATC 300
AGCAGCATCG CGTATATTGA TAATACTGCG GTTTATGTCT TCACTTACTG CTCCCTGCTG CTCGACCGCA GTCGCTATTT GCGCGTTCAT GTCGGTAATT 400
TCGTTAACGC GTTGGCCAAT TCCATCAAGA GCTGTAGCTG CTTCCTCTGC GTGAGCTACA CTCGTGTGCG CTTGCCGACT ACTTTGCTCC ATGACTGTAA 500
CAGCGGATTG CGCTCGCTCT TGTAGAGCGC TGATCATGCT TTGAATATCC GTTGTCGATT GCTGTGTGCG AGCAGCAAGA CTGCGAACCT CATCGGCGAC 600
AACAGCAAAA CCACGCCCCT GCTCACCAGC ACGCGCGGCC TCAATTGCTG CGTTGAGTGC CAACAAATTC GTTTGCTCGG CGATCCCTCG TATAACGTCA 700
AGAACTTTTG ATATCTCGTT ACTTTGACCT TCAAGCTCAT GAATAACCTG AGTGGCTTGC CTAATTTCAC CTTCAAGGGC AGTGATTGAC TGGCTTGTGT 800
GGGCTACCAG ACGCTGGCCA GATGCCGTCT CAGTGTCTGC TCTTCCGGCC GCATCTGCAG CATGCTGTGC ATTGCTCGCA ACCTCTTGAA TGCTTGCCAC 900
CATTTGGTTT ACTGCCGTTG CTATTTGATC TGTCTCTGCC TGCTGCTCAA CTGTAAGTAC ATTGCTTGAC TCAATATCCT TTAGTAGGCC TCGGGTGTGT 1000
TCGCTAAGCC GATTTGATGC ATCACCTATG CGACCTACTA TGGCGCCTGT TTCAGCTTGC ATCATTCGTA AAGCAAACTC TATTTGGCCA AACTCATCGG 1100
TGCGCCCAGT GTAGAGGGAT TGACTTAATG GGTTATTGGA AATATTCCTG GCTCTTTCAA CCAGTCTTCC AAGAGGAGAG AGAATAGCCA AAACACTAAC 1200
AGAGCTTAAG CTTCCTGACA TTAAAGTGGC TAACAATAAG CTGCTTATTG ATGTATCAGT AAGCATGCCG GCAGCCATTG CGCTTGATAT AATACTACCC 1300
CATATGAGCA AGAGTATTTT CACGGAAAAG CTAGCAGCCA ATTTCGGCCT CGCGGCCTTC CCGCTTCTCA ATTGAGCATA TAATTTTTCC GCAGCCAAAA 1400
CCTGCTCAGG TTCAGGCTTG GTCCTTACAG ACTGGTATTC AACAATCGAA CCATTCTTAG CTATTGGCGT TACATAAGCA CTTACCCAAT AGTGGTCGCC 1500
ATTTTTACAG CGATTTTTTA CTAGCCCCAT CCATGAGCGG CCAGATTTTA ATGTACTCCA CATATGCTCA AATGCAGCAG GCGGCATATC TGGGTGTCTT 1600
ACGATGTTGT GAGGCTGGCC TAATAGTTCT TCCTCAGTGA AACCACTGAT TTTAATGAAG TCAGGATTAA CGTACGTGAT ATGGCTTTGA GGGGAGGTAG 1700
TCGAAAGAAT ATTGGCATCT TTTGGGAGTT CTAAGTTTCG ACCCGTCACT GGTAAATTCT GGCGCATAAG AACCTCAAGG GTTGGCTGTT TTATTTTATT 1800
GTTTTCGGCA TTAAGCCCAA TTTCTTGAGC GTTACGATAA AGCTAGCATG GAAACGATAG GTGCAAGCAA GTTAAGGGTT GCATCGCGCA TGTCAATCTA 1900
GGCTATACCC TAACTTGATG TCAGGCAGGG CCGCGCCGCT TCGTCAGAAT AGAGTCTGCT TTCCCATTTT TTTGTCGTTT TCAGAAGACG GCTGCACTGA 2000
ACGTCAGAAG CCGACTGCAC TATAGCAGCG GAGGGGTTGG ATCCATCAGG CAACGACGGG CTGCTGCCGG CCATCAGCGG ACGCAGGGAG GACTTTCCGC 2100
AACCGGCCGT TCGATGCGGC ACCGATGGCC TTCGCGCAGG GGTAGTGAAT CCGCCAGGAT TGACTTGCGC TGCCCTACCT CTCACTAGTG AGGGGCGGCA 2200
GCGCATCAAG CGGTGAGCGC ACTCCGGCAC CGCCAACTTT CAGCACATGC GTGTAAATCA TCGTCGTAGA GACGTCGGAA TGGCCGAGCA GATCCTGCAC 2300
GGTTCGAATG TCGTAACCGC TGCGGAGCAA GGCCGTCGCG AACGAGTGGC GGAGGGTGTG CGGTGTGGCG GGCTTCGTGA TGCCTGCTTG TTCTACAGCA 2400
CGTTTGAAGG CGCGCTGAAA GGTCTGGTCA TACATGTGAT GGCGACGCAC GACACCGCTC CGTGGATCGG TCGAATGCGT GTGCTGCGCA AAAACCCAGA 2500
ACCACGGCCA GGAATGCCCG GCGCGCGGAT ACTTCCGCTC AAGGGCGTCG GGAAGCGCAA CGCCGCTGCG GCCCTCGGCC TGGTCCTTCA GCCACCATGC 2600
CCGTGCACGC GACAGCTGCT CGCGCAGGCT GGGTGCCAAG CTCTCGGGTA ACATCAAGGC CCGATCCTTG GAGCCCTTGC CCTCCCGCAC GATGATCGTG 2700
CCGTGATCGA AATCCAGATC CTTGACCCGC AGTTGCAAAC CCTCACTGAT CCGCATGCCC GTTCCATACA GAAGCTGGGC GAACAAACGA TGCTCGCCTT 2800
CCAGAAAACC GAGGATGCGA ACCACTTCAT CCGGGGTCAG CACCACCGGC AAGCGCCGCG ACGGCCGAGG TCTTCCGATC TCCTGAAGCC AGGGCAGATC 2900
CGTGCACAGC ACCTTGCCGT AGAAGAACAG CAAGGCCGCC AATGCCTGAC GATGCGTGGA GACCGAAACC TTGCGCTCGT TCGCCAGCCA GGACAGAAAT 3000
GCCTCGACTT CGCTGCTGCC CAAGGTTGCC GGGTGACGCA CACCGTGGAA ACGGATGAAG GCACGAACCC AGTTGACATA AGCCTGTTCG GTTGGTAAGC 3100
TGTAATGCAA GTAGCGTATG CGCTCACGCA ACTGGTCCAG AACCTTGACC GAACGCAGCG GTGGTAACGG CGCAGTGGCG GTTTTCATGG CTTGTTATGA 3200
