Transposon
Name: Tn7
Family: Tn7
Evidence of Transposition: yes
 Host     

Host Organism:Escherichia coli Molecular Source:plasmid R721
Date of Isolation:1972

 Map     



 Terminal Inverted Repeats (IR)     

IRR (Length: 30 bp)TGTGGGCGGACAATAAAGTCTTAAACTGAA
IRL (Length: 28 bp)TGTGGGCGGACAAAATAGTTGGGAACTG

 Sequence     
DNA SequenceLength  14067 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
TGTGGGCGGA CAATAAAGTC TTAAACTGAA CAAAATAGAT CTAAACTATG ACAATAAAGT CTTAAACTAG ACAGAATAGT TGTAAACTGA AATCAGTCCA 100
GTTATGCTGT GAAAAAGCAT ACTGGACTTT TGTTATGGCT AAAGCAAACT CTTCATTTTC TGAAGTGCAA ATTGCCCGTC GTATTAAAGA GGGGCGTGGC 200
CAAGGGCATG GTAAAGACTA TATTCCATGG CTAACAGTAC AAGAAGTTCC TTCTTCAGGT CGTTCCCACC GTATTTATTC TCATAAGACG GGACGAGTCC 300
ATCATTTGCT ATCTGACTTA GAGCTTGCTG TTTTTCTCAG TCTTGAGTGG GAGAGCAGCG TGCTAGATAT ACGCGAGCAG TTCCCCTTAT TACCTAGTGA 400
TACCAGGCAG ATTGCAATAG ATAGTGGTAT TAAGCATCCT GTTATTCGTG GTGTAGATCA GGTTATGTCT ACTGATTTTT TAGTGGACTG CAAAGATGGT 500
CCTTTTGAGC AGTTTGCTAT TCAAGTCAAA CCTGCAGCAG CCTTACAAGA CGAGCGTACC TTAGAAAAAC TAGAACTAGA GCGTCGCTAT TGGCAGCAAA 600
AGCAAATTCC TTGGTTCATT TTTACTGATA AAGAAATAAA TCCCGTAGTA AAAGAAAATA TTGAATGGCT TTATTCAGTG AAAACAGAAG AAGTTTCTGC 700
GGAGCTTTTA GCACAACTAT CCCCATTGGC CCATATCCTG CAAGAAAAAG GAGATGAAAA CATTATCAAT GTCTGTAAGC AGGTTGATAT TGCTTATGAT 800
TTGGAGTTAG GCAAAACATT GAGTGAGATA CGAGCCTTAA CCGCAAATGG TTTTATTAAG TTCAATATTT ATAAGTCTTT CAGGGCAAAT AAGTGTGCAG 900
ATCTCTGTAT TAGCCAAGTA GTGAATATGG AGGAGTTGCG CTATGTGGCA AATTAATGAG GTTGTGCTAT TTGATAATGA TCCGTATCGC ATTTTGGCTA 1000
TAGAGGATGG CCAAGTTGTC TGGATGCAAA TAAGCGCTGA TAAAGGAGTT CCACAAGCTA GGGCTGAGTT GTTGCTAATG CAGTATTTAG ATGAAGGCCG 1100
CTTAGTTAGA ACTGATGACC CTTATGTACA TCTTGATTTA GAAGAGCCGT CTGTAGATTC TGTCAGCTTC CAGAAGCGCG AGGAGGATTA TCGAAAAATT 1200
CTTCCTATTA TTAATAGTAA GGATCGTTTC GACCCTAAAG TCAGAAGCGA ACTCGTTGAG CATGTGGTCC AAGAACATAA GGTTACTAAG GCTACAGTTT 1300
ATAAGTTGTT ACGCCGTTAC TGGCAGCGTG GTCAAACGCC TAATGCATTA ATTCCTGACT ACAAAAACAG CGGTGCACCA GGGGAAAGAC GTTCAGCGAC 1400
AGGAACAGCA AAGATTGGCC GAGCCAGAGA ATATGGTAAG GGTGAAGGAA CCAAGGTAAC GCCCGAGATT GAACGCCTTT TTAGGTTGAC CATAGAAAAG 1500
CACCTGTTAA ATCAAAAAGG TACAAAGACC ACCGTTGCCT ATAGACGATT TGTGGACTTG TTTGCTCAGT ATTTTCCTCG CATTCCCCAA GAGGATTACC 1600
CAACACTACG TCAGTTTCGT TATTTTTATG ATCGAGAATA CCCTAAAGCT CAGCGCTTAA AGTCTAGAGT TAAAGCAGGG GTATATAAAA AAGACGTACG 1700
ACCCTTAAGT AGTACAGCCA CTTCTCAGGC GTTAGGCCCT GGGAGTCGTT ATGAGATTGA TGCCACGATT GCTGATATTT ATTTAGTGGA TCATCATGAT 1800
CGCCAAAAAA TCATAGGAAG ACCAACGCTT TACATTGTGA TTGATGTGTT TAGTCGGATG ATCACGGGCT TTTATATCGG CTTTGAAAAT CCGTCTTATG 1900
TGGTGGCGAT GCAGGCTTTT GTAAATGCTT GCTCTGACAA AACGGCCATT TGTGCCCAGC ATGATATTGA GATTAGTAGC TCAGACTGGC CGTGTGTAGG 2000
TTTGCCAGAT GTGTTGCTAG CGGACCGTGG CGAATTAATG AGTCATCAGG TCGAAGCCTT AGTTTCTAGT TTTAATGTGC GAGTGGAAAG TGCTCCACCT 2100
AGACGTGGCG ATGCTAAAGG CATAGTGGAA AGCACTTTTA GAACACTACA AGCCGAGTTT AAGTCCTTTG CACCTGGCAT TGTAGAGGGC AGTCGGATCA 2200
AAAGCCATGG TGAAACAGAC TATAGGTTAG ATGCATCTCT GTCGGTATTT GAGTTCACAC AAATTATTTT GCGTACGATC TTATTCAGAA ATAACCATCT 2300
GGTGATGGAT AAATACGATC GAGATGCTGA TTTTCCTACA GATTTACCGT CTATTCCTGT CCAGCTATGG CAATGGGGTA TGCAGCATCG TACAGGTAGT 2400
TTAAGGGCTG TGGAGCAAGA GCAGTTGCGA GTAGCGTTAC TGCCTCGCCG AAAGGTCTCT ATTTCTTCAT TTGGCGTTAA TTTGTGGGGT TTGTATTACT 2500
CGGGGTCAGA GATTCTGCGT GAGGGTTGGT TGCAGCGGAG CACTGATATA GCTAGACCTC AACATTTAGA AGCGGCTTAT GACCCAGTGC TGGTTGATAC 2600
GATTTATTTG TTTCCGCAAG TTGGCAGCCG TGTATTTTGG CGCTGTAATC TGACGGAACG TAGTCGGCAG TTTAAAGGTC TCTCATTTTG GGAGGTTTGG 2700
GATATACAAG CACAAGAAAA ACACAATAAA GCCAATGCGA AGCAGGATGA GTTAACTAAA CGCAGGGAGC TTGAGGCGTT TATTCAGCAA ACCATTCAGA 2800
AAGCGAATAA GTTAACGCCC AGTACTACTG AGCCCAAATC AACACGCATT AAGCAGATTA AAACTAATAA AAAAGAAGCC GTGACCTCGG AGCGTAAAAA 2900
ACGTGCGGAG CATTTGAAGC CAAGCTCTTC AGGTGATGAG GCTAAAGTTA TTCCTTTCAA CGCAGTGGAA GCGGATGATC AAGAAGATTA CAGCCTACCC 3000
ACATACGTGC CTGAATTATT TCAGGATCCA CCAGAAAAGG ATGAGTCATG AGTGCTACCC GGATTCAAGC AGTTTATCGT GATACGGGGG TAGAGGCTTA 3100
TCGTGATAAT CCTTTTATCG AGGCCTTACC ACCATTACAA GAGTCAGTGA ATAGTGCTGC ATCACTGAAA TCCTCTTTAC AGCTTACTTC CTCTGACTTG 3200
