Transposon
Name: TnAs3       (Synonyms: Tn7145)
Family: Tn3        Group: Tn21
Evidence of Transposition: yes
 Host     

Date of Isolation:2007

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  18735 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGCACCT CAGAAAACGG AAAATAAAGC ACGCTAAGGC ATAGCTGACC TTGCCAGGCC TGCTTCGCCC TGTAGTGACG CGATCAACGG GCAGGAAACA 100
TTCCCCTTTC GTGCATGGCA GGCGCACACG AGTTCAGACA GCACGGTTTC CATGCGCGCC AAGTCGGCCA TCTTCTCGCG CACGTCCTTG AGCTTGTGTT 200
CGGCCAGGCT GCTGGCCTCC TCGCAGTGGG TGCCATCGTC GAGCCGCAAC AGCTCGGCAA TCTCGTCCAG ACTGAACCCC AGCCGCTGTG CCGATTTCAC 300
GAATTTCACC CGAACCACGT CCGCCTCCCC ATAGCGGCGG ATGCTGCCGT AAGGCTTGTC CGGTTCCCGC AACAGGCCCT TGCGCTGATA GAAGCGGATT 400
GTCTCCACGT TGACCCCGGC CGCCTTGGCA AAAACGCCAA TGGTCAGGTT TTCCAAATTA TTTTCCATAT CGCTTGACTC CGTACATGAG TACGGAAGTA 500
AGGTTACGCT ATCCAATCCA AATTCAAAAG GGCCAACGTA TGTCTGAACC ACAAAACGGG CGCGGTGCGC TCTTCGCCGG CGGGCTGGCC GCCATTCTTG 600
CATCGACCTG CTGCCTGGGG CCGCTAGTAC TGGTCGCCCT GGGCTTCTCC GGTGCTTGGA TCGGCAACCT GACGGTGCTG GAACCCTATC GACCGTTGTT 700
CATCGGCGCG GCGCTAGTGG CGCTGTTCTT CGCCTGGAAG CGGATTTACC GGCCCGTGCA GGCATGCAAG CCAGGTGAGG TCTGCGCGAT TCCGCAGGTG 800
CGCGCCACCT ACAAGCTGAT TTTCTGGATC GTGGCCGTGC TGGTCCTGGT CGCGCTTGGA TTTCCCTATG TCGTTCCATT TTTCTATTAA CCAGGAGTTC 900
ATCATGAAGA AACTGTTTGC CTCCCTTGCC CTCGCCGCCG CTGTTGCCCC GGTGTGGGCC GCTACCCAGA CCGTCACGCT AGCGGTTCCC GGCATGACTT 1000
GCGCCGCCTG CCCGATCACA GTCAAGAAAG CGCTCTCCAA GGTCGAAGGC GTGAGCAAGG TCGATGTGGG CTTCGAGAAG CGCGAGGCCG TCGTCACTTT 1100
TGACGACACC AAGGCCAGCG TACAGAAGCT GACCAAGGCC ACCGCAGACG CCGGCTATCC GTCCAGCGTC AAGCAGTGAG CCAGCAAGCC AACGACAACA 1200
GCGAGAGCCG CTTCATGGGA CTGATGACAC GCATTGCCGA TAAAACCGGC GCGCTCGGCA GCGTCGTTTC CGCGATGGGC TGCGCCGCCT GCTTTCCAGC 1300
CCTCGCCAGC TTCGGCGCGG CCATCGGGCT GGGCTTCTTG AGCCAGTACG AGGGACTGTT CATCAGCCGC CTGCTGCCGC TGTTTGCCGC GCTGGCCTTC 1400
CTGGCGAACG CGCTGGGTTG GTTCAGTCAT CGGCAATGGC TGCGCAGTCT GCTCGGCATG ATCGGCCCGG CCATCGTGTT TGCGGCCACG GTCTGGCTGC 1500
TCGGCAACTG GTGGACGGCG AACCTGATGT ACGTCGGCCT GGCCTTGATG ATTGGGGTGT CGATCTGGGA CTTCGTGTCG CCGGCGCATC GCCGTTGCGG 1600
ACCGGACGGC TGCGAACTCC CCGCCAAGCG CTTGTGAAAG ACGGCTGACC GTGCGACACG GCGGCCCACA CGAATAAGGA ACGATGGTAT GAGCACTCTC 1700
AAAATCACCG GCATGACTTG CGACTCGTGC GCAGTGCATG TCAAGGACGC CCTGGAGAAA GTGCCCGGCG TGCAATCAGC GGATGTCTCC TACGCCAAGG 1800
GCAGCGCCAA GCTCGCCATT GAGGTCGGCA CGTCACCCGA CGCGCTGACG GCCGCTGTAG CTGGACTCGG TTATCGGGCC ACGCTGGCCG ATGCCCCCTC 1900
AGTTTCGACG CCGGGCGGAT TGCTCGACAA GATGCGCGAT CTGCTGGGCA GAAACGACAA GACGGGTAGC AGCGGCGCAT TGCATATCGC CGTCATCGGC 2000
AGCGGCGGGG CCGCGATGGC AGCGGCGCTG AAGGCCGTCG AGCAAGGCGC ACGTGTCACG CTGATCGAGC GCGGCACCAT CGGCGGCACC TGCGTCAATG 2100
TCGGTTGTGT GCCGTCCAAG ATCATGATCC GCGCCGCCCA TATCGCCCAT CTGCGCCGGG AAAGCCCGTT CGATGGCGGC ATCGCCGCTA CCACGCCGAC 2200
CATCCAGCGC ACGGCGCTGC TGGCCCAGCA GCAGGCCCGC GTCGATGAAC TGCGCCACGC CAAGTACGAA GGCATCTTGG AGGGCAATCC GGCGATCACT 2300
GTGCTGCACG GCTCCGCCCG CTTTAAGGAC AATCGCAACC TGATCGTGCA ACTCAACGAC GGCGGCGAGC GCGTGGTGGC ATTCGACCGC TGCCTGATCG 2400
CCACCGGCGC GAGCCCGGCC GTGCCGCCGA TTCCCGGCCT GAAAGACACT CCGTACTGGA CTTCCACTGA AGCGCTGGTC AGCGAGACGA TTCCTAAGCG 2500
CCTGGCCGTG ATTGGCTCAT CAGTGGTGGC GCTGGAGCTG GCGCAGGCGT TCGCCCGACT CGGAGCGAAG GTGACGATCC TGGCTCGCAG CACGCTGTTC 2600
TTCCGCGAAG ACCCAGCTAT AGGCGAAGCC GTCACGGCCG CATTCCGCAT GGAGGGCATC GAGGTGAGGG AACACACCCA GGCCAGCCAG GTCGCGTATA 2700
TCAATGGTGA AGGGGACGGC GAATTCGTGC TCACCACGGC GCACGGCGAA CTGCGCGCCG ACAAGCTGCT GGTCGCCACC GGCCGCGCGC CCAACACACG 2800
CAAGCTGGCA CTGGATGCGA CGGGCGTCAC GCTCACCCCG CAAGGCGCTA TCGTCATCGA CCCCGGCATG CGTACAAGCG TGGAACACAT CTACGCCGCA 2900
GGCGACTGCA CCGACCAGCC GCAGTTCGTC TATGTGGCGG CAGCGGCCGG CACTCGCGCC GCGATCAACA TGACCGGCGG TGACGCGGCC CTGAACCTGA 3000
CCGCGATGCC GGCCGTGGTG TTCACCGACC CGCAAGTGGC GACCGTAGGC TACAGCGAGG CGGAAGCGCA CCATGACGGC ATCAAAACTG ATAGTCGCAC 3100
GCTAACGCTG GACAACGTGC CGCGCGCGCT CGCCAACTTC GACACGCGCG GCTTCATCAA ACTGGTGGTT GAAGAAGGCA GCGGACGACT GATCGGCGTG 3200
CAGGCAGTGG CCCCGGAAGC GGGCGAACTG ATCCAGACGG CCGCACTGGC GATTCGCAAC CGGATGACGG TGCAGGAACT GGCCGACCAG TTGTTCCCCT 3300
ACCTGACGAT GGTCGAAGGG TTGAAGCTCG CGGCGCAGAC CTTCAACAAG GATGTGAAGC AGCTTTCCTG CTGCGCCGGG TGAGGACAAG GAGGTGTGCG 3400
ATGAGCGCCT ACACGGTATC GCAACTGGCC CATAACGCTG GGGTGAGCGT ACATATCGTG CGCGACTACC TGGTGCGCGG CTTGTTACGG CCGGTGGCCT 3500
GCACCACGGG CGGCTACGGC GTGTTCGACG ATGCGGCCTT GCAACGGCTG TGCTTCGTGC GCGCGGCCTT CGAGGCGGGT ATCGGCCTGG ATGCCCTGGC 3600
