Transposon
Name: TnAli20       (Synonyms: Tn7136)
Family: Tn3        Group: Tn163
Evidence of Transposition: no
 Host     


 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 49 bp)GAGGGCATCGCGACATTTGTTCGGCAGACAACGCTATAAGGTCGAACGC
IRR (Length: 48 bp)GAGGGCATCGCGACATTTGTTCGGCAGACAACGCTAAGGTCGAACGGA

 Sequence     
DNA SequenceLength  3828 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GAGGGCATCG CGACATTTGT TCGGCAGACA ACGCTATAAG GTCGAACGCA CCGGGAACAG CGATGGATGA TTGCCCAGCC TGATGCTGGT CAGGAGGTGT 100
ACGGCGGCCT CTGGAGGCCC GCCAAGCTCA TCTCCCGGTA AACGGTGGAT CTCCCCAACC CCAGCTGCTT GGCGGCTTCG GTCGGCGACA GGCCAGCTTC 200
CACCAGTTTC AGTGCCGCTT TGATCTTGTC CATGTCCACC GGCTCGCGAC CTGGGCGTTT GCCGCGGGCC CGGGCGGGCG CGATGCCGTC CTTCGTGCGC 300
TCGGCGATCA GCCGCTGTTC GAAATGCGCA ATCGCGCCGA AGACGTGGAA CACCAGTTCG CCGGCCGCCG AAGTGGTGTC GATCCTCTCC TCCAGGCTGA 400
GCAGGCCGAT CCCGCGCTCC TTCAGCATCG CCACTGTCGC CAGCAACTCA GCGAGCGATC GGCCGAGCCG GTCGAGGCGG ACAATGGCCA GCGTGTCGCC 500
ACGGCGCGCA TGGGCGAGCA ACGCCTCCAA CCCTGGCCGG TCCTTCGCCT TGCCCGAGCA CACGTCGGTG AAGACCTTCA AGGCGCCGGC CTGCTCCAGC 600
CGCAACCGTT GGCCGGCGAC ATCCTGGTCG CCGGTCGAGA CCCGTGCGTA GCCCAGCATG TCGCCCATGC CCGTCCCCCA ACCGGCCGTT CTGTGGACGG 700
TCGCGCCGAA CCCGATCAGA CTGCTGCGCC GCCGTCCACA GAATACGTCC CGTTAATCCC TGCCGTCCAC AGTCCAATCC GACGTTTTCT GGACAGGGAA 800
AGACCACGTG GCACGACGCC AATTGCTGAC GGAGGAGGAA CGCCGACTGT TGTTCGGCCT GCCCACGGAT CGGGACGCCT TGGCCCGCCA TTACACGTTC 900
ACCCGCTCGG ATTTGGACCT CATCGCCAGC CGACGCGGTA ATGCCAACCG CTTGGGCTTC GCCGTGCAAT TGGCGCTCTT GCGTTATCCC GGATTGCCTC 1000
TGCCCCATAT CGGCGAGCCG ATCGACGCCG TCGTCGGCTG GGTGGCCGAA CACCTCGAGC TGCCGGTGAC GGCCTTCGCC GAGTATGCGC GTCGATCACA 1100
AACGATGACC GATCACGCCC GCGACACTGT CGCCGCGCTT GGGCTGCGGT TCCCACGCGA GGCCGATTTG CCTGACTTGA TCGAGGCCGC AGCGCAGGCG 1200
GCCTGGATTT CCGACCAAGG AATGTCGATC ATGACCGGGA CCATCGCTGC ACTCCGGTCA GCGAAGATCG TCCTGCCGTC CCCGGCGGTG ATCGAGCGCG 1300
CCGCCCTGGC GGGCCGTGCT CGCGCCCGAA AGCGGGCGGC GGATGCCTTG GTGGCCGATC TCACGGCCGA GCAGCGGGAT AAACTCGACA AGCTGCTGGC 1400
CGTTGATCCA GCAACCGGGA TCACCTCGCT GACCTGGTTG AGGACTATTC CCACGGCGCC GAAAGCGGAT CACGTTCGCG ACGTGATCGA CAAACTTCAC 1500
GTCGTTCGCG GCATCGGAAT CGATGCCGAG GCGCAGGCGC GTGTCCATGA AACCCGCTTT CGCCAGTTTG CCCGCGAGGG CATGGCCTCG CCCACCTACC 1600
TGATCGAGCG CTGTGCGCCG AACCGGCGGC GCGCGACACT GGTGGCGTTG CTGATCGACC TGGAGAACCG GCTCACCGAC GCCGCGCTCG ACATGGCCGA 1700