CAAAAGTCCC GTGTTATCAG AGCTCATACC ATTTGTCGTA TTCCAGATGA CTATTTTCAG CCATTAGGTA CGCATTTGCT ACTAAGTGAG CGTATTTCGG 3300
TCATGATTCG AGGTGGCTAC GTAGGCAGAA ATCCTAAAAC AGGAGATTTA CAAAAGCATT TACAAAATGG TTATGAGCGT GTTCAAACGG GAGAGTTGGA 3400
GACATTTCGC TTTGAGGAGG CACGATCTAC GGCACAAAGC TTATTGTTAA TTGGTTGTTC TGGTAGTGGG AAGACGACCT CTCTTCATCG TATTCTAGCC 3500
ACGTATCCTC AGGTGATTTA CCATCGTGAA CTCAATGTAG AGCAGGTGGT GTATTTGAAA ATAGACTGCT CGCATAATGG TTCGCTAAAA GAAATCTGCT 3600
TGAATTTTTT CAGAGCGTTG GATCGAGCCT TGGGCTCGAA CTATGAGCGT CGTTATGGCT TAAAACGTCA TGGTATAGAA ACCATGTTGG CTTTGATGTC 3700
GCAAATAGCC AATGCACATG CTTTAGGGTT GTTGGTTATT GATGAAATTC AGCATTTAAG CCGCTCTCGT TCGGGTGGAT CTCAAGAGAT GCTGAACTTT 3800
TTTGTGACGA TGGTGAATAT TATTGGCGTA CCAGTGATGT TGATTGGTAC CCCTAAAGCA CGAGAGATTT TTGAGGCTGA TTTGCGGTCT GCACGTAGAG 3900
GGGCAGGGTT TGGAGCTATA TTCTGGGATC CTATACAACA AACGCAACGT GGAAAGCCCA ATCAAGAGTG GATCGCTTTT ACGGATAATC TTTGGCAATT 4000
ACAGCTTTTA CAACGCAAAG ATGCGCTGTT ATCGGATGAG GTCCGTGATG TGTGGTATGA GCTAAGCCAA GGAGTGATGG ACATTGTAGT AAAACTTTTT 4100
GTACTCGCTC AGCTCCGTGC GCTAGCTTTA GGCAATGAGC GTATTACCGC TGGTTTATTG CGGCAAGTGT ATCAAGATGA GTTAAAGCCT GTGCACCCCA 4200
TGCTAGAGGC ATTACGCTCG GGTATCCCAG AACGCATTGC TCGTTATTCT GATCTAGTCG TTCCCGAGAT TGATAAACGG TTAATCCAAC TTCAGCTAGA 4300
TATCGCAGCG ATACAAGAAC AAACACCAGA AGAAAAAGCC CTTCAAGAGT TAGATACCGA AGATCAGCGT CATTTATATC TGATGCTGAA AGAGGATTAC 4400
GATTCAAGCC TGTTAATTCC CACTATTAAA AAAGCGTTTA GCCAGAATCC AACGATGACA AGACAAAAGT TACTGCCTCT TGTTTTGCAG TGGTTGATGG 4500
AAGGCGAAAC GGTAGTGTCA GAACTAGAAA AGCCCTCCAA GAGTAAAAAG GTTTCGGCTA TAAAGGTAGT CAAGCCCAGC GACTGGGATA GCTTGCCTGA 4600
TACGGATTTA CGTTATATCT ATTCACAACG CCAACCTGAA AAAACCATGC ATGAACGGTT AAAAGGGAAA GGGGTAATAG TGGATATGGC GAGCTTATTT 4700
AAACAAGCAG GTTAGCCATG AGAAACTTTC CTGTTCCGTA CTCGAATGAG CTGATTTATA GCACTATTGC ACGGGCAGGC GTTTATCAAG GGATTGTTAG 4800
TCCTAAGCAG CTGTTGGATG AGGTGTATGG CAACCGCAAG GTGGTCGCTA CCTTAGGTCT GCCCTCGCAT TTAGGTGTGA TAGCAAGACA TCTACATCAA 4900
ACAGGACGTT ACGCTGTTCA GCAGCTTATT TATGAGCATA CCTTATTCCC TTTATATGCT CCGTTTGTAG GCAAGGAGCG CCGAGACGAA GCTATTCGGT 5000
TAATGGAGTA CCAAGCGCAA GGTGCGGTGC ATTTAATGCT AGGAGTCGCT GCTTCTAGAG TTAAGAGCGA TAACCGCTTT AGATACTGCC CTGATTGCGT 5100
TGCTCTTCAG CTAAATAGGT ATGGGGAAGC CTTTTGGCAA CGAGATTGGT ATTTGCCCGC TTTGCCATAT TGTCCAAAAC ACGGTGCTTT AGTCTTCTTT 5200
GATAGAGCTG TAGATGATCA CCGACATCAA TTTTGGGCTT TGGGTCATAC TGAGCTGCTT TCAGACTACC CCAAAGACTC CCTATCTCAA TTAACAGCAC 5300
TAGCTGCTTA TATAGCCCCT CTGTTAGATG CTCCACGAGC GCAAGAGCTT TCCCCAAGCC TTGAGCAGTG GACGCTGTTT TATCAGCGCT TAGCGCAGGA 5400
TCTAGGGCTA ACCAAAAGCA AGCACATTCG TCATGACTTG GTGGCGGAGA GAGTGAGGCA GACTTTTAGT GATGAGGCAC TAGAGAAACT GGATTTAAAG 5500
TTGGCAGAGA ACAAGGACAC GTGTTGGCTG AAAAGTATAT TCCGTAAGCA TAGAAAAGCC TTTAGTTATT TACAGCATAG TATTGTGTGG CAAGCCTTAT 5600
TGCCAAAACT AACGGTTATA GAAGCGCTAC AGCAGGCAAG TGCTCTTACT GAGCACTCTA TAACGACAAG ACCTGTTAGC CAGTCTGTGC AACCTAACTC 5700
TGAAGATTTA TCTGTTAAGC ATAAAGACTG GCAGCAACTA GTGCATAAAT ACCAAGGAAT TAAGGCGGCA AGACAGTCTT TAGAGGGTGG GGTGCTATAC 5800
GCTTGGCTTT ACCGACATGA CAGGGATTGG CTAGTTCACT GGAATCAACA GCATCAACAA GAGCGTCTGG CACCCGCCCC TAGAGTTGAT TGGAACCAAA 5900
GAGATCGAAT TGCTGTACGA CAACTATTAA GAATCATAAA GCGTCTAGAT AGTAGCCTTG ATCACCCAAG AGCGACATCG AGCTGGCTGT TAAAGCAAAC 6000
TCCTAACGGA ACCTCTCTTG CAAAAAATCT ACAGAAACTG CCTTTGGTAG CGCTTTGCTT AAAGCGTTAC TCAGAGAGTG TGGAAGATTA TCAAATTAGA 6100
CGGATTAGCC AAGCTTTTAT TAAGCTTAAA CAGGAAGATG TTGAGCTTAG GCGCTGGCGA TTATTAAGAA GTGCAACGTT ATCTAAAGAG CGGATAACTG 6200
AGGAAGCACA AAGATTCTTG GAAATGGTTT ATGGGGAAGA GTGAGTGGTT AGGCTAGCTA CATTTAATGA CAATGTGCAG GTTGTACATA TTGGTCATTT 6300
ATTCCGTAAC TCGGGTCATA AGGAGTGGCG TATTTTTGTT TGGTTTAATC CAATGCAAGA ACGGAAATGG ACTCGATTTA CTCATTTGCC TTTATTAAGT 6400
CGAGCTAAGG TGGTTAACAG TACAACAAAG CAAATAAATA AGGCGGATCG TGTGATTGAG TTTGAAGCAT CGGATCTTCA ACGAGCCAAA ATAATCGATT 6500
TTCCTAATCT CTCGTCCTTT GCTTCCGTAC GCAACAAGGA TGGAGCGCAG AGTTCATTTA TTTACGAAGC TGAAACACCA TATAGCAAGA CTCGTTATCA 6600
CATCCCACAG TTAGAGCTAG CTCGGTCATT ATTTTTAATT AACTCCTATT TCTGTCGAAG CTGTTTGAGC AGTACCGCTT TACAGCAAGA GTTCGACGTT 6700
CAGTATGAGG TTGAGCGAGA TCATTTAGAG ATAAGGATCT TACCCAGTTC ATCGTTTCCT AAAGGGGCGT TAGAGCAGTC GGCCGTAGTG CAGCTTTTGG 6800