GCGGCTGTGC CGTGCGCTCG ACGCAGCGGA CGGCGCACAA GCCGCAGCGC AGCTTGCCGT GCTGCGCCAG TTGGTCGAGC GGCGGCGCGC GGCGTTGGCC 3700
CATCTGGACG CGCAACTGGC CTCCATGCCA GCCGAGCGGG CGCACGAGGA GGCATTGCCG TGAACGCCCC TGACAAACTG CCGCCCGAGA CGCGCCAACC 3800
CGTTTCCGGC TACCTGTGGG GTGCGCTGGC CGTGTTGACC TGCCCCTGCC ATCTGCCGAT TCTCGCCGCC GTGCTGGCCG GGACGACCGC CGGTGCCTTC 3900
CTTGGCGAGC ATTGGGGTGT TGCCGCGCTC GCGCTGACCG GCTTGTTCGT TCTGGCCGTA ACGCGGCTGC TGCGCGCCTT CCGGGGCGGA TCATGACGAG 4000
TTCGCAGCCC GCCGGATGGA CGGCGGCCGA GTTGGCGCAG GCGGCGGCGC GCGGACAGCT TGACCTGCAT TACCAGCCGC TGGTCGATCT GCGCGATCAC 4100
CGGATCGCTG GCGCGGAAGC GTTGATGCGC TGGCGGCATC CGAGGCTTGG CCTGTTGCCG CCCGGCCAGT TCCTGCCGCT GGCCGAGTCG TTCGGCCTGA 4200
TGCCGGAAAT AGGCGCGTGG GTGCTGGGCG AGGCCTGTCG CCAGATGCAC AAGTGGCAAG GACCGGCATG GCAACCGTTC CGTCTTGCCA TCAATGTGTC 4300
CGCCAGCCAG GTTGGGCCAA CGTTCGACGA CGAGGTAAAG CGGGTGCTGG CCGATATGGC CCTGCCCGCC GAGCTTCTGG AGATCGAACT GACCGAATCG 4400
GTCGCATTCG GCAATCCAGC CCTGTTCGCC AGTTTCGACG CCTTGCGCGC CATCGGCGTG CGCTTCGCCG CCGACGACTT CGGCACCGGC TATTCCTGCC 4500
TGCAACATCT GAAATGCTGC CCCATCACCA CATTGAAAAT CGACCAATCC TTTGTCGCCA GGCTCCCGGA TGATGCCCGT GACCAAACTA TCGTGCGGGC 4600
GGTGATCCAG CTCGCGCACG GGCTGGGCAT GGATGTCATT TTCAGAAGAC GACTGCACCA GTTGATTGGG CGTAATGGCT GTTGTGCAGC CAGCTCCTGA 4700
CAGTTCAATA TCAGAAGTGA TCTGCACCAA TCTCGACTAT GCTCAATACT CGTGTGCACC AAAGCGAGGT GAGCATGGCG ACGGACACCC CACGGATTCC 4800
AGAACAAGGC GTGGCCACTC TGCCTGATGA GGCTTGGGAG CGTGCGCGCC GTCGTGCGGA GATCATCAGT CCGTTGGCGC AGTCGGAGAC GGTCGGGCAC 4900
GAAGCGGCCG ATATGGCGGC TCAGGCGCTG GGCTTGTCTC GGCGCCAGGT ATACGTTCTG ATCCGGCGTG CCCGGCAAGG CAGCGGCCTC GTGACGGATC 5000
TGGTGCCCGG CCAGTCCGGT GGAGGTAAAG GTAAGGGGCG CTTGCCGGAA CCGGTCGAGC GCGTCATCCA CGAGCTACTG CAAAAGCGGT TCCTGACCAA 5100
GCAGAAGCGC AGCCTAGCGG CCTTTCACCG CGAAGTCACT CAGGTGTGCA AGGCTCAAAA ACTGCGAGTG CCGGCGCGCA ATACCGTGGC CTTACGGATC 5200
GCTAGCCTTG ACCCGCGCAA GGTCATCCGC CGGCGGGAAG GCCAGGATGC CGCTCGTGAC CTACAAGGTG TGGGCGGCGA GCCTCCTGCC GTGACCGCGC 5300
CGCTGGAGCA GGTGCAGATA GACCATACGG TCATCGACCT GATCGTGGTC GATGACCGCG ACCGGCAACC TATTGGCCGC CCGTACCTGA CCCTCGCCAT 5400
CGACGTGTTC ACCCGCTGCG TGCTCGGCAT GGTCGTCACG CTGGAAGCGC CGTCTGCCGT TTCGGTTGGC CTGTGCCTCG TGCATGTCGC CTGCGACAAG 5500
CGCCCTTGGC TGGAAGGACT GAACGTGGAA ATGGATTGGC AGATGAGCGG CAAGCCCTTG CTGCTCTACC TAGACAACGC GGCCGAGTTC AAGAGCGAGG 5600
CCCTGCGCCG GGGTTGCGAG CAGCATGGCA TCCGGCTGGA CTATCGCCCG CTGGGACAGC CGCACTATGG CGGCATCGTG GAACGGATCA TCGGCACGGC 5700
GATGCAGATG ATTCACGACG AACTGCCGGG AACGACCTTC TCCAACCCTG ACCAGCGCGG CGACTACGAT TCCGAAAACA AGGCCGCCCT GACGCTGCGC 5800
GAGCTAGAGC GCTGGCTCAC ATTGGCGGTC GGCACCTACC ACGGTTCGGT GCACAACGGC CTGCTCCAAC CGCCGGCCGC GCGCTGGGCC GAGGCCGTGG 5900
CGCGTGTCGG CGTACCGGCC GTCGTCACAC GCGCTACTTC GTTCCTGGTC GATTTTCTGC CGATCCTCCG GCGCACGCTG ACCCGCACCG GCTTTGTCAT 6000
CGACCACATC CACTACTACG CCGATGCGCT CAAGCCGTGG ATTGCGCGGC GTGAACGCTG GCCGTCCTTT CTGATCCGGC GCGATCCGCG CGACATCAGC 6100
CGTATCTGGG TCCTGGAACC GGAGGGACAG CATTACCTGG AAATTCCCTA CCGTACCTTG TCGCATCCGG CTGTCACCCT CTGGGAACAA CGGCAGGCGC 6200
TGGCGAAACT GCGGCAGCAA GGGCGCGAAC AGGTGGATGA GTCGGCGCTG TTCCGCATGA TCGGCCAGAT GCGTGAGATT GTGACCAGCG CGCAGAAGGC 6300
CACACGCAAG GCGCGGCGTG ACGCGGATCG CCGCCAGCAC CTCAAGACAT CAGCTCGGCC GGACAAGCCC GTTCCGCCGG ATACGGATAT TGCCGACCCG 6400
CAGGCAGACA ACTTGCCACC CGCCAAACCG TTCGACCAGA TTGAGGAGTG GTAGCCGTGG ACGAATATCC CATCATCGAC CTGTCCCACC TGCTGCCGGC 6500
GGCCCAGGGC TTGGCCCGTC TTCCGGCGGA CGAGCGCATC CAGCGCCTTC GCGCCGACCG CTGGATCGGC TATCCGCGCG CAGTCGAGGC GCTGAACCGG 6600
CTGGAAGCCC TTTATGCGTG GCCAAACAAG CAACGCATGC CCAACCTGCT GCTGGTTGGC CCGACCAACA ATGGCAAGTC GATGATCGTC GAGAAGTTCC 6700
GCCGCACCCA CCCGGCCAGC TCCGACGCCG ACCAGGAGCA CATCCCGGTG TTGGTCGTGC AGATGCCGTC CGAGCCGTCC GTGATCCGCT TCTACGTCGC 6800
GCTGCTCGCC GCGATGGGCG CGCCGCTGCG CCCACGCCCA CGGTTGCCGG AAATGGAGCA ACTGGCTCTG GCACTGCTGC GCAAGGTCGG CGTGCGCATG 6900
CTGGTGATCG ACGAGCTGCA CAACGTGCTG GCCGGCAACA GCGTCAACCG CCGGGAATTC CTCAACCTGC TGCGCTTCCT CGGCAACGAA CTGCGCATCC 7000
CGTTGGTTGG GGTAGGCACG CGCGACGCCT ACCTAGCCAT CCGCTCCGAT GACCAGTTGG AAAATCGCTT CGAGCCGATG ATGCTGCCGG TATGGGAGGC 7100
CAACGACGAT TGCTGCTCAC TGCTGGCCAG CTTCGCCGCT TCGCTCCCGC TGCGCCGGCC TTCCCCAATT GCCACGCTGG ACATGGCTCG CTACCTGCTC 7200
ACACGCAGCG AGGGCACCAT AGGGGAACTG GCGCACTTGC TGATGGCGGC GGCCATCGTC GCCGTGGAGA GCGGCGAGGA AGCGATCAAC CATCGCACAC 7300
TCAGCATATC GACAACCTCT CGCGCAACCA AGACATCGCG GTCGGACTGC AAGTGATCTT GAAGCCACGG GCCCGTCCCA CCCCGACATG GACCTCGATG 7400