CAAGCTGATC GGCGGTGCGT TCACGCGCGC GAAGAACAAC AAGGAAAAGA CCTGCGTCGC GAAGACGAAG GACGTCGGCC GTCTGATGCG TCTGTTTCAC 1800
CGCACCATCG AGGCGCTCAG CCTAGCCCAG GAAAGCGACG GGGACGCCTT CGCTCTCGTC AACGAGGCGG TGGGCTGGCC GCAGTTGCTG CGCGTGCGCG 1900
GCGAGGTGGC CAGCCTCGCC GAGCTCGCGG AAGAGGACCC GCTGGTCCGC GCCGCCGACC GGTACGTCAC CATCCGGAAG TTCGCCCCGG CGCTCCTCGA 2000
AGCGCTCACG TTCAAGGCTG CCCGGAGCAA GGACCCGATC CTGGCGGCGG TCGAGTTGCT CAAGGAGCTC AACCGATCCG GCAAGCGCGA CATCCCGGCG 2100
GACGCGCCGA TGCTGTTCCG CAAGGAGTGG CGGCGCCTCG TCACCAAGGA CGGCAAGCCC AACCGGCGGC TCTACGAGAC AGCGGTGCTC GCCACCCTGC 2200
GCAACAAACT GCGCTCGGGC GACGTGTGGG TGGAGCGGTC GTCCAACTAC CGCCGCTTCG ACAGCTATCT GCTGCCCGCG GCGGCGGCGG CCCCGATCTC 2300
AGCGGATTTG ACGCTGCCCG CGACGGCCGA AGAGTGGCTG GGGGCGCTGG GGCGCGACCT CGACGAACAG CTGAAGCGTT TTGCCCAGCG CCTGCGCGAC 2400
GGCCAGCTCG AGGGCGTCGA ATTGCGCGAT GAGCGGCTGC ACATCGCGGC GCTGAAGGCG ACCGCGCCGC CAGAAGCGGA CGTTCTCGCC GACCGGCTCG 2500
ACGCCCTTCT GCCGCGCGTG CGCATCACCG AACTGCTGCA CGAGGTCAAC CGCGCGACCG GCTTCGCGGC GGCGTTCACC AACCTGCGCA CCGGTGAATC 2600
CTGCGACAAC GAGAACGCGC TGCTCGCCGT CATCCTAGCC GACGGCACCA ACCTGGGCCT GACACGCATG GCGGAGGCCA GCCAGGGCGT GACCCGCGAC 2700
CAGCTCATCT GGACCGCCGA CGCCTGCATC CGGCCTGAAA CCTACCAGTC GGCCCTGGCC CGGATCATCG ACGCTCACCA TCGGCTGCCC ATGGCCGCCG 2800
TCTGGGGTGG CGGAACGACG TCCTCATCGG ACGGCCAGTT CTTCCGTTCC GGCAAGCGCG GCAACGTCGC CGGCGAGGTG AACGCCCGGT ATGGCGGCAG 2900
TCCCGGCTTC AGCTTCTACA CCCACGTCTC GGACCAGCAC GGTCCGTACC ATGTCCGGGT CATCTCGGCG GCGGCCCACG AGGCCCCCTA CGTTCTGGAC 3000
GGCCTGCTGC ACCATGGGAC CGGCTTGAAG CTCGACACCC ACTACGTCGA TACAGGCGGC ACCTCGGATC ACGTGTTCAT TTTGGCCGCC ATGCTCGGCT 3100
TCCGCTTCTG TCCTCGCCTG CGCGATTTTC CCGAACGTCG GCTGGCCAGC ATCGAGCCGT CGAGCTGTTA TCCGGACCTC CAGCCACTGC TGGGCCGGCG 3200
GGTCAAGGTG GACGTCATCC GTGAGCATTG GAACGACGTG GTGCGCCTGG TCGCGTCGCT GAAGGCCGGC ACCGTGGCGC CCTCGACCAT GTTGAAGAAG 3300
CTGGCCGCCT ACGAGCGACA AAACCAGCTT GATCTGGCGC TCCAGGAACT GGGCCGCATC GAGCGCACAC TCTTCATGAT CCGCTGGTTG GAAACACCCG 3400
AGCTCAGACG GAGCTGTCAC ATCGGGTTGA ACAAAGGGGA GCAGCGTCAC GCTCTGGCCC AGGCGATCTG CACGTTCAAA CAGGGCCGGA TCGCCGACCG 3500
CGGGTCCCAA GCGCAGCAGT ATCGCGCCTC GGGGCTGAAC CTGCTCATCG CCGCGATCGT CTATTGGAAC TCGACCTACA TGGCCGACGC GGTTGGTCAT 3600
CTGCGCGCCG TCGGCGGGAC CGTACCCGAC GACCTGCTCG TCCACACCTC ACCGGTCGGC TGGGAGCACA TCGGTCTGTC CGGCGATTTC CTGTGGGGCC 3700