TTTGGTTGTT TTCGGATCAA GATGTTATGG ATTCGTATGA AAGTATTTTT AGGCACTATC AACAAAATAG AGAAATTAAG AACGGCGTTG AAAGCTGGTG 6900
CTTTAGCTTT GACCCTCCGC CCATGCAGGG TTGGAAATTA CATGTAAAAG GACGTTCTTC TAACGAGGAT AAGGATTATT TAGTTGAGGA AATAGTAGGT 7000
TTAGAAATCA ACGCTATGCT TCCTAGCACA ACAGCTATTA GCCATGCCTC TTTTCAGGAA AAGGAGGCAG GTGATGGTAG TACGCAGCAC ATAGCGGTTT 7100
CAACAGAGTC AGTTGTTGAT GATGAGCATC TACAGTTGGA CGATGAGGAA ACAGCCAATA TAGACACAGA CACACGAGTC ATAGAGGCTG AGCCGACATG 7200
GATAAGTTTT AGTAGACCTA GTCGAATTGA AAAATCTCGC AGGGCAAGAA AAAGTAGCCA AACTATTTTA GAAAAAGAAG AAGCAACAAC AAGTGAAAAT 7300
AGTAATTTGG TTAGTACTGA TGAGCCACAC TTAGGTGGTG TCCTAGCAGC GGCAGATGTG GGTGGGAAGC AGGATGCAAC CAATTACAAC TCTATTTTTG 7400
CTAATCGATT TGCTGCTTTT GATGAGCTAC TTTCAATTCT AAAAACTAAA TTTGCATGTC GGGTGCTTTT TGAAGAAACC TTGGTTTTGC CAAAAGTTGG 7500
GCGTAGCCGA TTACATCTGT GTAAAGATGG CTCACCAAGA GTGATTAAAG CCGTTGGGGT GCAACGTAAT GGCAGTGAAT TTGTATTGCT AGAGGTGGAT 7600
GCATCGGATG GGGTGAAAAT GCTTTCTACC AAAGTGTTGA GTGGCGTTGA TAGCGAAACA TGGCGGAATG ATTTTGAAAA GATACGGCGT GGAGTGGTGA 7700
AGAGCTCATT GAATTGGCCA AATAGTTTGT TTGATCAATT ATATGGACAA GACGGGCATA GAGGGGTGAA TCATCCAAAG GGGTTGGGGG AGCTGCAAGT 7800
ATCGAGAGAG GATATGGAAG GGTGGGCTGA GAGAGTGGTT AGAGAGCAAT TTACGCATTA AAGGAATGAC TGAAAGAGCC TGTAAACCCT TTTGTGTAAG 7900
TGCTTTTGCC GGTCAGTTAA AGGTGGCCAT TTAAACGGTC ACCAAATTCG ATCATAAAAC GGTTCATGGC CGGCTTCCAG TTGCGGATCG GCATCGTCCA 8000
TTTCTTGGTC GCCGCCTGGA TAGCCAGGTA CACCACCTTC ATCGCTGATT CGTCCGTAGG GAACACCTTG AGTTCATATT AATGGAATTT TCTACAAATA 8100
GCCTCCGTGG TTTTGAGGGG GGATTACAGA CGATCCATAG TAGTAATCCA ATGAGTTCTT GAGCGCGGCG ACATGTTTGG ACGCCTTGGC AAAAATTAGA 8200
GCCTGCTTGA AGTGCAGGCG AGCACGTGCT TGGACGATTG ATCCATTCGC GGTCAAAAAC TCAATCTTGG ATGACAGCGT GTCAGGAAAT CCAATATCGA 8300
AGTCCCGCCC CGTGTCAAAG TAGGGCATTT CATGATCAAA GGACGAAGCT TCCCAGGCCA CTTCCCTAAT ATTCCAGCCG CTAGAAACAA GATTTCGTAC 8400
GACTTCATCA ACTTTTTTGC TTTCCAACTT GTCACAAAGT GCATAGGCAA GAGCTTTGGC GGCAGACACG TGCGTTTCCT CTTAAACATA GGTCGAACGG 8500
ATACCCGAGG CAAAGCGGAG CATTAGTCCC AAAGCATCTC CGGTAGATCC GGAGGCTCCA TACTGAAGGC ATGGCATCTT GGGCATTGAT ATTTGAAACT 8600
TCTCTCTAGA TAGCAGGGAT TTCTTGGCCT TGCCTCATGC TGATAGCTTG TAAATATCAC ACGATCCTTA GCCCCACAAA GTGAGCATAC TCCGTAGCTT 8700
TCATTTATAG AAATCGTCGT TAGATTGTCG CAGCATGTGC ACGTTCCGAC TATTTGCTCA GGAAGCATCG CCATACCTTG GCCTAGGTAA AGAAGATCAG 8800
ACTCGTAGCC ACATCGGTGG CAACTGAGCT TGTACGCAAT GCCCATCTGG TTGTCTCACC TGAATCGTAA CGTCAGAGCT ATTCATCCAT CCATTCGGCA 8900
TCAATGTATG CCACTAAGCC GACCAGCTGA CCGTTTGGAC TGAAGTATGT TGCCTGCACC CCACTTGACA TCTCATCAAT ACCACCGCAC TGCGCTAGGC 9000
GCCGGTCCCA CTTGCCCACA GAAGCGTCAG GATCGGCTGA GTTCCCCAAG ACCCTTGTGA GCCATGCCTC CTTTAACTCA ACCTCTCGAA TGATTGCGTC 9100
GGCCAGCTCC TCCGCGTTAT CTAGTTCGAC ATAGTCTGGA ATTCGGACGT ACGTTCTGAA CACAGCTGGA TACTTACTTG GGCGATTGTC ATACATGACA 9200
TCAACAATGT ACCCGTTTGT GTAACCGTCT CTTGGAGGTT CGTATGACAC TAGTGGTTCC CCTCAGCTTG CGACTAGATG TTGAGGCCTA ACATTTTATT 9300
AGAGAGCAGG CTAGTTGCTT AGATACATGA TCTTCAGGCC GTTATCTGTC AGGGCAAGCG AAAATTGGCC ATTTATGACG ACCAATGCCC CGCAGAAGCT 9400
CCCATCTTTG CCGCCATAGA CGCCGCGCCC CCCTTTTGGG GTGTAGAACA TCCTTTTGCC AGATGTGGAA AAGAAGTTCG TTGTCCCATT GTTGGCAATG 9500
ACGTAGTAGC CGGCGAAAGT GCGAGACCCA TTTGCGCTAT ATATAAGCCT ACGATTTCCG TTGCGACTAT TGTCGTAATT GGATGAACTA TTATCGTAGT 9600
TGCTCTCAGA GTTGTCGTAA TTTGATGGAC TATTGTCGTA ATTGCTTATG GAGTTGTCGT AGTTGCTTGG AGAAATGTCG TAGTTGGATG GGGAGTAGTC 9700
ATAGGGAAGA CGAGCTTCAT CCACTAAAAC AATTGGCAGG TCAGCAAGTG CCTGCCCCGA TGCCATCGCA AGTACGAGGC TTAGAACCAC CTTCAACAGA 9800
TCGCGCATAG TCTTCCCCAG CTCTCTAACG CTTGAGTTAA GCCGCGCCGC GAAGCGGCGT CGGCTTGAAC GAATTGTTAG ACATTATTTG CCGACTACCT 9900
TGGTGATCTC GCCTTTCACG TAGTGAACAA ATTCTTCCAA CTGATCTGCG CGCGAGGCCA AGCGATCTTC TTGTCCAAGA TAAGCCTGCC TAGCTTCAAG 10000
TATGACGGGC TGATACTGGG CCGGCAGGCG CTCCATTGCC CAGTCGGCAG CGACATCCTT CGGCGCGATT TTGCCGGTTA CTGCGCTGTA CCAAATGCGG 10100
GACAACGTAA GCACTACATT TCGCTCATCG CCAGCCCAGT CGGGCGGCGA GTTCCATAGC GTTAAGGTTT CATTTAGCGC CTCAAATAGA TCCTGTTCAG 10200
GAACCGGATC AAAGAGTTCC TCCGCCGCTG GACCTACCAA GGCAACGCTA TGTTCTCTTG CTTTTGTCAG CAAGATAGCC AGATCAATGT CGATCGTGGC 10300