CCCGAACGGA CGTTAGATTT CGAGTTCTAG GCGTTCTGCG ATGAAGGTTG GATCCCAGCC GGGATTGAAA GTGTCGACGT GGGTGAATCC GAGCCGCTCG 7500
TATAGGCCAC GCAGGTTCGG GTGGCAGTCG AGCCGCAGCT TGGCGCACCC CTGCGTTCGC GCGGCATGGC GGCAAGCCTC GATCAGCGCG GAGCTGACAC 7600
CCCGGCCCGC ATGTGTCCGT CGCACCGCGA GCTTGTGCAG ATATGCGGCC TCCCCCTTGA GGGCGTCGGG CCAGAACTCG GGATCCTCGG CCGACAAGGT 7700
GCAACAGCCG ACGATGCCGT CGCTGCAACT CGCGACTAGG AGCTCGGATC TCAGGACGAA GGTCTCCGCG AATGTCCGGT CGATCCGCGC GACGTCCCAG 7800
GCGGGCGTTC CCTTGGCGGA CATCCACGCC GCAGCGTCGT GCATCAGCCG CACAACCTCG TCGATATCAC CCGAGCAGGC GACCCGAACG TTCGGAGGCT 7900
CCTCGCTGTC CATTCGCTCC CCTGGCGCGG TATGAACCGC CGCCTCATAG TGCAGTTTGA TCCTGACGAG CCCAGCATGT CTGCGCCCAC CTTCGCGGAA 8000
CCTGACCAGG GTCCGCTAGC GGGCGGCCGG AAGGTGAATG CTAGGCATGA TCTAACCCTC GGTCTCTGGC GTCGCGACTG CGAAATTTCG CGAGGGTTTC 8100
CGAGAAGGTG ATTGCGCTTC GCAGATCTCC AGGCGCGTGG GTGCGGACGT AGTCAGCGCC ATTGCCGATC GCGTGAAGTT CCGCCGCAAG GCTCGCTGGA 8200
CCCAGATCCT TTACAGGAAG GCCAACGGTG GCGCCCAAGA AGGATTTCCG CGACACCGAG ACCAATAGCG GAAGCCCCAA CGCCGACTTC AGCTTTTGAA 8300
GGTTCGACAG CACGTGCAGC GATGTTTCCG GTGCGGGGCT CAAGAAAAAT CCCATCCCCG GATCGAGGAT GAGCCGGTCG GCAGCGACCC CGCTCCGTCG 8400
CAAGGCGGAA ACCCGCGCCT CGAAGAACCG CACAATCTCG TCGAGCGCGT CTTCGGGTCG AAGGTGACCG GTGCGGGTGG CGATGCCATC CCGCTGCGCT 8500
GAGTGCATAA CCACCAGCCT GCAGTCCGCC TCAGCAATAT CGGGATAGAG CGCAGGGTCA GGAAATCCTT GGATATCGTT CAGGTAGCCC ACGCCGCGCT 8600
TGAGCGCATA GCGCTGGGTT TCCGGTTGGA AGCTGTCGAT TGAAACACGG TGCATCTGAT CGGACAGGGC GTCTAAGAGC GGCGCAATAC GTCTGATCTC 8700
ATCGGCCGGC GATACAGGCC TCGCGTCCGG ATGGCTGGCG GCCGGTCCGA CATCCACGAC GTCTGATCCG ACTCGCAGCA TTTCGATCGC CGCGGTGACA 8800
GCGCCGGCGG GGTCTAGCCG CCGGCTCTCA TCGAAGAAGG AGTCCTCGGT GAGATTCAGA ATGCCGAACA CCGTCACCAT GGCGTCGGCC TCCGCAGCGA 8900
CTTCCACGAT GGGGATCGGG CGAGCAAAAA GGCAGCAATT ATGAGCCCCA TACCTACAAA GCCCCACGCA TCAAGCTTTT GCCCATGAAG CAACCAGGCA 9000
ATGGCTGTAA TTATGACGAC GCCGAGTCCC GACCAGACTG CATAAGCAAC ACCGACAGGG ATGGATTTCA GAACCAGAGA AAGAAAATAA AATGCGATGC 9100
CATAACCGAT TATGACAACG GCGGAAGGGG CAAGCTTAGT AAAGCCCTCG CTAGATTTTA ATGCGGATGT TGCGATTACT TCGCCAACTA TTGCGATAAC 9200
AAGAAAAAGC CAGCCTTTCA TGATATATCT CCCAATTTGT GTAGGGCTTA TTATGCACGC TTAAAAATAA TAAAAGCAGA CTTGACCTGA TAGTTTGGCT 9300
GTGAGCAATT ATGTGCTTAG TGCATCTAAC GCTTGAGTTA AGCCGCGCCG CGAAGCGGCG TCGGCTTGAA CGAATTGTTA GACATTATTT GCCGACTACC 9400
TTGGTGATCT CGCCTTTCAC GTAGTGAACA AATTCTTCCA ACTGATCTGC GCGCGAGGCC AAGCGATCTT CTTCTTGTCC AAGATAAGCC TGTCTAGCTT 9500
CAAGTATGAC GGGCTGATAC TGGGCCGGCA GGCGCTCCAT TGCCCAGTCG GCAGCGACAT CCTTCGGCGC GATTCTGCCG GTTACTGCGC TGTACCAAAT 9600
GCGGGACAAC GTAAGCACTA CATTTCGCTC ATCGCCAGCC CAGTCGGGCG GCGAGTTCCA TAGCGTTAAG GTTTCATTTA GCGCCTCAAA TAGATCCTGT 9700
TCAGGAACCG GATCAAAGAG TTCCTCCGCC GCTGGACCTA CCAAGGCAAC GCTATGTTCT CTTGCTTTTG TCAGCAAGAT AGCCAGATCA ATGTCGATCG 9800
TGGCTGGCTC GAAGATACCT GCAAGAATGT CATTGCGCTG CCATTCTCCA AATTGCAGTT CGCGCTTAGC TGGATAACGC CACGGAATGA TGTCGTCGTG 9900
CACAACAATG GTGACTTCTA CAGCGCGGAG AATCTCGCTC TCTCCAGGGG AAGCCGAAGT TTCCAAAAGG TCGTTGATCA AAGCTCGCCG CGTTGTTTCA 10000
TCAAGCCTTA CGGTCACCGT AACCAGCAAA TCAATATCAC TGTGTGGCTT CAGGCCGCCA TCCACTGCGG AGCCGTACAA ATGTACGGCC AGCAACGTCG 10100
GTTCGAGATG GCGCTCGATG ACGCCAACTA CCTCTGATAG TTGAGTCGAT ACTTCGGCGA TCACCGCTTC CCTCATGATG TTTAACTTTG TTTTAGGGCG 10200
ACTGCCCTGC TGCGTAACAT CGTTGCTGCT CCATAACATC AAACATCGAC CCACGGCGTA ACGCGCTTGC TGCTTGGATG CCCGAGGCAT AGACTGTACA 10300
AAAAAACAGT CATAACAAGC CATGAAAACC GCCACTGCGC CGTTACCACC GCTGCGTTCG GTCAAGGTTC TGGACCAGTT GCGTGAGCGC ATACGCTACT 10400
TGCATTACAG CTTACGAACC GAACAGGCTT ATGTCCACTG GGTTCGTGCC TTCATCCGTT TCCACGGTGT GCGTCACCCG GCAACCTTGG GCAGCAGCGA 10500
AGTCGAGGCA TTTCTGTCCT GGCTGGCGAA CGAGCGCAAG GTTTCGGTCT CCACGCATCG TCAGGCATTG GCGGCCTTGC TGTTCTTCTA CGGCAAGGTG 10600
CTGTGCACGG ATCTGCCCTG GCTTCAGGAG ATCGGAAGAC CTCGGCCGTC GCGGCGCTTG CCGGTGGTGC TGACCCCGGA TGAAGTGGTT CGCATCCTCG 10700
GTTTTCTGGA AGGCGAGCAT CGTTTGTTCG CCCAGCTTCT GTATGGAACG GGCATGCGGA TCAGTGAGGG TTTGCAACTG CGGGTCAAGG ATCTGGATTT 10800
CGATCACGGC ACGATCATCG TGCGGGAGGG CAAGGGCAGG CGCATTGGCC GGACTTTCTC GCGCGCCGTG AGGTAGAAGA CCGCCCGCTG TCCGAGTATG 10900
TGCGCGAGGA GTTCGAGACC TACCTGCGCT GCGGCGTGCT CGAGCACGGC TTCCTGCGCG TGGTCTGCGA GCACTGTCGT GCCGAGAGGC TGGTGGCGTA 11000
TTCCTGCAAG AAGCGCGGGC TGTGCCCGAG CTGCGGCGCA CGGCGCATGG CCGAGTCGGC GCGGCATCTG GTGGACGAGG TGTTCGGCCC GCGGCCGGTG 11100
CGGCAATGGG TGCTGAGTTT CCCCTACCCG TTGCGCTTCC TGTTCGCCAG CAAGCCGGAG GCGATCGGCC CGGTGCTGGG CATCGTGCAT CGTGTGATCG 11200
