Transposon
Name: TnAmu1       (Synonyms: Tn7138)
Family: Tn3        Group: Tn163
Evidence of Transposition: yes
 Host     

Host Organism:Acidiphilium multivorum AIU301 Molecular Source:plasmid pACMV6
Date of Isolation:2010
Other Geographic Information:pyritic acid mine drainage

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTCACCGCACGATCTGTTCAAAATCGTACGCTAAG
IRR (Length: 38 bp)GGGGTCACCGCACGATCTGTTCAAAATCGTACGCTAAG

 Sequence     
DNA SequenceLength  3788 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCACCG CACGATCTGT TCAAAATCGT ACGCTAAGCG TTGGCGGGCT GCCTGGCGAG GGTACGATAG ATGGTTGGGC GGGAGACGGA GAATAGGTCT 100
GCGAGATCAG TGATGGAATA ATTGCCAGTG TCGTACATGC GGCGCAGTTC TTTTTGTTGT CTTTCGGATA GCGTCGGCCT TTTGCCGCGT AATTTTCCTT 200
TGGCGCGAGC GATGGCCATG CCTTCTCTGG TACGTAACCG GATCAGGTCG GCCTCAAACT CTGCGAAGGT GGCGAGAATG TTGAAGAACA TCTTCCCCAT 300
TGGGTCGGTT GGGTCATAGA CGGCCGCGCC GAGCGCGAGT TTGACACCGC GGGTAATGAG TTCATCGGCG ATCGCACGGG CATCTGGAAC GGAGCGTGCA 400
AGGCGGTCGA GTTTTGGCAC GACCAGGGTG TCGCCTTTAC GCACCGCCGC CAAGGCTTGA GCAAGCCCGG GGCGGGCACG ATTGGTGCCT GTGAGGCCAT 500
GGTCCGTATA GATGCGGTCC GGCTTTACCC CGAGCTGTTC GAGTTCGGCG CGTTGCGCGG CGAGATCTTG CCGGTCGGTT GAACAGCGGG CGTAACCGAT 600
CAGGGTGTGG GCCATGCGGA ATTGTAACGT ATGACCCCCC TTCATTGCAA AAGATATCGT ACCAGTTAAA TGATCCATCC GTTGCCGAGG GAAACAGCCA 700
CCAGTGCCAG GCCGTTACAT CTGTCCGTTG AACGATCCTC TTGCGGACGC ACGGTGGGCG CTAATTTTCT CATCAACCGG AACCCGATAT GCCACTCCGC 800
GTTCTTTTAT CCGCTGAACA ACGAGCCCGT TTGTTTTCAA TTCCAACGGA CATGGCCTCC ATGAGCCGGC ATTACGTACT GGATGCTGCT GACCTCGCTA 900
TGGTCAGGGT CAGACGCCGG GCAAGCAACC GGCTCGGCTT TGCCGTGCAA CTCTGTGTTC TCCGCTTCCC AGGCCGCACT CTGGATCCAT CGGAATATCC 1000
ACCGGCGCCG GCGCTGGCTT TTGTTGCTGA ACAGATCGGT GTCGATCCTT TGTTGTTTGC GGAATACGCG CGCCGTGCTG AAACCCGTCG GGAGCATTTG 1100
GTCGAGCTCC AAAAGTTCAC TGGTCTGCGT AGTTTTGGCC TCGATGACTG GCGCGCCTGC CTACATGCTG GTGCGGATAC GGCTTGGGCC ACAGATCGCG 1200
GCGAACCCAT CATCCAGGCT ATGCTCGTTC ATCTGAGAGA AAGCCGGGTA TTGCTTCCCT CGGCGACAGT GTTGGAGCGA ATTGGACTGG CCGCCCGTGT 1300
CCGAGCACGC AAGAAAACAT TCGAGGTGCT GGCAGCCGGG ATGGCCGATG CGGAGCGCAG TGCTCTGACC GAGCTGCTGA CGGTCGATCC CGAGTTGCGT 1400