TGGCTCGAAG ATACCTGCAA GAATGTCATT GCGCTGCCAT TCTCCAAATT GCAGTTCGCG CTTAGCTGGA TAACGCCACG GAATGATGTC GTCGTGCACA 10400
ACAATGGTGA CTTCTACAGC GCGGAGAATC TCGCTCTCTC CAGGGGAAGC CGAAGTTTCC AAAAGGTCGT TGATCAAAGC TCGCCGCGTT GTTTCATCAA 10500
GCCTTACGGT CACCGTAACC AGCAAATCAA TATCACTGTG TGGCTTCAGG CCGCCATCCA CTGCGGAGCC GTACAAATGT ACGGCCAGCA ACGTCGGTTC 10600
GAGATGGCGC TCGATGACGC CAACTACCTC TGATAGTTGA GTCGATACTT CGGCGATCAC CGCTTCCCTC ATGATGTTTA ACTCCTGAAT TAAGCCGCGC 10700
CGCGAAGCGG TGTCGGCTTG AATGAATTGT TAGGCGTCAT CCTGTGCTCC CGAGAACCAG TACCAGTACA TCGCTGTTTC GTTCGAGACT TGAGGTCTAG 10800
TTTTATACGT GAACAGGTCA ATGCCGCCGA GAGTAAAGCC ACATTTTGCG TACAAATTGC AGGCAGGTAC ATTGTTCGTT TGTGTCTCTA ATCGTATGCC 10900
AAGGAGCTGT CTGCTTAGTG CCCACTTTTT CGCAAATTCG ATGAGACTGT GCGCGACTCC TTTGCCTCGG TGCGTGTGCG ACACAACAAT GTGTTCGATA 11000
GAGGCTAGAT CGTTCCATGT TGAGTTGAGT TCAATCTTCC CGACAAGCTC TTGGTCGATG AATGCGCCAT AGCAAGCAGA GTCTTCATCA GAGTCATCAT 11100
CCGAGATGTA ATCCTTCCGG TAGGGGCTCA CACTTCTGGT AGATAGTTCA AAGCCTTGGT CGGATAGGTG CACATCGAAC ACTTCACGAA CAATGAAATG 11200
GTTCTCAGCA TCCAATGTTT CCGCCACCTG CTCAGGGATC ACCGAAATCT TCATATGACG CCTAACGCCT GGCACAGCGG ATCGCAAACC TGGCGCGGCT 11300
TTTGGTACAA AAGGCGTGAC AGGTTTGCGA ATCCGTTGCT GCCACTTGTT AACCCTTTTG CCAGATTTGG TAACTATAAT TTATGTTAGA GGCGAAGTCT 11400
TGGGTAAAAA CTGGCCTAAA ATTGCTGGGG ATTTCAGGAA AGTAAACATC ACCTTCCGGC TCGATGTCTA TTGTAGATAT ATGTAGTGTA TCTACTTGAT 11500
CGATCAGGCT TTTGTATATC TCCCCACCAC CTGAAACAAT GACATGATCC GTTATTTTCT TTAGGTTGGT TAAAGCATCT TTAATTGATG GAAAGATCAA 11600
TACGTTCTCA TTGTCAGATG TAAAACTTGA ACGTGTTACG ACCGCATACT TTCGGTTGGG TAATGCTCCC ATTGATTCAA AAGTCTTGCG TCCAACCAAC 11700
AGCCATTGGT TATAGGTAAT AGCTTTAAAC AGGAGCTGTT CACCTTTGGC ACTCCATGGA ATATCAGGGC CATTCCCGAT AACTCCATTC TTCGATATAG 11800
CTACCATTAG TGATAGTTTC ACAATTCTTC CTCAGAGGTT AACATTTTAT TAGTAAGCAT GCTCGTTTTG TCACCCGCTG ATGCTTACCG TTAATTAATA 11900
TAATCACTTG TATTAAATAG ACTTTCTTTA AAAATACAAG ACACTCTGTT ATTACAAATC GTGCATGCCG TCTATCCTGC TTGCACGATG CACATTATCT 12000
CACCCAAAGA ACTCATAACA TTTTAATTTA TTTAGCATTA AATTAAAACT CTACCGGTAA ACAAGCATCT CTAGGCGTAA AAAACAGGCA CTTTTTTAAA 12100
TCCCAGCTAG AATAGGCTGT ATAGGCAGAC AGTTGCAAGA CAAGGAGCGT TTTATGTCTA ACAGTCCATT TTTAAATTCT ATACGCACGG ATATGCGACA 12200
AAAAGGTTAT GCGCTGAAAA CTGAAAAAAC TTACCTGCAC TGGATTAAGC GTTTTATTCT GTTTCACAAA AAACGTCATC CTCAGACCAT GGGCAGTGAA 12300
GAGGTCAGGC TGTTTTTATC CAGCTTAGCA AACAGCAGAC ATGTAGCCAT AAACACGCAG AAAATCGCTT TAAATGCCCT AGCTTTTTTG TACAACAGGT 12400
TTTTACAACA GCCGTTGGGC GATATTGATT ATATCCCTGC AAGCAAGCCT AGACGGCTAC CCTCTGTTAT CTCTGCAAAT GAAGTGCAAC GCATTTTGCA 12500
GGTTATGGAT ACTCGCAACC AAGTTATTTT TACGCTGCTG TATGGTGCAG GTTTGCGCAT TAATGAATGC TTGCGTTTGC GGGTTAAAGA TTTTGATTTT 12600
GATAATGGCT GCATCACTGT GCATGACGGT AAGGGTGGGA AAAGCAGAAA CAGCCTACTG CCCACGCGCC TAATCCCAGC AATAAAATAA CTCATTGAGC 12700
AAGCGCGGCT TATTCAGCAA GACGACAACT TACAAGGCGT AGGGCCATCG CTGCCTTTTG CTTTAGATCA CAAATACCCT TCTGCTTATC GACAAGCGGC 12800
GTGGATGTTT GTCTTTCCCT CCAGCACGCT CTGCAACCAC CCGTATAACG GCAAATTATG CCGCCATCAT CTGCATGACT CCGTTGCGCG AAAGGCATTG 12900
AAGGCAGCCG TACAAAAAGC AGGCATCGTT AGCAAGCGTG TCACTTGTCA TACATTTCGT CACTCGTTTG CTACGCATCT ATTACAAGCG GGGCGTGATA 13000
TTCGCACTGT GCAAGAACTC TTAGGGCATA ACGATGTTAA GACCACGCAA ATCTATACGC ATGTGTTGGG TCAGCATTTT GCCGGCACCA CCAGTCCTGC 13100
GGATGGACTG ATGCTACTTA TCAATCAGTA AAAGTAGATA AATATCTTTA TGTAGCCCTG AGTAGCCCCT GATACTTTTT ATGGTGAAAA AGATAAACAA 13200
TCATAGAGGG GATAAATATG AGCCAGTTCT ACCATTGTTC AGATAAGTTT AAGCAAGATA CTGTCAATCA CAGTGACCAT TCATGGTCAT TACACTTCCT 13300
CCAGTTGCCA GACAATGCCT AACATAAAAA CGCAAAAGCC CAAAAGTCAG AGCTTAGGTG TTCTAGGCGT TTTCTAAGCG CTGAAGAAAT ACGTCTTACC 13400
GTAGATTGCG TGCGTTTCTG AAGCACATTT TCCTTATACA TGGCTTTATC CCAGGCAGCT TCATCAAGCT CTTGGAGTAA CAAGCCAGTA ATAATGCGAC 13500
ACTCTCGGGT TTGTAGCGAG CCGCTGGTGA GATCGGAGTT ATAGCGGAAA GGGGTCATTT GTAATTATTT GTGGGTGGAG GATAGTTAAC TTATTATTGT 13600
AGTTGGAAGA GGCTGCTTTC CAAACATTAG CACCTCGTAA TGCTTGTTAC TGTATATTAA TTTATGCTCT TAGCGCATGT TAATGGGCTA TTACAATGCA 13700
TAATGTCCAC ATCAAGATAA CTGTGGCTTA ACACCTGTAC AAGCGAAAAA AATCAATCAC CTGTCCGGAA ATACGGGATC ACTGTAAAGT GTTGGTGAGG 13800