CCGGTTGGCT TGCCGATCAG GCCGGCGTGC CGCGGGATAC GGCGCAATGC GGTGCGGTGA CCCTGATCCA GCGCTTCGGC AGCGCGCTGA ACCTGAATGT 11300
TCACTTCCAC ATGCTGTGGC TCGACGGCGT GTACGACGCG AACGTCGAGC CCCCGCGGCG CAAGCCGCGC CTGCGCCGCG CCCGTGCCCC CACCTCTGCG 11400
CAACTGACGC AGCTCGCCAA CACCATCGCG CATCGCGTGT GCCGGCACCT GTCGCGCCGC GGCTGGCTCG AAGGCGAAGA CGAATCCGTG TTCCTGTCCG 11500
ACAGCGCGGG TAGCGACGAC GGCATGGATG GGCTGCGGAT GAGTTCGATG ACCTACCGCA TCGCCACCGG TCGCGACGCT GGCCGCAAGG TCGTCACGCT 11600
GCAAACATTG CCCGGTGACG CAGGCTCGCT GGAGGGCGAT GCCGGCAAGG TCGGCGGCTT CTCGCTGCAT GCCGGCGTGG CCGCGGAAGC ACACGAAAGC 11700
CACAAGCTCG AAAAGCTGTG CCGCTACATC ACGCGCCCGG CGATCAGCGA GCAGCGGCTG TCGATCTCAC CGCAGGGTAG GGTGCGGTAT CAGCTCAAGA 11800
CGCCGTGGCG AAATGGGACC ACGCATGTCG AATGGGATGC GGTGGACTTC ATCGCCAAGC TGGCGGCACT GGTCCCGCCA CCTCGCGCGC ATCTCACCCG 11900
CTTCCACGGC GTATTCGCCC CGAATGCAAA CCTGCGTGCG CAGCTGACGC CCTCGGGGCG CGGCAAGCGG CCTGCGGGCG ATGCGGCGCC AGTGGACGTC 12000
AGCGCCCACG ACGAGCCGCG CAGCCCCGAG CAGAAGCGCC GTGCGATGAG CTGGGCGCAA CGGCTCAAGC GGGTCTTTTC CATCGACATC ACCATCTGCG 12100
CCCACTGCGG CGGCGCGGTA CGGATCGTCG CCAGCATCGA GGAACCCACC GCCATCCGCG CCATCCTGGC CCACTTCGAG AAGCACGGTG CGCGGGAAGA 12200
AGCGCACTAC CGGCCCGCGG CGCGCGCGCC GCCTGGGGAA GCCGCGTGAC CTCCCGCCGG TCACGATGCC GAGGGCGAAA ACTGGAAAAC GCCACGATGC 12300
GGCCACGACC CCGCAGGGCT GCCCTCGGCC TGCTGCCGGG AATTGGTGGG AAATACCCCC GGACTGCGCC ACTGCGCCGC CCCGCGAAGC CGAAACCCCG 12400
CGCGCGGACC ACCGACCCGA GCCCCAACCG GCGCTTGCGC GGCCGCAACC TACCCGCCAG ACTTCCCGAA AAGGGCGTTT GAAATTCCTA TACCCCCTTT 12500
GTGTTGTTCG ATAAACTGGG ATTTTATTTA TTCAGCAAGT CTTGTAATTC ATCCAAAAAA CGGCAAACAT GAAAGCCATC ACAAACGGCA TGATGCACTT 12600
GAATCGATAA GGGAATATAG TATTTTCCGC CATCCTCATA ATACTTCCCA AACGTAAATA TCGGCAGTAG ATAGTCATAT CCTTTTTTTA GATTTAAGTT 12700
AAAGCCTTCA AAGCTTGTCC ACGGTATCAT AGAAACAGGG AAAGTGTTTT CCGGAGGATT AGGCTTTGCG AACATTCCCT TTCGTTCACC ATAAGCGTCT 12800
ATATCCTTTT GATAGTTCTG AAGAAACTCA GTATAGTCTG CTGTAAACTC AGTCCAAATA CTCGAAAAGG TTTCAGTTTC CTTATGAAAG ATTGTGTAGC 12900
AAGGCAGCAT TTCTGAAAAA ACACCTACCT GTCCGTTTTT ATCTAATGCC GTCCTGAACT CTTCGTGTCG ATTGAGGATT GTTGTAACCC CATATAAGAG 13000
AGTCGGATAT AATTTTTTTC CATCCTTTTT CAACTTAGAA ATATCGAGTT TTACCGTCAT ACTATATGTG CAGGGCGTAT TGTCAAAATA GTGGTCGAAA 13100
TACTCTTTTC GTGTCCAATT ATTTATATCA ATCTTTGTGA ATTGCATCAT TTATCCTCCG CAAATTCTAA TTTGCAAATT TTATTATACT TGAAAAATAT 13200
GACCAATTCA ACCACAGAAA GCGGGGTATC AAAACTATGT ATTACACCCA AGAACAGATA GACCGCGCCA ACCAAGCCGA CCTTGTTTCT TTCCTGCAAT 13300
CACAGGGCGA GCAGCTTACC CGTGCCGGAA ATGAATACCG CTGGAAGCGG CACGACAGCC TGACCGTCCG GGGAAACAAA TGGTACAGGC ACAGCCAGAG 13400
TAAGGGCGGT GCACCCATTG ATTTTGTCAT GGAGTTTTTC GGCAAGAGCT TCACCGAAGC CGTTGAACTC ATAACAAGCC ATGAAAACCG CCACTGCGCC 13500
GTTACCACCG CTGCGTTCGG TCAAGGTTCT GGACCAGTTG CGTGAGCGCA TACGCTACTT GCATTACAGC TTACGAACCG AACAGGCTTA TGTCCACTGG 13600
GTTCGTGCCT TCATCCGTTT CCACGGTGTG CGTCACCCGG CAACCTTGGG CAGCAGCGAA GTCGAGGCAT TTCTGTCCTG GCTGGCGAAC GAGCGCAAGG 13700
TTTCGGTCTC CACGCATCGT CAGGCATTGG CGGCCTTGCT GTTCTTCTAC GGCAAGGTGC TGTGCACGGA TCTGCCCTGG CTTCAGGAGA TCGGAAGACC 13800
TCGGCCGTCG CGGCGCTTGC CGGTGGTGCT GACCCCGGAT GAAGTGGTTC GCATCCTCGG TTTTCTGGAA GGCGAGCATC GTTTGTTCGC CCAGCTTCTG 13900
TATGGAACGG GCATGCGGAT CAGTGAGGGT TTGCAACTGC GGGTCAAGGA TCTGGATTTC GATCACGGCA CGATCATCGT GCGGGAGGGC AAGGGCTCCA 14000
AGGATCGGGC CTTGATGTTA CCCGAGAGCT TGGCACCCAG CCTGCGCGAG CAGCTGTCGC GTGCACGGGC ATGGTGGCTG AAGGACCAGG CCGAGGGCCG 14100
CAGCGGCGTT GCGCTTCCCG ACGCCCTTGA GCGGAAGTAT CCGCGCGCCG GGCATTCCTG GCCGTGGTTC TGGGTTTTTG CGCAGCACAC GCATTCGACC 14200
GATCCACGGA GCGGTGTCGT GCGTCGCCAT CACATGTATG ACCAGACCTT TCAGCGCGCC TTCAAACGTG CCGTAGAACA AGCAGGCATC ACGAAGCCCG 14300
CCACACCGCA CACCCTCCGC CACTCGTTCG CGACGGCCTT GCTCCGCAGC GGTTACGACA TTCGAACCGT GCAGGATCTG CTCGGCCATT CCGACGTCTC 14400
TACGACGATG ATTTACACGC ATGTGCTGAA AGTTGGCGGT GCCGGAGTGC GCTCACCGCT TGATGCGCTG CCGCCCCTCA CTAGTGAGAG GTAGGGCAGC 14500
GCAAGTCAAT CCTGGCGGAT TCACTACCCC TGCGCGAAGG CCATCGGTGC CGCATCGAAC GGCCGGTTGC GGAAAGTCCT CCCTGCGTCC GCTGATGGCC 14600
GGCAGCAGCC CGTCGTTGCC TGATGGATCC AACCCCTCCG CTGCTATAGT GCAGTCGGCT TCTGACGTTC AGTGCAGCCG TCTTCTGAAA ACGACAATGG 14700
AGGTGGTAGC CGAGGGTGTG GAAACACCCG ACTGCCTTGC GTGGTTGCGG CAGGCGGGTT GCGACACGGT GCAGGGTTTC CTGTTCGCCA GGCCGATGCC 14800
GGCGGCGGCC TTCGTCGGCT TCGTCAACCA ATGGAGGAAC ACCACCATGA ACGCCAATGA ACCGAGCACC AGTTGCTGCG TGTGCTGCAA GGAAATCCCG 14900
CTCGATGCCG CCTTCACGCC GGAAGGGGCC GAGTACGTGG AGCATTTCTG CGGGCTGGAG TGCTATCAGC GCTTCCAGGC GCGGGCCAGC ACTGCGACCG 15000