CTGTTTTTTT GTACAGTCTA TGCCTCGGGC ATCCAAGCAG CAAGCGCGTT ACGCCGTGGG TCGATGTTTG ATGTTATGGA GCAGCAACGA TGTTACGCAG 3300
CAGGGCAGTC GCCCTAAAAC AAAGTTAGAA AAGGGAAAGT ATGAGCAAGT TATCTGTATT CTTTATATTT TTGTTTTGTA GCATTGCTAC CGCAGCAGAG 3400
CCTTTGCCAG ATTTAAAAAT TGAAAAACTT GATGAAGGCG TTTATGTTCA TACTTCGTTT GAAGAAGTTA ACGGGTGGGG CGTTGTTCCT AAACATGGTT 3500
TGGTTGTTCT TGTAGATGCT GAAGCTTATC TAATTGACAC TCCATTTACG GCTAAAGATA CTGAAAAGTT AGTCACTTGG TTTGTGGAAC GTGGCTATAA 3600
AATAAAAGGC AGTATTTCCT CTCATTTTCA TAGTGACAGC ACGGGCGGAA TAGAGTGGCT TAATTCTCAA TCCATCCCCA CGTATGCGTC TGAATTAACT 3700
AATGAGCTGC TTAAAAAAGA CGGTAAGGTT CAAGCTAAAA ATTCATTTGG CGGGGTTAAC TATTGGCTAG TTAAAAATAA AATTGAAGTT TTTTATCCAG 3800
GCCCAGGACA CACTCCAGAT AACCTAGTAG TTTGGCTGCC TGAAAGGAAA ATATTATTCG GTGGTTGTTT TATTAAACCG TACGGTCTAG GTAATTTGGG 3900
TGACGCAAAT TTAGAAGCTT GGCCAAAGTC CGCTAAATTA TTAATATCCA AATATGGTAA GGCAAAACTG GTTGTTCCAA GTCACAGTGA AGCTGGAGAC 4000
GCATCACTCT TGAAACTTAC ATTAGAGCAG GCGGTTAAAG GGTTAAACGA AAGTAAAAAA CCATCAAAAC TAAGCAACTA AATTTCTAAC AAGTCGTTGC 4100
AGCATCGTGC GCTGCGCGCA CTGGACAGTT TTTAAGTCGC GGTTTTATGG TTTTGCTTCG CAAAAATATT CCATAAAACC ACAACTTAAA AACTGCCGCT 4200
GAACTCGGCG TTAGATGCTT TGCTGTGCGC ACAAATTTCG GCCAGCAACA AGACTGTTTT TTTTCTTAAA TCGAACCTAA AATTTATTCG CGGAACTCCA 4300
TGGATAAATA TTTTGAAAAA TTGGTTATTT CTGGCTACGT CCATTATTTT TGAGGTCATT GCAACCTCTG CGCTCAAGTC TAGTGAGGGC TTTACTAGGT 4400
TAGTACCGTC TTTTATCGTC GTAGCGGGAT ACGCTGCTGC TTTTTATTTC CTGTCGCTGA CACTCAAATC GATTCCTGTT GGAATCGCCT ACGCAGTTTG 4500
GTCGGGCCTC GGGATCGTCT TGGTCACTGC GATTGCATGG GTTTTGCATG GTCAAAAACT AGATATGTGG GGATTTGTTG GTGTCGGCTT CATTATCAGC 4600
GGCGTTGCTG TGCTCAACTT GCTATCTAAG GCAAGTGTTC ACTAAAACGG TCGCATCTAA CCATTCCGTC GAGAGGGACC GCCCACAAGC TGCGCTTGCG 4700
GGTTCCCTTC GCGGCTTCGC CGCTACGGCG GCCCCTCACG TCAAACGTTA GGCATCACAA AGTACAGCAT CGTGACCAAC AGCAACGATT CCGTCACACT 4800
GCGCCTCATG ACTGAGCATG ACCTTGCGAT GCTCTATGAG TGGCTAAATC GATCTCATAT CGTCGAGTGG TGGGGCGGAG AAGAAGCACG CCCGACACTT 4900
GCTGACGTAC AGGAACAGTA CTTGCCAAGC GTTTTAGCGC AAGAGTCCGT CACTCCATAC ATTGCAATGC TGAATGGAGA GCCGATTGGG TATGCCCAGT 5000
CGTACGTTGC TCTTGGAAGC GGGGACGGAT GGTGGGAAGA AGAAACCGAT CCAGGAGTAC GCGGAATAGA CCAGTCACTG GCGAATGCAT CACAACTGGG 5100
CAAAGGCTTG GGAACCAAGC TGGTTCGAGC TCTGGTTGAG TTGCTGTTCA ATGATCCCGA GGTCACCAAG ATCCAAACGG ACCCGTCGCC GAGCAACTTG 5200
CGAGCGATCC GATGCTACGA GAAAGCGGGG TTTGAGAGGC AAGGTACCGT AACCACCCCA GATGGTCCAG CCGTGTACAT GGTTCAAACA CGCCAGGCAT 5300
TCGAGCGAAC ACGCAGTGAT GCCTAACCCT TCCATCGAGG GGGACGTCCA AGGGCTGGCG CCCTTGGCCG CCCCTCATGT CAAACGTTAG ACCGCTATGA 5400
CAGTCGCCCT CGACGAAGTA TCTGAACTAA AGAATTTGCT TTCACCCTTG TTGGATGAAT GCACTTTTGA AGAAGTTGAG TATGGTCAGT CAGATGCTCG 5500
AGTGATTCGA GTTCTATTTC CTGATCGCAA TACCGCGTAT CTAAAGTACG CCTCCGGATC TTCTGCTCAA GAAATTCTTC AAGAGCATCA GCGCACTAGA 5600
TGGCTCAGAA CACGAGCTCT CGTACCGGAA GTGATCTCAT ATGTCTCGAC TTCAACTGTC ACCATCCTGT TGACAAAAGC ATTGATTGGC CACAATGCCG 5700
CTGACGCCGC AGATGCAGAT CCAGTTATTG TTGTTGCAGA GATGGCACGA GCGTTACGCG ACCTCCATTC GATCTCGCCT GACGATTGCC CATTCGACGA 5800
AAGGCTCCAC CTGCGACTGA AGCTGGCTTC GGGCCGTTTG GAAGCCGGGT TAGTTGATGA GGAGGACTTT GATCACGCAA GGCAAGGCAT GCTGGCGCGG 5900
GATGTTTACG AGCAACTTTT TATACAAATG CCTGGAGCGG AGCAGCTGGT AGTCACACAT GGCGACGCCT GTCCCGAGAA CTTCATCTTC CAAGGTAATG 6000
CCTTCGTCGG CTTCATAGAC TGCGGTCGGG TCGGGCTTGC CGATAAGTAT CAAGACCTGG CGCTTGCATC GAGAAACATT GACGCGGTAT TTGGACCAGA 6100