CGCTCCCGTT TTGCCTGGCT GCGGGATTAT TCGGAATCAC CAGCTCCCTC CAACATCGTC TCCCTGCTCG ATCGCCTCGA ATATGTCCGC GCCATGGGCA 1500
TTGATCCCGC ACGGGCTGGT CGTATCCATG CTGCCCGCCT GGTCCGGCTG ACCGACGAGG GGGCGCTCAT GACCGTGCAG CACATCGCCG ATCTGGAGCC 1600
GGCGCGGCGC ACAGCCATTC TCATTGCCCA GATCGCAAGC CTGGAAACCC GTCTGACGGA CGCGACGCTT GCCATGTTCG AGAAATATGT CGGCACTTTG 1700
TTCAGCCGGG CGCGCAACCG CGATGAGCGT CGGTTTCAGG CCACGCGGCG CGATGTCGCC AAGGCGCTAC TGCTGTTCCG CCGGACGATC GCCGCCCTTC 1800
GCCAGGCGAA GGAGGCCGGA GAAGATGGGA TCACCGCCAT CGAGCGCGAG ATCGGCATGA ACCAGCTCGA AGATGTGCTG CCGATCATCG GCGCCGTCGC 1900
CGATGTGGCG GATCAGGATA TTTTGGTCAC GGCGGCCGAG CGATATACGG TGCTCCGCCG GTTCAGCCCC CGCTTCCTGG CCGCCTTCGA TTTCCGGTCG 2000
AATATGCCGA ACGATCCCGT TCTGGCCGCG ATCGAACTTC TCCGCGCCCT GAACCGTGGC GCGATCCGCA GCTTGCCCAA GCGGCCGCCC TCCACGTTCC 2100
TGCCGCCGCA GTGGCGGAAA TTGATTTTTG CCGGCGGCAC AGCCGACCGG CGGCTCTATG AAACAGCGGT GCTGGCCGTG CTGCGCGACA AGCTGCGGGG 2200
CAGTAATATC TGGGTCGCTG GCAGCCGCGA TTACCAGGCG TTCGAGACCT ATCTGCTTCC GGCCGGGGCG GGTGCGGCCA CCGGCATCGA TGGTGAGGCC 2300
GATCCCGATC GTTACGTCGC AAGCCGGGCA GAGATGCTGC GCGAGCGTCT GACCTTCGTG GCCGCCCGGG CCGCGCAGGG CGACCTCGAC GGGGTGGAGA 2400
TTGAGGACGG CAAACTTTTT ATCGCCCGCA CGCCGCCCAC CGTGCCCGAC GCGGCTCGCG ATCTGGCGCT GCGGCTGAAC AGTATGCTGC CGCGGGTGCG 2500
GATCACCGAG GTTTTGAGCG AGGTCGATGC CTGGACCGGG TTCACGGACA GGTTCGTGCA TCTGCGCACC GGTAACCCCG TCACCGACAA AGCGGCCCTG 2600
CTGGCAGCGG TGCTCGCTGA CGGCACCAAT CTTGGCCTTG CCCGCATGGC GGACGCCTCG CGCGGTCTCA GCTATCACCA CCTGGTCAAT GTGGCCCAAT 2700
GGCACATCAG CGATGACAAT TATGTCGCCG CCCGCGCCGC CATCATCAAT GCGCACCATG CACACCCCAT GGCGGCAATC TGGGATGATG GGACAAGCTC 2800
GTCTTCGGAC GGGCAATATT TCCGGGCCGC AGGCCGCGCC GGAGCCGGCG GCTCGGTAAA CGCCAAATAC GGCATCGAGC CGGGCGCGGT GATCTACACC 2900
CATGTTTCCG GTCAATACGG ACCGTTCCAC ACGCGCGTCA TCTCCGCGAC GATGAGCGAG GCGCCTTATG TGCTCGACGG GCTGCTGCAT CATGTCCACC 3000
AGACCGATCT GCGCATCGCC GAGCATTATA CCGATACCGC CGGCGCGACC GATCATGTCT TCGGTCTCTG CCATCTGCTG GGTTACAGGT TTGCCCCCAG 3100
GATCAAGGAT CTCCGGGACC GCAAGCTCTA CACGATAGAA AAGCCAGGCA CCTGGCCGCT GCTGGTGCCG CTCATCGGCG ACGCCGTCGA AACCACCGCC 3200
ATCCTCGGGC AATGGCCGGA GTTGATGCGG TTAAAGGCAT CCATCAATGC CGGCACTGTT CTGCCTTCCG TCATCTTGCG GAAGCTGGCC GCCGCCGGTG 3300