AAACCAGCGT CAAACCGGAC GCTTGTGATT CGCCGCCGTC AGGTTGAGGC ATACCCTAAC CTGATGTCAG ATGCCATGTG TAAATTGCGT CAGGATAGGA 15100
TTGAATTTTG AATTTATTGA CATATCTCGT TGAAGGTCAT AGAGTCTTCC CTGACATTTT GCAGGGAATT CCATGACTGG ACAGCGCATT GGGTATATCA 15200
GGGTCAGCAC CTTCGACCAG AACCCGGAAC GGCAACTGGA AGGCGTCAAG GTTGATCGCG CTTTTAGCGA CAAGGCATCC GGCAAGGATG TCAAGCGTCC 15300
GCAACTGGAA GCGCTGATAA GCTTCGCCCG CACCGGCGAC ACCGTGGTGG TGCATAGCAT GGATCGCCTG GCGCGCAATC TCGATGATTT GCGCCGGATC 15400
GTGCAAACGC TGACACAACG CGGCGTGCAT ATCGAATTCG TCAAGGAACA CCTCAGTTTT ACTGGCGAAG ACTCTCCGAT GGCGAACCTG ATGCTCTCGG 15500
TGATGGGCGC GTTCGCCGAG TTCGAGCGCG CCCTGATCCG CGAGCGTCAG CGCGAGGGTA TTGCGCTCGC CAAGCAACGC GGGGCTTACC GTGGCAGGAA 15600
GAAATCCCTG TCGTCTGAGC GTATTGCCGA ACTGCGCCAA CGTGTCGAGG CTGGCGAGCA AAAGACCAAG CTTGCTCGTG AATTCGGAAT CAGTCGCGAA 15700
ACCCTGTATC AATACTTGAG AACGGATCAG TAAATATGCC ACGTCGTTCC ATCCTGTCCG CCGCCGAGCG GGAAAGCCTG CTGGCGTTGC CGGACTCCAA 15800
GGACGACCTG ATCCGACATT ACACATTCAA CGATACCGAC CTCTCGATCA TCCGACAGCG GCGCGGGCCA GCCAATCGGC TGGGCTTCGC GGTGCAGCTC 15900
TGTTACCTGC GCTTTCCCGG CGTCATCCTG GGCGTCGATG AACTACCGTT CCCGCCCTTG TTGAAGCTGG TCGCCGACCA GCTCAAGGTC GGCGTCGAAA 16000
GCTGGAACGA GTACGGCCAG CGGGAGCAGA CCCGGCGCGA GCACCTGAGC GAGCTGCAAA CCGTGTTCGG TTTCCGGCCC TTCACCATGA GCCATTACCG 16100
GCAGGCCGTC CAGATGCTGA CCGAGCTGGC GATGCAAACC GACAAAGGCA TCGTGCTGGC CAGCGCCTTG ATCGGGCACC TGCGGCGGCA GTCGGTCATT 16200
CTGCCCGCCC TCAACGCCGT CGAGCGGGCG AGTGCCGAGG CGATCACCCG TGCTAACCGG CGCATCTACG ACGCCTTGGC CGAACCACTG GCGGACGCGC 16300
ATCGCCGCCG CCTCGACGAT CTGCTCAAGC GCCGGGACAA CGGCAAGACG ACCTGGTTGG CTTGGTTGCG CCAGTCTCCG GCCAAGCCAA ATTCGCGGCA 16400
TATGCTGGAA CACATCGAAC GCCTCAAGGC ATGGCAGGCA CTCGATCTGC CTACCGGCAT CGAGCGGCTG GTTCACCAGA ACCGCCTGCT CAAGATTGCC 16500
CGCGAGGGCG GCCAGATGAC ACCCGCCGAC CTGGCCAAAT TCGAGCCGCA ACGGCGCTAC GCCACTCTCG TGGCGCTGGC CACCGAGGGC ATGGCCACCG 16600
TCACCGACGA AATCATCGAC CTGCACGACC GCATCCTGGG TAAGCTGTTT AACGCTGCCA AGAATAAGCA TCAGCAGCAG TTCCAGGCGT CAGGCAAGGC 16700
CATCAACGCC AAGGTACGTC TGTACGGGCG CATCGGTCAG GCGCTGATCG ACGCCAAGCA ATCAGGCCGC GATGCGTTTG CCGCCATCGA GGCCGTCATG 16800
TCCTGGGATT CCTTTGCCGA GAGCGTCACC GAGGCGCAGA AGCTCGCGCA ACCCGATGAC TTCGATTTCC TGCATCGCAT CGGCGAGAGC TACGCCACCC 16900
TGCGCCGCTA TGCACCGGAA TTCCTTGCCG TGCTCAAGCT GCGGGCCGCG CCCGCCGCCA AAAACGTGCT TGATGCCATT GAGGTGCTGC GCGGCATGAA 17000
CACCGACAAC GCCCGCAAGC TGCCAGCCGA TGCACCGACC GGCTTCATCA AGCCGCGCTG GCAGAAACTG GTGATGACCG ACGCCGGCAT CGACCGGCGC 17100
TACTACGAAC TGTGCGCGCT GTCCGAGTTG AAGAACTCCC TGCGCTCGGG CGACATCTGG GTGCAGGGTT CACGCCAGTT CAAGGACTTC GAGGACTACC 17200
TGGTACCGCC CGAGAAGTTC ACCAGCCTCA AGCAGTCCAG CGAATTGCCG CTGGCCGTGG CCACCGACTG CGAACAATAT CTGCATGAGC GGCTGACGCT 17300
GCTGGAAGCA CAACTTGCCA CCGTCAACCG CATGGCGGCA GCCAACGACC TGCCGGATGC CATCATCACC GAGTCGGGCT TGAAGATCAC GCCGCTGGAT 17400
GCGGCGGTGC CCGACACCGC GCAGGCGCTG ATAGACCAGA CAGCCATGGT CCTGCCGCAC GTCAAGATCA CCGAACTGCT GCTCGAAGTC GATGAGTGGA 17500
CGGGCTTCAC CCGGCACTTC ACGCACTTGA AATCGGGCGA TCTGGCCAAG GACAAGAACC TGTTGTTGAC CACGATCCTG GCCGACGCGA TCAACCTGGG 17600
CCTGACCAAG ATGGCCGAGT CCTGCCCCGG CACGACCTAC GCGAAGCTCG CTTGGCTGCA AGCCTGGCAT ACCCGCGACG AAACGTACTC GACAGCGTTG 17700
GCTGAACTGG TCAACGCTCA GTTTCGGCAT CCCTTTGCCG GGCACTGGGG CGATGGCACC ACATCATCAT CGGACGGACA GAATTTCCGA ACCGCTAGCA 17800
AGGCAAAGAG CACGGGGCAC ATCAACCCAA AATATGGCAG CAGCCCAGGA CGGACTTTCT ACACCCACAT CTCCGACCAA TACGCGCCAT TCCACACCAA 17900
GGTGGTCAAT GTCGGCCTGC GCGACTCAAC CTACGTGCTC GACGGCCTGC TGTACCACGA ATCCGACCTG CGGATCGAGG AGCACTACAC CGACACGGCG 18000
GGCTTCACCG ATCACGTCTT CGCCCTGATG CACCTCTTGG GCTTCCGCTT CGCGCCGCGC ATCCGCGACC TGGGCGACAC CAAGCTCTAC ATCCCGAAGG 18100
GCGATGCCGC CTATGACGCG CTCAAGCCGA TGATCGGCGG CACGCTCAAC ATCAAGCACG TCCGCGCCCA TTGGGACGAA ATCCTGCGGC TGGCCACCTC 18200
GATCAAGCAG GGCACGGTGA CGGCCTCGCT GATGCTCAGG AAACTCGGCA GCTACCCGCG CCAGAACGGC TTGGCCGTCG CGCTGCGCGA GTTGGGCCGC 18300
ATCGAGCGCA CGCTGTTCAT CCTCGACTGG CTGCAAAGCG TCGAGCTACG CCGCCGCGTG CATGCCGGGC TGAACAAGGG CGAGGCGCGC AATGCGCTGG 18400
CCCGTGCCGT GTTCTTCAAC CGCCTTGGTG AAATCCGTGA CCGCAGTTTC GAGCAGCAGC GCTACCGGGC CAGCGGCCTC AACCTGGTGA CGGCGGCCAT 18500
CGTGCTGTGG AACACGGTCT ACCTGGAGCG TGCGGCGCAT GCGTTGCGCG GCAATGGTCA TGCCGTCGAT GACTCGCTAT TGCAGTACCT GTCGCCACTC 18600
GGCTGGGAGC ACATCAACCT GACCGGTGAT TACCTATGGC GCAGCAGCGC CAAGATCGGC GCGGGGAAGT TCAGGCCGCT ACGGCCTCTG CAACCGGCTT 18700
AGCGTGCTTT ATTTTCCGTT TTCTGAGACG ACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
attC qacEdelta1_sul1 core 8013-8046 34 CCGCTAGCGG GCGGCCGGAA GGTGAATGCT AGGC