CAGTCTAGGA GGGGGATTTA ATTTGGGATA CTGATGAAAG GATTATGATC AGTTGGATAT AGGATCGTAC TAAGCTGAGC GGCAGGTTAG CTAGATTAGT 13900
TAACCAGATA AGTGAAATCT AGTTCCAAAC TATTTTGTCA TTTTTAATTT TCGTATTAGC TTACGACGCT ACACCCAGTT CCCATCTATT TTGTCACTCT 14000
TCCCTAAATA ATCCTTAAAA ACTCCATTTC CACCCCTCCC AGTTCCCAAC TATTTTGTCC GCCCACA

 Recombination Sites     

Name Coordinates Gene Sequence
attC ANT(3'')-IIa core 9823-9882 60 CTCTAACGCT TGAGTTAAGC CGCGCCGCGA AGCGGCGTCG GCTTGAACGA ATTGTTAGAC
attC Sat-2 core 10676-10735 60 GTTTAACTCC TGAATTAAGC CGCGCCGCGA AGCGGTGTCG GCTTGAATGA ATTGTTAGGC
attC dfrA1 core 11260-11354 95 GCCTAACGCC TGGCACAGCG GATCGCAAAC CTGGCGCGGC TTTTGGTACA AAAGGCGTGA
CAGGTTTGCG AATCCGTTGC TGCCACTTGT TAACC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnsA Tn7 135-956 Transposase   +
tnsB Tn7 943-3051 Transposase   +
tnsC Tn7 3048-4715 Accessory Gene Helper +
tnsD Tn7 4718-6244 Accessory Gene Target Site Selection +
tnsE Tn7 6245-7861 Accessory Gene Target Site Selection +
ybgA Tn7 8092-8469 Passenger Gene Hypothetical -
ybfB Tn7 8523-8846 Passenger Gene Hypothetical -
ybfC Tn7 8879-9250 Passenger Gene Hypothetical -
orfX-R721_21 In_Tn7 9311-9808 Passenger Gene Hypothetical -
ANT(3'')-IIa (ARO:3004089) In_Tn7 9884-10672 Passenger Gene Antibiotic Resistance -
SAT-2 (ARO:3002895) In_Tn7 10730-11254 Passenger Gene Antibiotic Resistance -
dfrA1 (ARO:3002854) In_Tn7 11349-11822 Passenger Gene Antibiotic Resistance -
intI2 In_Tn7 12154-13131 Integron Integrase Class 2 +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnsA TnsA Tn7 822 135-956 +
Class:   Transposase
Function:   transposase
Comment:   resembles a type II restriction enzyme||functions at the 5' end of the transposon||interacts with TnsB||forms double stranded breaks at ends of transposon
Protein Sequence:  
MAKANSSFSE VQIARRIKEG RGQGHGKDYI PWLTVQEVPS SGRSHRIYSH KTGRVHHLLS DLELAVFLSL EWESSVLDIR EQFPLLPSDT RQIAIDSGIK
HPVIRGVDQV MSTDFLVDCK DGPFEQFAIQ VKPAAALQDE RTLEKLELER RYWQQKQIPW FIFTDKEINP VVKENIEWLY SVKTEEVSAE LLAQLSPLAH
ILQEKGDENI INVCKQVDIA YDLELGKTLS EIRALTANGF IKFNIYKSFR ANKCADLCIS QVVNMEELRY VAN

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnsB TnsB Tn7 2109 943-3051 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   functions at the 3' end of the transposon||interacts with TnsA||also interacts with target site for joining reaction
Protein Sequence:  
MWQINEVVLF DNDPYRILAI EDGQVVWMQI SADKGVPQAR AELLLMQYLD EGRLVRTDDP YVHLDLEEPS VDSVSFQKRE EDYRKILPII NSKDRFDPKV
RSELVEHVVQ EHKVTKATVY KLLRRYWQRG QTPNALIPDY KNSGAPGERR SATGTAKIGR AREYGKGEGT KVTPEIERLF RLTIEKHLLN QKGTKTTVAY
RRFVDLFAQY FPRIPQEDYP TLRQFRYFYD REYPKAQRLK SRVKAGVYKK DVRPLSSTAT SQALGPGSRY EIDATIADIY LVDHHDRQKI IGRPTLYIVI
DVFSRMITGF YIGFENPSYV VAMQAFVNAC SDKTAICAQH DIEISSSDWP CVGLPDVLLA DRGELMSHQV EALVSSFNVR VESAPPRRGD AKGIVESTFR
TLQAEFKSFA PGIVEGSRIK SHGETDYRLD ASLSVFEFTQ IILRTILFRN NHLVMDKYDR DADFPTDLPS IPVQLWQWGM QHRTGSLRAV EQEQLRVALL
PRRKVSISSF GVNLWGLYYS GSEILREGWL QRSTDIARPQ HLEAAYDPVL VDTIYLFPQV GSRVFWRCNL TERSRQFKGL SFWEVWDIQA QEKHNKANAK
QDELTKRREL EAFIQQTIQK ANKLTPSTTE PKSTRIKQIK TNKKEAVTSE RKKRAEHLKP SSSGDEAKVI PFNAVEADDQ EDYSLPTYVP ELFQDPPEKD
ES

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnsC TnsC Tn7 1668 3048-4715 +
Class:   Accessory Gene
Sub Class:   Helper
Function:   adaptor protein
Comment:   ATP-dependent DNA-binding protein||interacts with double-stranded DNA nonspecifically and the transposase TnsAB and the target site selectors TnsD and E||ATP-hydrolysis promotes correct transposition
Protein Sequence:  
MSATRIQAVY RDTGVEAYRD NPFIEALPPL QESVNSAASL KSSLQLTSSD LQKSRVIRAH TICRIPDDYF QPLGTHLLLS ERISVMIRGG YVGRNPKTGD
LQKHLQNGYE RVQTGELETF RFEEARSTAQ SLLLIGCSGS GKTTSLHRIL ATYPQVIYHR ELNVEQVVYL KIDCSHNGSL KEICLNFFRA LDRALGSNYE
RRYGLKRHGI ETMLALMSQI ANAHALGLLV IDEIQHLSRS RSGGSQEMLN FFVTMVNIIG VPVMLIGTPK AREIFEADLR SARRGAGFGA IFWDPIQQTQ
RGKPNQEWIA FTDNLWQLQL LQRKDALLSD EVRDVWYELS QGVMDIVVKL FVLAQLRALA LGNERITAGL LRQVYQDELK PVHPMLEALR SGIPERIARY
SDLVVPEIDK RLIQLQLDIA AIQEQTPEEK ALQELDTEDQ RHLYLMLKED YDSSLLIPTI KKAFSQNPTM TRQKLLPLVL QWLMEGETVV SELEKPSKSK