GCGCCGCGGC CGTGCCCATC GGCAGGCGAC CGCTTAACCT GCGACGGGAC CGCCATGCCG CCTGAAAGCC AAGTTCCCGG TCCGTTCGAC CTTAGCGTTG 3800
TCTGCCGAAC AAATGTCGCG ATGCCCTC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnpR TnAli20 90-668 Accessory Gene Resolvase -
tnpA TnAli20 808-3765 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnAli20 579 90-668 -
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MGDMLGYARV STGDQDVAGQ RLRLEQAGAL KVFTDVCSGK AKDRPGLEAL LAHARRGDTL AIVRLDRLGR SLAELLATVA MLKERGIGLL SLEERIDTTS
AAGELVFHVF GAIAHFEQRL IAERTKDGIA PARARGKRPG REPVDMDKIK AALKLVEAGL SPTEAAKQLG LGRSTVYREM SLAGLQRPPY TS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnAli20 2958 808-3765 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
VARRQLLTEE ERRLLFGLPT DRDALARHYT FTRSDLDLIA SRRGNANRLG FAVQLALLRY PGLPLPHIGE PIDAVVGWVA EHLELPVTAF AEYARRSQTM
TDHARDTVAA LGLRFPREAD LPDLIEAAAQ AAWISDQGMS IMTGTIAALR SAKIVLPSPA VIERAALAGR ARARKRAADA LVADLTAEQR DKLDKLLAVD
PATGITSLTW LRTIPTAPKA DHVRDVIDKL HVVRGIGIDA EAQARVHETR FRQFAREGMA SPTYLIERCA PNRRRATLVA LLIDLENRLT DAALDMADKL
IGGAFTRAKN NKEKTCVAKT KDVGRLMRLF HRTIEALSLA QESDGDAFAL VNEAVGWPQL LRVRGEVASL AELAEEDPLV RAADRYVTIR KFAPALLEAL
TFKAARSKDP ILAAVELLKE LNRSGKRDIP ADAPMLFRKE WRRLVTKDGK PNRRLYETAV LATLRNKLRS GDVWVERSSN YRRFDSYLLP AAAAAPISAD
LTLPATAEEW LGALGRDLDE QLKRFAQRLR DGQLEGVELR DERLHIAALK ATAPPEADVL ADRLDALLPR VRITELLHEV NRATGFAAAF TNLRTGESCD
NENALLAVIL ADGTNLGLTR MAEASQGVTR DQLIWTADAC IRPETYQSAL ARIIDAHHRL PMAAVWGGGT TSSSDGQFFR SGKRGNVAGE VNARYGGSPG
FSFYTHVSDQ HGPYHVRVIS AAAHEAPYVL DGLLHHGTGL KLDTHYVDTG GTSDHVFILA AMLGFRFCPR LRDFPERRLA SIEPSSCYPD LQPLLGRRVK
VDVIREHWND VVRLVASLKA GTVAPSTMLK KLAAYERQNQ LDLALQELGR IERTLFMIRW LETPELRRSC HIGLNKGEQR HALAQAICTF KQGRIADRGS
QAQQYRASGL NLLIAAIVYW NSTYMADAVG HLRAVGGTVP DDLLVHTSPV GWEHIGLSGD FLWGRAAAVP IGRRPLNLRR DRHAA

 References     

Wisniewski-Dyé F, Borziak K, Khalsa-Moyers G, Alexandre G, Sukharnikov LO, Wuichet K, Hurst GB, McDonald WH, Robertson JS, Barbe V, Calteau A, Rouy Z, Mangenot S, Prigent-Combaret C, Normand P, Boyer M, Siguier P, Dessaux Y, Elmerich C, Condemine G, Krishnen G, Kennedy I, Paterson AH, González V, Mavingui P, Zhulin IB. Azospirillum genomes reveal transition of bacteria from aquatic to terrestrial environments. PLoS Genet. 2011 Dec;7(12):e1002430. doi: 10.1371/journal.pgen.1002430. Epub 2011 Dec 22. PubMed ID: 22216014