attC aadA1a core 9330-9383 54 CGCTTGAGTT AAGCCGCGCC GCGAAGCGGC GTCGGCTTGA ACGAATTGTT AGAC
attI 10186-10241 56 CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCA
res 15032-15162 131 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAGA TGCCATGTGT AAATTGCGTC
AGGATAGGAT TGAATTTTGA ATTTATTGAC ATATCTCGTT GAAGGTCATA GAGTCTTCCC
TGACATTTTG C
res_site_I 15032-15070 39 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAG
res_site_II 15084-15127 44 ATTGCGTCAG GATAGGATTG AATTTTGAAT TTATTGACAT ATCT
res_site_III 15131-15162 32 TGAAGGTCAT AGAGTCTTCC CTGACATTTT GC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR TnAs3 34-468 Passenger Gene Heavy Metal Resistance -
merT TnAs3 540-890 Passenger Gene Heavy Metal Resistance +
merP TnAs3 904-1179 Passenger Gene Heavy Metal Resistance +
merC TnAs3 1215-1637 Passenger Gene Heavy Metal Resistance +
merA TnAs3 1689-3383 Passenger Gene Heavy Metal Resistance +
merD TnAs3 3401-3763 Passenger Gene Heavy Metal Resistance +
merE TnAs3 3760-3996 Passenger Gene Heavy Metal Resistance +
urfM 5'-end TnAs3 3993-4663 Passenger Gene Other +
tniA In_TnAs3 4775-6454 Transposase   +
tniB_p In_TnAs3 6457-7356 Accessory Gene   +
GNAT_fam In_TnAs3 7413-7913 Passenger Gene Antibiotic Resistance -
sul1 (ARO:3000410) In_TnAs3 8041-8880 Passenger Gene Antibiotic Resistance -
qacEdelta1 (ARO:3005010) In_TnAs3 8874-9221 Passenger Gene Antibiotic Resistance -
aadA (ARO:3002601) In_TnAs3 9385-10176 Passenger Gene Antibiotic Resistance -
intI1_p In_TnAs3 10322-10876 Integron Integrase Class 1 +
tnp IS91 family In_TnAs3 11047-12249 Transposase   +
CAT (ARO:3004454) In_TnAs3 12524-13150 Passenger Gene Antibiotic Resistance -
intI1 In_TnAs3 13481-14494 Integron Integrase Class 1 +
tnpM TnAs3 14697-15047 Accessory Gene Inhibitor +
tnpR TnAs3 15173-15733 Accessory Gene Resolvase +
tnpA TnAs3 15736-18702 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR TnAs3 435 34-468 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLREPDKPY GSIRRYGEAD VVRVKFVKSA QRLGFSLDEI AELLRLDDGT HCEEASSLAE HKLKDVREKM
ADLARMETVL SELVCACHAR KGNVSCPLIA SLQGEAGLAR SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT TnAs3 351 540-890 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPQNGRGA LFAGGLAAIL ASTCCLGPLV LVALGFSGAW IGNLTVLEPY RPLFIGAALV ALFFAWKRIY RPVQACKPGE VCAIPQVRAT YKLIFWIVAV
LVLVALGFPY VVPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP TnAs3 276 904-1179 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFASLAL AAAVAPVWAA TQTVTLAVPG MTCAACPITV KKALSKVEGV SKVDVGFEKR EAVVTFDDTK ASVQKLTKAT ADAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC TnAs3 423 1215-1637 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   transmembrane protein mercury transport
Target:   Mercury
Protein Sequence:  
MGLMTRIADK TGALGSVVSA MGCAACFPAL ASFGAAIGLG FLSQYEGLFI SRLLPLFAAL AFLANALGWF SHRQWLRSLL GMIGPAIVFA ATVWLLGNWW
TANLMYVGLA LMIGVSIWDF VSPAHRRCGP DGCELPAKRL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA TnAs3 1695 1689-3383 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MSTLKITGMT CDSCAVHVKD ALEKVPGVQS ADVSYAKGSA KLAIEVGTSP DALTAAVAGL GYRATLADAP SVSTPGGLLD KMRDLLGRND KTGSSGALHI
AVIGSGGAAM AAALKAVEQG ARVTLIERGT IGGTCVNVGC VPSKIMIRAA HIAHLRRESP FDGGIAATTP TIQRTALLAQ QQARVDELRH AKYEGILEGN
PAITVLHGSA RFKDNRNLIV QLNDGGERVV AFDRCLIATG ASPAVPPIPG LKDTPYWTST EALVSETIPK RLAVIGSSVV ALELAQAFAR LGAKVTILAR
STLFFREDPA IGEAVTAAFR MEGIEVREHT QASQVAYING EGDGEFVLTT AHGELRADKL LVATGRAPNT RKLALDATGV TLTPQGAIVI DPGMRTSVEH
IYAAGDCTDQ PQFVYVAAAA GTRAAINMTG GDAALNLTAM PAVVFTDPQV ATVGYSEAEA HHDGIKTDSR TLTLDNVPRA LANFDTRGFI KLVVEEGSGR
LIGVQAVAPE AGELIQTAAL AIRNRMTVQE LADQLFPYLT MVEGLKLAAQ TFNKDVKQLS CCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD TnAs3 363 3401-3763 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MSAYTVSQLA HNAGVSVHIV RDYLVRGLLR PVACTTGGYG VFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGAQ AAAQLAVLRQ LVERRRAALA
HLDAQLASMP AERAHEEALP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE TnAs3 237 3760-3996 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Comment:   similar to urf-1 in pKLH2 (GenBank AF213017), pKLH272 (Genbank Y08992), pMER610 (GenBank Y08993), pKLH210 (GenBank Y10102), Tn5036 (Genbank Y09025), orf1 in Tn501 (GenBank Z00027), and urf-1 in Tn5041 (GenBank X98999)
Protein Sequence:  