ACTCACTAAC CAGTTCTTCA TCGAGTATGG AGAGCCAAAT CCGAACATAG CTAAGATTGA GTACTACCGG ATCTTGGATG AGTTCTTCTA AGCGCGGTCT 6200
AACAATTCGT TCAAGCCGAG ATCGCTTCGC GGCCGCGGAG TTGTTCTGTA AATTGTCACA ACGCCGCGGC CGCAAAGCGC TCCGGCTTAA CTCAGGCGTT 6300
GAACGACAGC TTTCCCAAAA GCTCTACGGC TGCTCTGGGT CGACACCGGT AATCGGATCG TTGCCGCACT GAACAGCGCC CCGTTCCAGG TCGCCTCCAT 6400
TTATGCGGCT GAACCGAGGG AGAGCAGCTT TACGCCGTCT GGCCGCAGTT CGCCCTTGGG CGACACGTGC CGGTAGAGCG TCTGCCGGGT AATCCCGAGT 6500
TCTTCGCAGA GATCGCCCAC CTTGGTTTCC GGTTGCCCCA TGCTGGCCAT CGCCAGGCGT AGCTTGGCGG CGGTCATCTT GAAGGGGCGC CCCCCTTTCC 6600
TGCCGCGAGC GCGCGCCGAG ATAAGTCCAG CGACTGTTCG CTCGGAAATC AACTCACGCT CGAACTCGGC CAGCGCGGCA AAAATACCGA ACACAAGCTT 6700
GCCGGCGGCA GTCGTCGTGT CGACCGCCGC ACCGTGACCG GTCAGGACCT TCAGGCCCAC GCTACGCGCA GTTAGGTCGT GCACGGTGTT GATCAGGTGG 6800
CGCAGATCAC GGCCAAGCCG ATCGAGCTTC CACACGATCA GCGTGTCCCC TTCACGAAGC GCCTTCAGGC AAGCAGCCAA CCCTGGGCGA TCATCGCGCC 6900
TGCCCGAGGC CAGATCCTCG TAAAGGTGCG CAAGGCTCAC ACCAGCGGCG ATGAGCGCAT CGCGTTGCAA ATTGGTGGAC TGGGATCCGT CCGCCTTCGA 7000
TACCCGCATG TAGCCGATCA GCACCTTTTC ACCCGTCACG TATACGTTCG ATTATGTGAC AGTGTGAGCC AGAAAGTTCT CGCCGTCAAA AACTGTCACT 7100
TAACCCGTCA TTTAGTCTAA GACCTGCAAA CGGCCATTCA GGCTCGTAAT GTGACAAAAA CTCCGGCGGG ATGCCCTCCT TGGTGAACGT GGCGCGCAAA 7200
CGTTCCAGGG ATTCGGGGTC GCGTCGCCCG TAGGACGCCA GTGTGAACAG CAAGCGGGCC GTCTCCGGGT TGTGTCGCGC TTCAATGATG GCCTCATCGA 7300
TGGCCTGGGC TGCTCGTTGC CAGTGGTTGA TGGGTTCCGG CTTCGGCACC TTCGCCGGCA GGCCGTTGGT GAAACCAGTG TGCGGCTCCG TCTGAAACAG 7400
CGCGGCCTGT TCCCCGCGCG GGATCAGCGC CTTTGACTCG ATCAGCGTGA TGGCGGTGGC CGCCGCCTCC AGCATCTGCC ACTGCACCGC CGGGGCCAGA 7500
ATCTCGTAGG GACGCCACAG ACTCTGCCCG GCGCGCAGCG GATGGCCGCA GCGCTCCCAG ACATGGCGGA TGCTCGCCGA GCAACTGCCG CAGTGCGAGA 7600
GCGGCGTGTT CAGCTCATCA AGCAGGGTGC GCAGCAGCCG GAACCACAAG CCGGCGTGGA CACGCCGACG CGGCAGCTCC ACAAAACCCG TCGTCAGCGC 7700
CTGCCAGGTG CGCCGGTCCA TGCAGGCGAT TGCGTCATCG GCAGGGCGCG GCGCAGCATC GGCGATTTCC CACTGAAGAT ACCGGCCGGG CATGCCCCAG 7800
TAGGACTCCA GCCAGCAGCC ATGCTGCGGG CAGCTCAGCA TCAAGGGGAG CTGCCAGACG AGTAGCACAG CTTGATTCGT TGGATCGTTC AGACACTGCG 7900
GACACGCCCG GCGAATCGTC TGGCTCGGTA GCCAGGCACG CCAGCGAGTG ATGGACCGCA CCTTGCGGGT GCGCTTGGGC AGGAGCACCG CGCATTGGAA 8000
TGTATAGGTT TCCAAGGCTG CTGGTACCGA ATCGTCGAGA CTGTCGAGCA GCCACGGCAC CCAGCCTGCA AGACTCATGC TGCGCAACCG CTCCAGCTCG 8100
ACGCCACTGC GCTGGCAGAG CGCCGTCAGC AACGACAAGG ATGGTGCGGT ATCCAGGTCA TCAAGTTGGC TGTGACCAAG ATCGTGGGCC AGCAGCTCGT 8200
GCACGTCCAT CTGGTAGCAG GCGGCGACCC GGTTGAGCCA TGAGGACAGG GCTTCGCCTT CCTTGGGTGC CGGATGCAGC GGCCAGCGCG GCGCGGACTT 8300
CACATCAGTT CCCGCTCGAA CTGTCGCCGC CGCTCACTGG GGCCGATGTA GTCGGCCATG CTGAGCGTGC GGTGGTTGAT CGCTTCCTCG CCACTCTCCA 8400
CGGCGGCGAC GGCCGCCGCC ACCAGCAGAT GTGCAAGCTC GCCGATGGTG CCTTCGCTCC GGGTGAGCAG GTAGCGGGCC ATGTCCAGCG TGGCAATCGG 8500
GGATGGCCGC CGTAGCGGGA GTGACGCCGC GAAGCTGGCC AGCAGCGAGC AGCAGTCCTC ATTGGCCTCC CACGGCGGCA GCAGCATCGG CTCGAAGCGG 8600
TTTTCCAACT GATCGTCCGA ACGGATGGCC AGGTACGCCT CGCGCGTGCC GACCCCGACC AGGGGGATAC GCAGCTCGTT GCCGAGGAAG CGCAGCAGGT 8700
TGAGGAACTC GCGCCGGTTA ACGCTGTTGC CAGCCAGTAC ATTGTGCAGT TCGTCGATCA CCAGCATGCG CACGCCGACC TTGCGCAGCA GGGCCAGCGT 8800
CAGTTGCTCC ATTTCCGGCA GCCGTGGGCG CGGGCGCAGC GGCGCGCCCA TCGCAGCCAG CAGCGCGACA TAGAAGCGGA TCACCGATGG CTCTGACGGC 8900
ATCTGCACGA CCAGCACCGG GATATGTTCT TGGTCAGCGT CGGTGCCGAC CGGGTGCGCC CGCCGGAATT TCTCGACGAT CATCGACTTG CCGTTGTTGG 9000
TGGGGCCGAC CAGCAGCAGG TTTGGCATGC GTTGCTTGTT CGGCCACGCA TACAGAGTTT CCAGCCGGTT CAGCGCCTCG ACCGCGCGCG GGTAGCCGAT 9100