KVSAIKVVKP SDWDSLPDTD LRYIYSQRQP EKTMHERLKG KGVIVDMASL FKQAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnsD TnsD Tn7 1527 4718-6244 +
Class:   Accessory Gene
Sub Class:   Target Site Selection
Function:   target site selection
Comment:   DNA-binding protein||functions with the TnsABC complex to select specific target sites in the chromosome called attTn7 (this 63-bp site is at the 3' end of the glutamine synthase gene glmS as well as other targets in other chromosomes)
Protein Sequence:  
MRNFPVPYSN ELIYSTIARA GVYQGIVSPK QLLDEVYGNR KVVATLGLPS HLGVIARHLH QTGRYAVQQL IYEHTLFPLY APFVGKERRD EAIRLMEYQA
QGAVHLMLGV AASRVKSDNR FRYCPDCVAL QLNRYGEAFW QRDWYLPALP YCPKHGALVF FDRAVDDHRH QFWALGHTEL LSDYPKDSLS QLTALAAYIA
PLLDAPRAQE LSPSLEQWTL FYQRLAQDLG LTKSKHIRHD LVAERVRQTF SDEALEKLDL KLAENKDTCW LKSIFRKHRK AFSYLQHSIV WQALLPKLTV
IEALQQASAL TEHSITTRPV SQSVQPNSED LSVKHKDWQQ LVHKYQGIKA ARQSLEGGVL YAWLYRHDRD WLVHWNQQHQ QERLAPAPRV DWNQRDRIAV
RQLLRIIKRL DSSLDHPRAT SSWLLKQTPN GTSLAKNLQK LPLVALCLKR YSESVEDYQI RRISQAFIKL KQEDVELRRW RLLRSATLSK ERITEEAQRF
LEMVYGEE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnsE TnsE Tn7 1617 6245-7861 +
Class:   Accessory Gene
Sub Class:   Target Site Selection
Function:   target site selection
Comment:   DNA-binding protein||functions with the TnsABC complex to select target sites for transposition similar to TnsD function||TnsE specifically targets sites with orientation bias the same as DNA replication, which leads to insertion into actively conjugating plasmid molecules in recipient cells undergoing lagging strand synthesis
Protein Sequence:  
MVRLATFNDN VQVVHIGHLF RNSGHKEWRI FVWFNPMQER KWTRFTHLPL LSRAKVVNST TKQINKADRV IEFEASDLQR AKIIDFPNLS SFASVRNKDG
AQSSFIYEAE TPYSKTRYHI PQLELARSLF LINSYFCRSC LSSTALQQEF DVQYEVERDH LEIRILPSSS FPKGALEQSA VVQLLVWLFS DQDVMDSYES
IFRHYQQNRE IKNGVESWCF SFDPPPMQGW KLHVKGRSSN EDKDYLVEEI VGLEINAMLP STTAISHASF QEKEAGDGST QHIAVSTESV VDDEHLQLDD
EETANIDTDT RVIEAEPTWI SFSRPSRIEK SRRARKSSQT ILEKEEATTS ENSNLVSTDE PHLGGVLAAA DVGGKQDATN YNSIFANRFA AFDELLSILK
TKFACRVLFE ETLVLPKVGR SRLHLCKDGS PRVIKAVGVQ RNGSEFVLLE VDASDGVKML STKVLSGVDS ETWRNDFEKI RRGVVKSSLN WPNSLFDQLY
GQDGHRGVNH PKGLGELQVS REDMEGWAER VVREQFTH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
ybgA YbgA Tn7 378 8092-8469 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MSAAKALAYA LCDKLESKKV DEVVRNLVSS GWNIREVAWE ASSFDHEMPY FDTGRDFDIG FPDTLSSKIE FLTANGSIVQ ARARLHFKQA LIFAKASKHV
AALKNSLDYY YGSSVIPPQN HGGYL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
ybfB YbfB Tn7 324 8523-8846 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MGIAYKLSCH RCGYESDLLY LGQGMAMLPE QIVGTCTCCD NLTTISINES YGVCSLCGAK DRVIFTSYQH EARPRNPCYL ERSFKYQCPR CHAFSMEPPD
LPEMLWD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
ybfC YbfC Tn7 372 8879-9250 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MSYEPPRDGY TNGYIVDVMY DNRPSKYPAV FRTYVRIPDY VELDNAEELA DAIIREVELK EAWLTRVLGN SADPDASVGK WDRRLAQCGG IDEMSSGVQA
TYFSPNGQLV GLVAYIDAEW MDE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfX-R721_21 OrfX-R721_21 In_Tn7 498 9311-9808 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MRDLLKVVLS LVLAMASGQA LADLPIVLVD EARLPYDYSP SNYDISPSNY DNSISNYDNS PSNYDNSESN YDNSSSNYDN SRNGNRRLIY SANGSRTFAG
YYVIANNGTT NFFSTSGKRM FYTPKGGRGV YGGKDGSFCG ALVVINGQFS LALTDNGLKI MYLSN

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
ANT(3'')-IIa (ARO:3004089) ANT(3'')-IIa In_Tn7 789 9884-10672 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Transpoase Chemistry:   aminoglycoside nucleotidyltransferase
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  ANT(3'') (ARO:3004275)
Comment:   strict match to reference sequence for ARO:3004089 (bitscore: 569)||Synonym: ANT(9)(3'')
Protein Sequence:  
MREAVIAEVS TQLSEVVGVI ERHLEPTLLA VHLYGSAVDG GLKPHSDIDL LVTVTVRLDE TTRRALINDL LETSASPGES EILRAVEVTI VVHDDIIPWR
YPAKRELQFG EWQRNDILAG IFEPATIDID LAILLTKARE HSVALVGPAA EELFDPVPEQ DLFEALNETL TLWNSPPDWA GDERNVVLTL SRIWYSAVTG
KIAPKDVAAD WAMERLPAQY QPVILEARQA YLGQEDRLAS RADQLEEFVH YVKGEITKVV GK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