MNAPDKLPPE TRQPVSGYLW GALAVLTCPC HLPILAAVLA GTTAGAFLGE HWGVAALALT GLFVLAVTRL LRAFRGGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM 5'-end UrfM 5'-end TnAs3 671 3993-4663 +
Class:   Passenger Gene
Sub Class:   Other
Comment:   urfM ORF interrupted by insertion of In2
Protein Sequence:  
MTSSQPAGWT AAELAQAAAR GQLDLHYQPL VDLRDHRIAG AEALMRWRHP RLGLLPPGQF LPLAESFGLM PEIGAWVLGE ACRQMHKWQG PAWQPFRLAI
NVSASQVGPT FDDEVKRVLA DMALPAELLE IELTESVAFG NPALFASFDA LRAIGVRFAA DDFGTGYSCL QHLKCCPITT LKIDQSFVAR LPDDARDQTI
VRAVIQLAHG LGMDVIFRRR LHQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA In_TnAs3 1680 4775-6454 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   can be extended upstream by 12 amino acids| identical to tniA (Tn1721 and In2)| 25% amino acid sequence identity to TnsB from Tn7
Protein Sequence:  
MATDTPRIPE QGVATLPDEA WERARRRAEI ISPLAQSETV GHEAADMAAQ ALGLSRRQVY VLIRRARQGS GLVTDLVPGQ SGGGKGKGRL PEPVERVIHE
LLQKRFLTKQ KRSLAAFHRE VTQVCKAQKL RVPARNTVAL RIASLDPRKV IRRREGQDAA RDLQGVGGEP PAVTAPLEQV QIDHTVIDLI VVDDRDRQPI
GRPYLTLAID VFTRCVLGMV VTLEAPSAVS VGLCLVHVAC DKRPWLEGLN VEMDWQMSGK PLLLYLDNAA EFKSEALRRG CEQHGIRLDY RPLGQPHYGG
IVERIIGTAM QMIHDELPGT TFSNPDQRGD YDSENKAALT LRELERWLTL AVGTYHGSVH NGLLQPPAAR WAEAVARVGV PAVVTRATSF LVDFLPILRR
TLTRTGFVID HIHYYADALK PWIARRERWP SFLIRRDPRD ISRIWVLEPE GQHYLEIPYR TLSHPAVTLW EQRQALAKLR QQGREQVDES ALFRMIGQMR
EIVTSAQKAT RKARRDADRR QHLKTSARPD KPVPPDTDIA DPQADNLPPA KPFDQIEEW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB_p TniB_p In_TnAs3 900 6457-7356 +
Class:   Accessory Gene
Sequence Family:  ATP binding protein
Comment:   3' deletion| similar function to Tn7 tnsC and MuB
Protein Sequence:  
VDEYPIIDLS HLLPAAQGLA RLPADERIQR LRADRWIGYP RAVEALNRLE ALYAWPNKQR MPNLLLVGPT NNGKSMIVEK FRRTHPASSD ADQEHIPVLV
VQMPSEPSVI RFYVALLAAM GAPLRPRPRL PEMEQLALAL LRKVGVRMLV IDELHNVLAG NSVNRREFLN LLRFLGNELR IPLVGVGTRD AYLAIRSDDQ
LENRFEPMML PVWEANDDCC SLLASFAASL PLRRPSPIAT LDMARYLLTR SEGTIGELAH LLMAAAIVAV ESGEEAINHR TLSISTTSRA TKTSRSDCK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
GNAT_fam GNAT_fam In_TnAs3 501 7413-7913 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  Acetyltransf_1 (Pfam:PF00583)
Comment:   putative acetyltransferase ADU64769.1
Protein Sequence:  
MDSEEPPNVR VACSGDIDEV VRLMHDAAAW MSAKGTPAWD VARIDRTFAE TFVLRSELLV ASCSDGIVGC CTLSAEDPEF WPDALKGEAA YLHKLAVRRT
HAGRGVSSAL IEACRHAART QGCAKLRLDC HPNLRGLYER LGFTHVDTFN PGWDPTFIAE RLELEI

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
sul1 (ARO:3000410) Sul1 In_TnAs3 840 8041-8880 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Transpoase Chemistry:   dihydropteroate synthase
Target:   sulfonamide antibiotic (ARO:3000282)||sulfone antibiotic (ARO:3003401)
Sequence Family:  sulfonamide resistant sul (ARO:3004238)
Comment:   perfect match to reference sequence for ARO:3000410
Protein Sequence:  
MVTVFGILNL TEDSFFDESR RLDPAGAVTA AIEMLRVGSD VVDVGPAASH PDARPVSPAD EIRRIAPLLD ALSDQMHRVS IDSFQPETQR YALKRGVGYL
NDIQGFPDPA LYPDIAEADC RLVVMHSAQR DGIATRTGHL RPEDALDEIV RFFEARVSAL RRSGVAADRL ILDPGMGFFL SPAPETSLHV LSNLQKLKSA
LGLPLLVSVS RKSFLGATVG LPVKDLGPAS LAAELHAIGN GADYVRTHAP GDLRSAITFS ETLAKFRSRD ARDRGLDHA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacEdelta1 (ARO:3005010) QacEdelta1 In_TnAs3 348 8874-9221 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   acridine dye (ARO:3000054)||quaternary ammonium salts
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Comment:   subunit of the qac multidrug efflux pump||perfect match to reference sequence for ARO:3005010 (bitscore:219)
Protein Sequence:  
MKGWLFLVIA IVGEVIATSA LKSSEGFTKL APSAVVIIGY GIAFYFLSLV LKSIPVGVAY AVWSGLGVVI ITAIAWLLHG QKLDAWGFVG MGLIIAAFLL
ARSPSWKSLR RPTPW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aadA (ARO:3002601) AadA In_TnAs3 792 9385-10176 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Transpoase Chemistry:   aminoglycoside nucleotidyltransferase
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  ANT(3'') (ARO:3004275)
Comment:   perfect match to reference sequence for ARO:3002601||Synonyms: aadA1-pm, aadA, aadA1, aad(3'')(9)
Protein Sequence:  
MREAVIAEVS TQLSEVVGVI ERHLEPTLLA VHLYGSAVDG GLKPHSDIDL LVTVTVRLDE TTRRALINDL LETSASPGES EILRAVEVTI VVHDDIIPWR
YPAKRELQFG EWQRNDILAG IFEPATIDID LAILLTKARE HSVALVGPAA EELFDPVPEQ DLFEALNETL TLWNSPPDWA GDERNVVLTL SRIWYSAVTG
RIAPKDVAAD WAMERLPAQY QPVILEARQA YLGQEEDRLA SRADQLEEFV HYVKGEITKV VGK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1_p IntI1_p In_TnAs3 555 10322-10876 +