CCAGCGGTCG GCGCGAATGC GCTGGATGCG CTCGTCTGCC GGCAGCCTGG CCAAACCCTG TGCCGCTGGC AGCAGGTGGG ACAGGTCAAT GACGGGATAT 9200
TCGTCCACGG CTACCACTCC TCGATCTGAT CGAACGGTTT GGCCGGCGGC AGGTTGTCTG CCTGCGGGTC AGCCATGTCC ACATCCGGCG GTATGGGCTT 9300
GGCCGGTGGC TCCGACGTCT TGAGGTGCTG GCGGCGATCA GCGTCGCGCC GCGCCTTGCG CGTGGCCTTC TGGGCGGTGG TCACGATCTC GCGCATCTGC 9400
CCGATCATGC GGAACAGCGC CGACTCATCC ACCTGCTCGC GCCCGAGCTG ACGCAATTTG GCCAGCGCCT GGCGTTGTTC CCAGAGGGTG ACGGCCGGAT 9500
GGGACAAGGT GCGGTAGTGG ATCTCCAGAT AGTGCTGACC TTCCGGTTCC AGTACCCAGA TGCGGCTGAT GTCGCGCGGA TCGCGCCGGA TCAGGAAGGC 9600
GGGCAAGCGC TCGCGCCGGG CAATCCACGG CTTGAGGGCG TCGGCGTAGT AGTGGATGTG GTCGATGACA AAGCCGGTGC GGGTCAGGGT GCGGCGGATC 9700
ACCGGCAGGA AATCGACCAA AAACGCGGTG GGGCGGGTAA CGACGGCCGG GACGCCAACG CGCTCCACGG CCTCGGCCCA GCGCGCGGCC GGCGGCTGGA 9800
GCAGGCCGTT GTGCACGGAG CCGTGATAGG TGCCTACCGC CAACGCGAGC CAGCGCTCCA GCTCGCGCAG CGTCAGGGTG GCCATCTTCT CGGAATCGTA 9900
CTCGCCGCGC TGGCCGGGAT TGGAGAAGGT CGTCCCCGGT AATTCGTCGT GGATCATCTG CATCGCCGTG CCGATGATCC GTTCCACGAT GCCGCCGTAG 10000
TGCGGCTGGC CTGGTGGGCG ATAGTCCAGC CGGATGCCAT GCTGTTCGCA GCCACGGCGC AGCGCTTCGC TTTTGAACTC GGCCGCGTTG TCCAGATAGA 10100
GCAGCCTGGG CTTGCCGCTC ATCGGCCAGT CCATTTCCAC ATTCAGCCCT TCCAGCCAGG GCCGCTTGTC GCAGGCGGCA TGCGCGAGGC ATAGGCCGAC 10200
CGAGACGGCG GACGGCGCTT CCAGCGTGAC CACCATGCCG AGTACGCAGC GCGTGAACAC GTCGATGGCG AGGGTCAAAT ATGGGCGGCC AATCGGTTGC 10300
CGGTCGCGCT CGTCGACCAC GATCAGGTCG ATGACGGTGT GGTCGATCTG CACCTGTTCC AGCGGCATGG TGACTTCGGG CGGAATGCCA CCCGCGCCTT 10400
GCAAGGGACG GGCAGCGTCC TGCCCGCCCC GGCTGCGGGC TATTTTCGCC GGGTGTAGTC CGGCAATCCG CTGGGCCACG GTGTTGCGCG CCGGCACCGG 10500
CAGCTTCTGG GTTTTGCACG CCTGCGCGAC TTCGCGGTGG AACGCCGCCA GGCTGCGTTT CTGCTTGGTC AGGAAGCGCT TTTGCAGCAG CTCGCGGATG 10600
ATGCGCTCGA CCGGTTCCGG CAAGCGCCCC TTGCCTTTGC CGCCGCCGGA TCGGCCGGGC GTCAGGTCTG TTACCAGGCC AGTACCCTGC CGGGCGCGAC 10700
GGATCAGGAC ATATACCTGT CGCCGGGACA GGCCCAGCGC TTGGGCTGCC TCATCGGCGG CTTCATGCCC GACCACCTCA AGCGCTGCCA GTGGCCCGAT 10800
GATTTCCGTC CGGTGCCGGG CTTGCGCCCA TGCCTCGTCG GGCAGGGTGG CCACGCCTTG CGCGGCAATC GGTGGAGTGT CTGATGTCAT GCCCAAACCT 10900
CGCTTTGGTG CACACGAGTA TTGAGCATAG TCGAGATTGG TGCAGACGAC TCCTGATATT GGGCTGTCAG GAGCCGTATG CACACCAGGC GTTACATCCA 11000
GTCAGATGGT GCGGTCGTCT TCTGAAAACG ACATTTTTGA CACATGCCCG CGAAGGTTAT AGATTTCAGC CTGACAGAAA TGGGCTTTGA GGCACAACGG 11100
AACAGAAAGT GCACTTAAGC CGCCTTCAAC CAAGGAGACA TCGTGCAGGG GCACCGCATC GGCTACGTCC GGGTCAGCAG CTTTGACCAG AACCCGGAAC 11200
GCCAGCTGGA ACAAACCCAG GTGAGCAAGG TGTTCACCGA CAAGGCATCG GGCAAGGACA CCCAGCGCCC CCAGCTCGAA GCGCTGCTGA GCTTCGTCCG 11300
CGAAGGCGAT ACAGTGGTGG TGCACAGCAT GGATCGGCTG GCCCGCAACC TCGATGACCT GCGTCGCTTG GTACAGAAGC TGACTCAGCG CGGCGTGCGC 11400
ATCGAGTTCC TGAAGGAGGG CCTGGTGTTC ACTGGCGAGG ACTCGCCGAT GGCCAACCTG ATGCTGTCGG TGATGGGGGC CTTCGCTGAG TTCGAGCGCG 11500
CCCTGATCCG CGAGCGGCAG CGTGAGGGCA TCGCCTTGGC CAAGCAGCGT GGCGCGTACC GGGGCCGCAA GAAAGCCCTG TCCGATGAGC AGGCTGCTAC 11600
CCTGCGGCAG CGAGCGACGG CCGGCGAGCC CAAGGCGCAG CTTGCCCGCG AGTTCAACAT CAGCCGGGAA ACCCTCTACC AGTACCTCCG CACGGACGAC 11700
TGACACATGC CGCGTCGCTT GATCCTCTCG GCCACGGAGC GGGACACCCT GCTTGCGCTG CCGGAAAGCC AGGATGACCT GATCCGCTAC TACACCTTCA 11800
ACGACTCCGA CCTGTCGCTG ATCCGCCAGC GACGCGGCGA CGCCAACCGC CTCGGCTTCG CCGTGCAGCT CTGCCTGCTG CGCTACCCCG GTTACGCGCT 11900
GGGAACCGAC AGCGAGCTGC CCGAGCCGGT CATCCTGTGG GTGGCGAAGC AAGTCCAGGC CGAGCCGGCG AGCTGGGCAA AGTACGGCGA GCGCGACGTG 12000