SAT-2 (ARO:3002895) SAT-2 In_Tn7 525 10730-11254 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   nucleoside antibiotic (ARO:3000034)
Sequence Family:  streptothricin acetyltransferase (SAT) (ARO:3000869)
Comment:   strict match to reference sequence for ARO:3002895 (bitscore: 365)
Protein Sequence:  
MKISVIPEQV AETLDAENHF IVREVFDVHL SDQGFELSTR SVSPYRKDYI SDDDSDEDSA CYGAFIDQEL VGKIELNSTW NDLASIEHIV VSHTHRGKGV
AHSLIEFAKK WALSRQLLGI RLETQTNNVP ACNLYAKCGF TLGGIDLFTY KTRPQVSNET AMYWYWFSGA QDDA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
dfrA1 (ARO:3002854) DfrA1 In_Tn7 474 11349-11822 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Target:   diaminopyrimidine antibiotic (ARO:3000171)
Sequence Family:  trimethoprim resistant dihydrofolate reductase dfr (ARO:3001218)
Comment:   Synonym: dfr1
Protein Sequence:  
MKLSLMVAIS KNGVIGNGPD IPWSAKGEQL LFKAITYNQW LLVGRKTFES MGALPNRKYA VVTRSSFTSD NENVLIFPSI KDALTNLKKI TDHVIVSGGG
EIYKSLIDQV DTLHISTIDI EPEGDVYFPE IPSNFRPVFT QDFASNINYS YQIWQKG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI2 IntI2 In_Tn7 978 12154-13131 +
Class:   Integron Integrase
Sub Class:   Class 2
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 2 Integron Tyrosine Integrase
Comment:   truncated stop at codon 174
Protein Sequence:  
MSNSPFLNSI RTDMRQKGYA LKTEKTYLHW IKRFILFHKK RHPQTMGSEE VRLFLSSLAN SRHVAINTQK IALNALAFLY NRFLQQPLGD IDYIPASKPR
RLPSVISANE VQRILQVMDT RNQVIFTLLY GAGLRINECL RLRVKDFDFD NGCITVHDGK GGKSRNSLLP TRLIPAIK*L IEQARLIQQD DNLQGVGPSL
PFALDHKYPS AYRQAAWMFV FPSSTLCNHP YNGKLCRHHL HDSVARKALK AAVQKAGIVS KRVTCHTFRH SFATHLLQAG RDIRTVQELL GHNDVKTTQI
YTHVLGQHFA GTTSPADGLM LLINQ

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
In_Tn7-NC_002525 In Integron 9311-13131 3821

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
repeat R1 Tn7 9-30 GACAATAAAG TCTTAAACTG AA
repeat R2 Tn7 29-50 AACAAAATAG ATCTAAACTA TG
repeat R3 Tn7 50-71 GACAATAAAG TCTTAAACTA GA
repeat R4 Tn7 70-91 GACAGAATAG TTGTAAACTG AA
repeat L3 Tn7 13918-13940 AGATCAAGGT TTGATAAAAC AGT
repeat L2 Tn7 13974-13996 GGGTCAAGGG TAGATAAAAC AGT
repeat L1 Tn7 14038-14060 GGGTCAAGGG TTGATAAAAC AGG

 References     

1.Datta N, Hedges RW. Trimethoprim resistance conferred by W plasmids in Enterobacteriaceae. J Gen Microbiol. 1972 Sep;72(2):349-55. doi: 10.1099/00221287-72-2-349. PubMed ID: 4562309
2.Kim SR, Komano T. Nucleotide sequence of the R721 shufflon. J Bacteriol. 1992 Nov;174(21):7053-8. doi: 10.1128/jb.174.21.7053-7058.1992. PubMed ID: 1400257
3.Fennewald MA, Shapiro JA. Transposition of Tn7 in Pseudomonas aeruginosa and isolation of alk::Tn7 mutations. J Bacteriol. 1979 Jul;139(1):264-9. doi: 10.1128/JB.139.1.264-269.1979. PubMed ID: 110782
4.Gringauz E, Orle KA, Waddell CS, Craig NL. Recognition of Escherichia coli attTn7 by transposon Tn7: lack of specific sequence requirements at the point of Tn7 insertion. J Bacteriol. 1988 Jun;170(6):2832-40. doi: 10.1128/jb.170.6.2832-2840.1988. PubMed ID: 2836374
5.Stellwagen AE, Craig NL. Avoiding self: two Tn7-encoded proteins mediate target immunity in Tn7 transposition. EMBO J. 1997 Nov 17;16(22):6823-34. doi: 10.1093/emboj/16.22.6823. PubMed ID: 9362496
6.Waddell CS, Craig NL. Tn7 transposition: two transposition pathways directed by five Tn7-encoded genes. Genes Dev. 1988 Feb;2(2):137-49. doi: 10.1101/gad.2.2.137. PubMed ID: 2834269
7.Skelding Z, Queen-Baker J, Craig NL. Alternative interactions between the Tn7 transposase and the Tn7 target DNA binding protein regulate target immunity and transposition. EMBO J. 2003 Nov 3;22(21):5904-17. doi: 10.1093/emboj/cdg551. PubMed ID: 14592987
8.McKown RL, Waddell CS, Arciszewska LK, Craig NL. Identification of a transposon Tn7-dependent DNA-binding activity that recognizes the ends of Tn7. Proc Natl Acad Sci U S A. 1987 Nov;84(22):7807-11. doi: 10.1073/pnas.84.22.7807. PubMed ID: 2825163
9.Bainton RJ, Kubo KM, Feng JN, Craig NL. Tn7 transposition: target DNA recognition is mediated by multiple Tn7-encoded proteins in a purified in vitro system. Cell. 1993 Mar 26;72(6):931-43. doi: 10.1016/0092-8674(93)90581-a. PubMed ID: 8384534