GAGGAAACAC TCTGTCCAGG GCGTTACGGG CTGTGGGGCG GATCGAGCGC ACCCTGTTCA CCCTGCAATG GCTGTCCGAT CCCGCTCTGC GCCAGCGCAG 3400
TCATGCCGGG CTCAATAAGG GCGAGGCCAG CAATGCCCTG CGCCGCGCCG TATTCTTCCA TCGCCAGGGT GAAATCCGCG ACCGCACCTT CGAAAATCAG 3500
AGCTTCCGGG CCTCCGGGCT CAGTCTCATC ACCGCCGCCA TCGTCCACTG GAATACCATC TATCTCGACC AGGCCGTCCA GCACCTGCGG GCCCAGGGTA 3600
CGGCAGTGCC CGATGATCTC CTGGCGCATG TCGCGCCGCT CGGATGGGAA CACATCGCTC TGACCGGCGA TTATGTCTGG AATCCCGCCA ATCCCAATGC 3700
CAGCTTCAGG CCGCTACGCG ATGTTCGCGC TCCGTTCATA CCCCGCGCCG CTTAGCGTAC GATTTTGAAC AGATCGTGCG GTGACCCC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnpR TnAmu1 34-645 Accessory Gene Resolvase -
tnpA TnAmu1 861-3755 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnAmu1 612 34-645 -
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MKGGHTLQFR MAHTLIGYAR CSTDRQDLAA QRAELEQLGV KPDRIYTDHG LTGTNRARPG LAQALAAVRK GDTLVVPKLD RLARSVPDAR AIADELITRG
VKLALGAAVY DPTDPMGKMF FNILATFAEF EADLIRLRTR EGMAIARAKG KLRGKRPTLS ERQQKELRRM YDTGNYSITD LADLFSVSRP TIYRTLARQP
ANA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnAmu1 2895 861-3755 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MSRHYVLDAA DLAMVRVRRR ASNRLGFAVQ LCVLRFPGRT LDPSEYPPAP ALAFVAEQIG VDPLLFAEYA RRAETRREHL VELQKFTGLR SFGLDDWRAC
LHAGADTAWA TDRGEPIIQA MLVHLRESRV LLPSATVLER IGLAARVRAR KKTFEVLAAG MADAERSALT ELLTVDPELR RSRFAWLRDY SESPAPSNIV
SLLDRLEYVR AMGIDPARAG RIHAARLVRL TDEGALMTVQ HIADLEPARR TAILIAQIAS LETRLTDATL AMFEKYVGTL FSRARNRDER RFQATRRDVA
KALLLFRRTI AALRQAKEAG EDGITAIERE IGMNQLEDVL PIIGAVADVA DQDILVTAAE RYTVLRRFSP RFLAAFDFRS NMPNDPVLAA IELLRALNRG
AIRSLPKRPP STFLPPQWRK LIFAGGTADR RLYETAVLAV LRDKLRGSNI WVAGSRDYQA FETYLLPAGA GAATGIDGEA DPDRYVASRA EMLRERLTFV
AARAAQGDLD GVEIEDGKLF IARTPPTVPD AARDLALRLN SMLPRVRITE VLSEVDAWTG FTDRFVHLRT GNPVTDKAAL LAAVLADGTN LGLARMADAS
RGLSYHHLVN VAQWHISDDN YVAARAAIIN AHHAHPMAAI WDDGTSSSSD GQYFRAAGRA GAGGSVNAKY GIEPGAVIYT HVSGQYGPFH TRVISATMSE
APYVLDGLLH HVHQTDLRIA EHYTDTAGAT DHVFGLCHLL GYRFAPRIKD LRDRKLYTIE KPGTWPLLVP LIGDAVETTA ILGQWPELMR LKASINAGTV
LPSVILRKLA AAGGGNTLSR ALRAVGRIER TLFTLQWLSD PALRQRSHAG LNKGEASNAL RRAVFFHRQG EIRDRTFENQ SFRASGLSLI TAAIVHWNTI
YLDQAVQHLR AQGTAVPDDL LAHVAPLGWE HIALTGDYVW NPANPNASFR PLRDVRAPFI PRAA