ACCCGTCGCG AGCATGCCCA GGAACTGCGC ACCTACCTGC AACTGGCCCC GTTCGGCCTG TCCGACTTCC GCGCCCTGGT GCGCGAGCTA ACCGAGCTGG 12100
CCCAGCAGAC CGACAAAGGC TTGCTGCTGG CCGGTCAGGC CCTGGAGAGC CTACGGCAGA AACGACGCAT CCTGCCGGCG CTGAGCGTGA TTGACCGGGC 12200
CTGCTCGGAA GCCATTGCGC GAGCCAATCG GCGGGTCTAC CGCGCCCTGG TCGAACCACT CACGGACTCG CATCGGGCCA AGCTGGACGA GCTGTTGAAG 12300
CTCAAGGCCG GCAGCAGCAT CACCTGGTTG ACCTGGCTGC GCCAGGCACC GCTGAAACCC AACTCTCGGC ACATGCTGGA ACACATCGAG CGGCTGAAGA 12400
CATTTCAGTT GGTGGACTTG CCCGAAGGCC TGGGCCGGCA CATCCACCAG AACCGCCTGC TCAAGCTGGC CCGCGAGGGT GGGCAGATGA CGCCCAAAGA 12500
CCTCGGTAAG TTCGAGCCGC AGCGCCGCTA CGCGACCCTG GCCGCCGTGG TGCTGGAGAG CACCGCGACC GTGATCGATG AGCTGGTCGA TCTGCATGAC 12600
CGCATCCTGG TCAAGCTGTT CAGCGGCGCG AAGCACAAGC ATCAGCAGCA GTTCCAGAAG CAGGGCAAGG CGATCAACGA CAAGGTGCGC CTGTACTCCA 12700
GGATCGGCCA GGCGCTGCTG GAAGCGAAGG AAAGCGGCAG CGACCCCTAT GCCGCCATCG AGGCGGTGAT TCCCTGGGAC GAGTTCACCG AGAGCGTCAG 12800
CGAGGCCGAG CTGCTGGCCC GGCCGGAAGG CTTCGACCAC CTGCACCTGG TCGGCGAGAA CTTCGCCACC CTGCGCCGTT ACACGCCGGC CTTGCTGGAG 12900
GTGCTGGAAC TGCGCGCCGC GCCGGCCGCG CAAGGCGTGC TGGCAGCCGT GCAGACCCTG CGTGAGATGA ACGCCGACAA CCTGCGCAAG GTGCCGGCCG 13000
ATGCACCCAC GGCCTTCATC AAGCCGCGCT GGAAGCCGCT GGTGATCACC CCGGAAGGCC TCGACCGGAA ATTCTACGAA ATCTGCGCCC TGTCCGAGCT 13100
GAAGAACGCC CTGCGCTCCG GCGACATCTG GGTCAAGGGC TCGCGGCAGT TCCGCGACTT CGACGACTAC CTGCTGCCGG CCGAGAAGTT CGCCGCACTC 13200
AAGCGCGAGC AGGCCCTGCC CCTGGCGATC AACCCGAACA GCGACCAGTA CCTGGAAGAG CGTTTGCAGC TGCTGGACGA GCAGTTGGCC ACCGTCACCC 13300
GCCTGGCCAA GGACAACGAG CTGCCCGATG CCATCCTCAC CGAGTCAGGG CTGAAAATCA CCCCGCTGGA TGCGGCGGTG CCGGATCGGG CGCAGGCGCT 13400
GATCGACCAA ACCAGCCAGT TACTGCCGCG CATCAAGATC ACCGAACTGC TGATGGACGT GGACGACTGG ACGGGCTTCA GCCGCCACTT CACCCACTTG 13500
AAGGACGGGG CCGAGGCCAA AGACAGGACG TTGCTGCTGT CCGCAATCCT CGGTGATGCG ATCAACCTCG GGCTGACCAA GATGGCCGAG TCGAGCCCCG 13600
GCCTGACCTA CGCCAAGCTG TCCTGGCTGC AAGCCTGGCA CATCCGCGAC GAAACCTATT CGGCGGCCTT GGCCGAGCTG GTCAACCACC AGTATCGCCA 13700
CGCCTTTGCC GCCCACTGGG GCGACGGCAC GACCTCATCC TCCGATGGCC AGCGCTTCCG CGCGGGTGGC CGGGGCGAGA GCACCGGGCA CGTCAACCCG 13800
AAGTACGGTA GCGAGCCGGG ACGGCTGTTC TATACCCATA TCTCCGACCA GTACGCGCCG TTCAGCACCC GCGTGGTGAA TGTCGGCGTC CGCGATTCCA 13900
CCTATGTGCT CGACGGCCTG CTGTACCACG AGTCCGACCT GCGGATCGAG GAGCACTACA CCGACACGGC CGGCTTCACC GATCACGTCT TTGCCCTGAT 14000
GCACCTGCTA GGCTTCCGCT TCGCGCCGCG CATCCGCGAC CTCGGCGAAA CCAAGCTGTA CGTGCCGCAG GGCGTGCAAG CCTACCCGAC GTTGCGCCCG 14100
CTGATCGGCG GCACCCTGAA CATCAAGCAC GTGCGTGCCC ACTGGGACGA CATCCTGCGC CTGGCCAGCT CGATCAAGCA GGGCACCGTC ACCGCCTCGC 14200
TGATGCTGCG CAAGCTCGGC AGCTACCCGC GCCAGAACGG ACTGGCCGTG GCCCTGCGCG AGCTGGGCCG GATCGAGCGC ACGCTGTTCA TCCTGGACTG 14300
GCTGCAAAGT GTTGAACTGC GCCGCCGCGT GCATGCCGGC CTGAACAAAG GTGAGGCGCG CAACTCGCTG GCCAGGGCGG TGTTCTTCAA CCGCCTTGGG 14400
GAAATCAGGG ATCGGAGCTT CGAGCAGCAG CGCTACCGGG CCAGCGGCCT CAACCTGGTG ACGGCGGCTA TCGTGCTGTG GAACACGGTG TACCTGGAAC 14500
GCGCCACCCA GGGGTTGGTC GAGGCCGGCA AGCCGGTGGA CGGCGAGCTG CTGCAATTCC TGTCGCCGCT GGGCTGGGAG CACATCAACC TAACCGGCGA 14600
TTACGTCTGG CGGCAGAGCC GCAGACTGGA AGACGGGAAG TTTCGGCCCT TACGGATGCC CGGAAAACCT TAGCGTACGA TTTTTTCCGA ATTCTGCGGG 14700
CTCCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res_site_I 1886-1925 40 GCGCATGTCA ATCTAGGCTA TACCCTAACT TGATGTCAGG
attI 3269-3324 56 TGATGTTATG GAGCAGCAAC GATGTTACGC AGCAGGGCAG TCGCCCTAAA ACAAAG