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LRTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGRRIGRTFS RAVR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp IS91 family Tnp IS91 family In_TnAs3 1203 11047-12249 +
Class:   Transposase
Transpoase Chemistry:   HUH
Protein Sequence:  
MAESARHLVD EVFGPRPVRQ WVLSFPYPLR FLFASKPEAI GPVLGIVHRV IAGWLADQAG VPRDTAQCGA VTLIQRFGSA LNLNVHFHML WLDGVYDANV
EPPRRKPRLR RARAPTSAQL TQLANTIAHR VCRHLSRRGW LEGEDESVFL SDSAGSDDGM DGLRMSSMTY RIATGRDAGR KVVTLQTLPG DAGSLEGDAG
KVGGFSLHAG VAAEAHESHK LEKLCRYITR PAISEQRLSI SPQGRVRYQL KTPWRNGTTH VEWDAVDFIA KLAALVPPPR AHLTRFHGVF APNANLRAQL
TPSGRGKRPA GDAAPVDVSA HDEPRSPEQK RRAMSWAQRL KRVFSIDITI CAHCGGAVRI VASIEEPTAI RAILAHFEKH GAREEAHYRP AARAPPGEAA


Gene Name Protein Name Associated TE Gene Length Coordinates Strand
CAT (ARO:3004454) CAT In_TnAs3 627 12524-13150 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   phenicol antibiotic (ARO:3000387)
Sequence Family:  chloramphenicol acetyltransferase (ARO:3000122)
Comment:   96% match to reference sequence for ARO:3004454 (bitscore: 420)||Synonyms:
Protein Sequence:  
MMQFTKIDIN NWTRKEYFDH YFDNTPCTYS MTVKLDISKL KKDGKKLYPT LLYGVTTILN RHEEFRTALD KNGQVGVFSE MLPCYTIFHK ETETFSSIWT
EFTADYTEFL QNYQKDIDAY GERKGMFAKP NPPENTFPVS MIPWTSFEGF NLNLKKGYDY LLPIFTFGKY YEDGGKYYIP LSIQVHHAVC DGFHVCRFLD
ELQDLLNK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 In_TnAs3 1014 13481-14494 +
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LRTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpM TnpM TnAs3 351 14697-15047 +
Class:   Accessory Gene
Sub Class:   Inhibitor
Function:   transposition regulator; reported to enhance Tn21 transposition and suppress resolution of cointegrate replicons in vivo
Comment:   3'-end of urfM ORF, which is interrupted by insertion of In2||inhibits tranposition probably by inhibiting resolution
Protein Sequence:  
MEVVAEGVET PDCLAWLRQA GCDTVQGFLF ARPMPAAAFV GFVNQWRNTT MNANEPSTSC CVCCKEIPLD AAFTPEGAEY VEHFCGLECY QRFQARASTA
TETSVKPDAC DSPPSG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnAs3 561 15173-15733 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   identical to tnpR (TnAs3 )
Protein Sequence:  
MTGQRIGYIR VSTFDQNPER QLEGVKVDRA FSDKASGKDV KRPQLEALIS FARTGDTVVV HSMDRLARNL DDLRRIVQTL TQRGVHIEFV KEHLSFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKSLSSER IAELRQRVEA GEQKTKLARE FGISRETLYQ YLRTDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnAs3 2967 15736-18702 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Comment:   identical to TnAs3 tnpA
Protein Sequence:  
MPRRSILSAA ERESLLALPD SKDDLIRHYT FNDTDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEL PFPPLLKLVA DQLKVGVESW NEYGQREQTR
REHLSELQTV FGFRPFTMSH YRQAVQMLTE LAMQTDKGIV LASALIGHLR RQSVILPALN AVERASAEAI TRANRRIYDA LAEPLADAHR RRLDDLLKRR
DNGKTTWLAW LRQSPAKPNS RHMLEHIERL KAWQALDLPT GIERLVHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LATEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLY GRIGQALIDA KQSGRDAFAA IEAVMSWDSF AESVTEAQKL AQPDDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKN VLDAIEVLRG MNTDNARKLP ADAPTGFIKP RWQKLVMTDA GIDRRYYELC ALSELKNSLR SGDIWVQGSR QFKDFEDYLV PPEKFTSLKQ
SSELPLAVAT DCEQYLHERL TLLEAQLATV NRMAAANDLP DAIITESGLK ITPLDAAVPD TAQALIDQTA MVLPHVKITE LLLEVDEWTG FTRHFTHLKS
GDLAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHTRDET YSTALAELVN AQFRHPFAGH WGDGTTSSSD GQNFRTASKA KSTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGLRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERAAHALRGN GHAVDDSLLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
In_TnAs3-CP000645.1 In Integron 4634-14696 10063

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
repeat i4 Tn5053 10-28 TCAGAAAACG GAAAATAAA
IRt In_TnAs3 4634-4666 TGTCATTTTC AGAAGACGAC TGCACCAGTT GAT
repeat t1 In_TnAs3 4642-4660 TCAGAAGACG ACTGCACCA
repeat t2 In_TnAs3 4682-4700 AACACGTCGG TCGAGGACT
repeat t3 In_TnAs3 4711-4730 TCAGAAGTGA TCTGCACCAA
repeat t4 In_TnAs3 4743-4761 TCAATACTCG TGTGCACCA
repeat i4 In_TnAs3 14577-14595 AGGAGGGACG CAGGCGACT
repeat i3 In_TnAs3 14605-14623 CGTCGGGCAG CAACGGACT
repeat i2 In_TnAs3 14647-14665 ATCACGTCAG CCGAAGACT
IRi In_TnAs3 14664-14696 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 In_TnAs3 14670-14688 GTCACGTCGG CAGAAGACT
IRR Tn21 18695-18735 GCCGAATCGC ACGAAATAAA AGGCAAAAGA CTCTGCTGGG G