attC bla IMP-4 core 4084-4216 133 TTCTAACAAG TCGTTGCAGC ATCGTGCGCT GCGCGCACTG GACAGTTTTT AAGTCGCGGT
TTTATGGTTT TGCTTCGCAA AAATATTCCA TAAAACCACA ACTTAAAAAC TGCCGCTGAA
CTCGGCGTTA GAT
attC qacE2 core 4655-4747 93 ATCTAACCAT TCCGTCGAGA GGGACCGCCC ACAAGCTGCG CTTGCGGGTT CCCTTCGCGG
CTTCGCCGCT ACGGCGGCCC CTCACGTCAA ACG
attC AAC(6')-Ib core 5321-5386 66 GCCTAACCCT TCCATCGAGG GGGACGTCCA AGGGCTGGCG CCCTTGGCCG CCCCTCATGT
CAAACG
attC aphA15 core 6197-6304 108 GTCTAACAAT TCGTTCAAGC CGAGATCGCT TCGCGGCCGC GGAGTTGTTC TGTAAATTGT
CACAACGCCG CGGCCGCAAA GCGCTCCGGC TTAACTCAGG CGTTGAAC
res 7031-7065 35 ACCCGTCACG TATACGTTCG ATTATGTGAC AGTGT
r1 7033-7046 14 CCGTCACGTA TACG
r2 7049-7062 14 CGATTATGTG ACAG
r3 7093-7106 14 CTGTCACTTA ACCC
r4 7144-7157 14 TCGTAATGTG ACAA
r5 7149-7162 14 ATGTGACAAA AACT
r6 7194-7208 15 GCGCAAACGT TCCAG
res_site_III 11051-11081 31 CGAAGGTTAT AGATTTCAGC CTGACAGAAA T

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
mcp TnCfrpOZ172 190-1767 Passenger Gene Other -
intI1 In_TnCfrpOZ172 2175-3188 Integron Integrase Class 1 -
bla IMP-4 (ARO:3002195) In_TnCfrpOZ172 3341-4081 Passenger Gene Antibiotic Resistance +
qacL (ARO:3005098) In_TnCfrpOZ172 4313-4645 Passenger Gene Antibiotic Resistance +
AAC(6')-Ib4 (ARO:3002577) In_TnCfrpOZ172 4772-5326 Passenger Gene Antibiotic Resistance +
aphA15 (ARO:3004675) In_TnCfrpOZ172 5397-6191 Passenger Gene Antibiotic Resistance +
tniC In_TnCfrpOZ172 6401-7024 Accessory Gene Resolvase -
tniQ In_TnCfrpOZ172 7086-8303 Accessory Gene Target Site Selection -
tniB In_TnCfrpOZ172 8300-9208 Accessory Gene   -
tniA In_TnCfrpOZ172 9211-10890 Transposase   -
tnpR TnCfrpOZ172 11143-11703 Accessory Gene Resolvase +
tnpA TnCfrpOZ172 11707-14673 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
mcp Mcp TnCfrpOZ172 1578 190-1767 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   methyl-accepting chemotaxis protein
Protein Sequence:  
MRQNLPVTGR NLELPKDANI LSTTSPQSHI TYVNPDFIKI SGFTEEELLG QPHNIVRHPD MPPAAFEHMW STLKSGRSWM GLVKNRCKNG DHYWVSAYVT
PIAKNGSIVE YQSVRTKPEP EQVLAAEKLY AQLRSGKAAR PKLAASFSVK ILLLIWGSII SSAMAAGMLT DTSISSLLLA TLMSGSLSSV SVLAILSPLG
RLVERARNIS NNPLSQSLYT GRTDEFGQIE FALRMMQAET GAIVGRIGDA SNRLSEHTRG LLKDIESSNV LTVEQQAETD QIATAVNQMV ASIQEVASNA
QHAADAAGRA DTETASGQRL VAHTSQSITA LEGEIRQATQ VIHELEGQSN EISKVLDVIR GIAEQTNLLA LNAAIEAARA GEQGRGFAVV ADEVRSLAAR
TQQSTTDIQS MISALQERAQ SAVTVMEQSS RQAHTSVAHA EEAATALDGI GQRVNEITDM NAQIATAVEQ QGAVSEDINR SIINIRDAAD TNVQTGQNNL
QSAKSVAQLT SALSELAKQF WEKRG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 In_TnCfrpOZ172 1014 2175-3188 -
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LPTEQAYVNW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla IMP-4 (ARO:3002195) Bla IMP-4 In_TnCfrpOZ172 741 3341-4081 +
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   carbapenem (ARO:0000020)||cephalosporin (ARO:0000032)||cephamycin (ARO:0000044)||penam (ARO:3000008)||penem (ARO:3003706)
Sequence Family:  IMP beta-lactamase (ARO:3000020)
Comment:   strict match to reference sequence for (ARO:3002195) (bitscore: 497)||Synonyms:
Protein Sequence:  
MSKLSVFFIF LFCSIATAAE PLPDLKIEKL DEGVYVHTSF EEVNGWGVVP KHGLVVLVDA EAYLIDTPFT AKDTEKLVTW FVERGYKIKG SISSHFHSDS
TGGIEWLNSQ SIPTYASELT NELLKKDGKV QAKNSFGGVN YWLVKNKIEV FYPGPGHTPD NLVVWLPERK ILFGGCFIKP YGLGNLGDAN LEAWPKSAKL
LISKYGKAKL VVPSHSEAGD ASLLKLTLEQ AVKGLNESKK PSKLSN

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacL (ARO:3005098) QacL In_TnCfrpOZ172 333 4313-4645 +
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   quaternary ammonium salts
Sequence Family:  small multidrug resistance (SMR) antibiotic efflux pump (ARO:0010003)
Comment:   subunit of the qac multidrug efflux pump||loose match to reference sequence for ARO:3005098 (bitscore:172)
Protein Sequence:  
MKNWLFLATS IIFEVIATSA LKSSEGFTRL VPSFIVVAGY AAAFYFLSLT LKSIPVGIAY AVWSGLGIVL VTAIAWVLHG QKLDMWGFVG VGFIISGVAV
LNLLSKASVH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
AAC(6')-Ib4 (ARO:3002577) AAC(6')-Ib4 In_TnCfrpOZ172 555 4772-5326 +
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  AAC(6') (ARO:3000345)
Comment:   strict match to reference sequence for ARO:3002577 (bitscore: 380)
Protein Sequence:  
MTNSNDSVTL RLMTEHDLAM LYEWLNRSHI VEWWGGEEAR PTLADVQEQY LPSVLAQESV TPYIAMLNGE PIGYAQSYVA LGSGDGWWEE ETDPGVRGID
QSLANASQLG KGLGTKLVRA LVELLFNDPE VTKIQTDPSP SNLRAIRCYE KAGFERQGTV TTPDGPAVYM VQTRQAFERT RSDA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aphA15 (ARO:3004675) AphA15 In_TnCfrpOZ172 795 5397-6191 +
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  APH(3') (ARO:3000126)
Comment:   strict match to reference sequence for ARO:3004675 (bitscore: 543)
Protein Sequence:  
MTVALDEVSE LKNLLSPLLD ECTFEEVEYG QSDARVIRVL FPDRNTAYLK YASGSSAQEI LQEHQRTRWL RTRALVPEVI SYVSTSTVTI LLTKALIGHN
AADAADADPV IVVAEMARAL RDLHSISPDD CPFDERLHLR LKLASGRLEA GLVDEEDFDH ARQGMLARDV YEQLFIQMPG AEQLVVTHGD ACPENFIFQG
NAFVGFIDCG RVGLADKYQD LALASRNIDA VFGPELTNQF FIEYGEPNPN IAKIEYYRIL DEFF

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniC TniC In_TnCfrpOZ172 624 6401-7024 -
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   identical to tniR (Tn1721)
Protein Sequence:  
MLIGYMRVSK ADGSQSTNLQ RDALIAAGVS LAHLYEDLAS GRRDDRPGLA ACLKALREGD TLIVWKLDRL GRDLRHLINT VHDLTARSVG LKVLTGHGAA
VDTTTAAGKL VFGIFAALAE FERELISERT VAGLISARAR GRKGGRPFKM TAAKLRLAMA SMGQPETKVG DLCEELGITR QTLYRHVSPK GELRPDGVKL
LSLGSAA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniQ TniQ In_TnCfrpOZ172 1218 7086-8303 -
Class:   Accessory Gene
Sub Class:   Target Site Selection
Function:   is needed for transposition of Tn5053
Protein Sequence:  
MKSAPRWPLH PAPKEGEALS SWLNRVAACY QMDVHELLAH DLGHSQLDDL DTAPSLSLLT ALCQRSGVEL ERLRSMSLAG WVPWLLDSLD DSVPAALETY
TFQCAVLLPK RTRKVRSITR WRAWLPSQTI RRACPQCLND PTNQAVLLVW QLPLMLSCPQ HGCWLESYWG MPGRYLQWEI ADAAPRPADD AIACMDRRTW
QALTTGFVEL PRRRVHAGLW FRLLRTLLDE LNTPLSHCGS CSASIRHVWE RCGHPLRAGQ SLWRPYEILA PAVQWQMLEA AATAITLIES KALIPRGEQA
ALFQTEPHTG FTNGLPAKVP KPEPINHWQR AAQAIDEAII EARHNPETAR LLFTLASYGR RDPESLERLR ATFTKEGIPP EFLSHYEPEW PFAGLRLNDG
LSDSF

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB TniB In_TnCfrpOZ172 909 8300-9208 -
Class:   Accessory Gene
Function:   is needed for transposition of Tn5053
Transpoase Chemistry:   Serine
Comment:   homologous to TnsC protein of Tn7 putative ATP-binding protein
Protein Sequence:  
MDEYPVIDLS HLLPAAQGLA RLPADERIQR IRADRWIGYP RAVEALNRLE TLYAWPNKQR MPNLLLVGPT NNGKSMIVEK FRRAHPVGTD ADQEHIPVLV
VQMPSEPSVI RFYVALLAAM GAPLRPRPRL PEMEQLTLAL LRKVGVRMLV IDELHNVLAG NSVNRREFLN LLRFLGNELR IPLVGVGTRE AYLAIRSDDQ
LENRFEPMLL PPWEANEDCC SLLASFAASL PLRRPSPIAT LDMARYLLTR SEGTIGELAH LLVAAAVAAV ESGEEAINHR TLSMADYIGP SERRRQFERE
LM

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA In_TnCfrpOZ172 1680 9211-10890 -
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   homologous to TnsB of Tn7
Protein Sequence:  
MTSDTPPIAA QGVATLPDEA WAQARHRTEI IGPLAALEVV GHEAADEAAQ ALGLSRRQVY VLIRRARQGT GLVTDLTPGR SGGGKGKGRL PEPVERIIRE
LLQKRFLTKQ KRSLAAFHRE VAQACKTQKL PVPARNTVAQ RIAGLHPAKI ARSRGGQDAA RPLQGAGGIP PEVTMPLEQV QIDHTVIDLI VVDERDRQPI
GRPYLTLAID VFTRCVLGMV VTLEAPSAVS VGLCLAHAAC DKRPWLEGLN VEMDWPMSGK PRLLYLDNAA EFKSEALRRG CEQHGIRLDY RPPGQPHYGG
IVERIIGTAM QMIHDELPGT TFSNPGQRGE YDSEKMATLT LRELERWLAL AVGTYHGSVH NGLLQPPAAR WAEAVERVGV PAVVTRPTAF LVDFLPVIRR
TLTRTGFVID HIHYYADALK PWIARRERLP AFLIRRDPRD ISRIWVLEPE GQHYLEIHYR TLSHPAVTLW EQRQALAKLR QLGREQVDES ALFRMIGQMR
EIVTTAQKAT RKARRDADRR QHLKTSEPPA KPIPPDVDMA DPQADNLPPA KPFDQIEEW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnCfrpOZ172 561 11143-11703 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MQGHRIGYVR VSSFDQNPER QLEQTQVSKV FTDKASGKDT QRPQLEALLS FVREGDTVVV HSMDRLARNL DDLRRLVQKL TQRGVRIEFL KEGLVFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKALSDEQ AATLRQRATA GEPKAQLARE FNISRETLYQ YLRTDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnCfrpOZ172 2967 11707-14673 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRLILSAT ERDTLLALPE SQDDLIRYYT FNDSDLSLIR QRRGDANRLG FAVQLCLLRY PGYALGTDSE LPEPVILWVA KQVQAEPASW AKYGERDVTR
REHAQELRTY LQLAPFGLSD FRALVRELTE LAQQTDKGLL LAGQALESLR QKRRILPALS VIDRACSEAI ARANRRVYRA LVEPLTDSHR AKLDELLKLK
AGSSITWLTW LRQAPLKPNS RHMLEHIERL KTFQLVDLPE GLGRHIHQNR LLKLAREGGQ MTPKDLGKFE PQRRYATLAA VVLESTATVI DELVDLHDRI
LVKLFSGAKH KHQQQFQKQG KAINDKVRLY SRIGQALLEA KESGSDPYAA IEAVIPWDEF TESVSEAELL ARPEGFDHLH LVGENFATLR RYTPALLEVL
ELRAAPAAQG VLAAVQTLRE MNADNLRKVP ADAPTAFIKP RWKPLVITPE GLDRKFYEIC ALSELKNALR SGDIWVKGSR QFRDFDDYLL PAEKFAALKR
EQALPLAINP NSDQYLEERL QLLDEQLATV TRLAKDNELP DAILTESGLK ITPLDAAVPD RAQALIDQTS QLLPRIKITE LLMDVDDWTG FSRHFTHLKD
GAEAKDRTLL LSAILGDAIN LGLTKMAESS PGLTYAKLSW LQAWHIRDET YSAALAELVN HQYRHAFAAH WGDGTTSSSD GQRFRAGGRG ESTGHVNPKY
GSEPGRLFYT HISDQYAPFS TRVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG ETKLYVPQGV QAYPTLRPLI
GGTLNIKHVR AHWDDILRLA SSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNSLAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERATQGLVEA GKPVDGELLQ FLSPLGWEHI NLTGDYVWRQ SRRLEDGKFR PLRMPGKP

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
In_TnCfrpOZ172-CP016763.1 In Integron 1973-11033 9061

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRi In_TnCfrpOZ172 1973-2005 TGTCGTTTTC AGAAGACGGC TGCACTGAAC GTC
repeat i1 In_TnCfrpOZ172 1981-1999 TCAGAAGACG GCTGCACTG
repeat i2 In_TnCfrpOZ172 2004-2022 TCAGAAGCCG ACTGCACTA
repeat i3 In_TnCfrpOZ172 2046-2064 TCAGGCAACG ACGGGCTGC
repeat i4 In_TnCfrpOZ172 2074-2092 TCAGCGGACG CAGGGAGGA
repeat t4 In_TnCfrpOZ172 10906-10924 ACCACGTGTG CTCATAACT
repeat t3 In_TnCfrpOZ172 10938-10956 ACCACGTCTG CTGAGGACT
repeat t2 In_TnCfrpOZ172 10967-10985 TCAGGAGCCG TATGCACAC
repeat t1 In_TnCfrpOZ172 11007-11025 ACCACGCCAG CAGAAGACT
IRt In_TnCfrpOZ172 11009-11033 CACGCCAGCA GAAGACTTTT GCTGT

 References     

1.Hawkey PM, Xiong J, Ye H, Li H, M'Zali FH. Occurrence of a new metallo-beta-lactamase IMP-4 carried on a conjugative plasmid in Citrobacter youngae from the People's Republic of China. FEMS Microbiol Lett. 2001 Jan 1;194(1):53-7. doi: 10.1111/j.1574-6968.2001.tb09445.x. PubMed ID: 11150665