10.McKown RL, Orle KA, Chen T, Craig NL. Sequence requirements of Escherichia coli attTn7, a specific site of transposon Tn7 insertion. J Bacteriol. 1988 Jan;170(1):352-8. doi: 10.1128/jb.170.1.352-358.1988. PubMed ID: 2826397
11.Arciszewska LK, Drake D, Craig NL. Transposon Tn7. cis-Acting sequences in transposition and transposition immunity. J Mol Biol. 1989 May 5;207(1):35-52. PubMed ID: 2544738
12.Hansson K, Sundstrom L, Pelletier A, Roy PH. IntI2 integron integrase in Tn7. J Bacteriol. 2002 Mar;184(6):1712-21. doi: 10.1128/jb.184.6.1712-1721.2002. PubMed ID: 11872723
13.Choi KY, Spencer JM, Craig NL. The Tn7 transposition regulator TnsC interacts with the transposase subunit TnsB and target selector TnsD. Proc Natl Acad Sci U S A. 2014 Jul 15;111(28):E2858-65. doi: 10.1073/pnas.1409869111. Epub 2014 Jun 30. PubMed ID: 24982178
14.Wolkow CA, DeBoy RT, Craig NL. Conjugating plasmids are preferred targets for Tn7. Genes Dev. 1996 Sep 1;10(17):2145-57. doi: 10.1101/gad.10.17.2145. PubMed ID: 8804309
15.Rao JE, Craig NL. Selective recognition of pyrimidine motif triplexes by a protein encoded by the bacterial transposon Tn7. J Mol Biol. 2001 Apr 13;307(5):1161-70. doi: 10.1006/jmbi.2001.4553. PubMed ID: 11292332
16.Craig NL. Tn7: a target site-specific transposon. Mol Microbiol. 1991 Nov;5(11):2569-73. PubMed ID: 1664019
17.Chakrabarti A, Desai P, Wickstrom E. Transposon Tn7 protein TnsD binding to Escherichia coli attTn7 DNA and its eukaryotic orthologs. Biochemistry. 2004 Mar 16;43(10):2941-6. doi: 10.1021/bi035535u. PubMed ID: 15005630
18.DeBoy RT, Craig NL. Tn7 transposition as a probe of cis interactions between widely separated (190 kilobases apart) DNA sites in the Escherichia coli chromosome. J Bacteriol. 1996 Nov;178(21):6184-91. doi: 10.1128/jb.178.21.6184-6191.1996. PubMed ID: 8892817
19.Sarnovsky RJ, May EW, Craig NL. The Tn7 transposase is a heteromeric complex in which DNA breakage and joining activities are distributed between different gene products. EMBO J. 1996 Nov 15;15(22):6348-61. PubMed ID: 8947057
20.Peters JE. Tn7. Microbiol Spectr. 2014 Oct;2(5). doi: 10.1128/microbiolspec.MDNA3-0010-2014. PubMed ID: 26104363
21.Kuduvalli PN, Rao JE, Craig NL. Target DNA structure plays a critical role in Tn7 transposition. EMBO J. 2001 Feb 15;20(4):924-32. doi: 10.1093/emboj/20.4.924. PubMed ID: 11179236
22.DeBoy RT, Craig NL. Target site selection by Tn7: attTn7 transcription and target activity. J Bacteriol. 2000 Jun;182(11):3310-3. doi: 10.1128/jb.182.11.3310-3313.2000. PubMed ID: 10809719
23.Sharpe PL, Craig NL. Host proteins can stimulate Tn7 transposition: a novel role for the ribosomal protein L29 and the acyl carrier protein. EMBO J. 1998 Oct 1;17(19):5822-31. doi: 10.1093/emboj/17.19.5822. PubMed ID: 9755182
24.Sarnovsky RJ, May EW, Craig NL. The Tn7 transposase is a heteromeric complex in which DNA breakage and joining activities are distributed between different gene products. EMBO J. 1996 Nov 15;15(22):6348-61. PubMed ID: 8947057
25.Shi Q, Parks AR, Potter BD, Safir IJ, Luo Y, Forster BM, Peters JE. DNA damage differentially activates regional chromosomal loci for Tn7 transposition in Escherichia coli. Genetics. 2008 Jul;179(3):1237-50. doi: 10.1534/genetics.108.088161. Epub 2008 Jun 18. PubMed ID: 18562643
26.Parks AR, Peters JE. Tn7 elements: engendering diversity from chromosomes to episomes. Plasmid. 2009 Jan;61(1):1-14. doi: 10.1016/j.plasmid.2008.09.008. Epub 2008 Nov 1. PubMed ID: 18951916
27.Gamas P, Craig NL. Purification and characterization of TnsC, a Tn7 transposition protein that binds ATP and DNA. Nucleic Acids Res. 1992 May 25;20(10):2525-32. doi: 10.1093/nar/20.10.2525. PubMed ID: 1317955
28.Arciszewska LK, McKown RL, Craig NL. Purification of TnsB, a transposition protein that binds to the ends of Tn7. J Biol Chem. 1991 Nov 15;266(32):21736-44. PubMed ID: 1657979
29.Gay NJ, Tybulewicz VL, Walker JE. Insertion of transposon Tn7 into the Escherichia coli glmS transcriptional terminator. Biochem J. 1986 Feb 15;234(1):111-7. doi: 10.1042/bj2340111. PubMed ID: 3010949
30.Holder JW, Craig NL. Architecture of the Tn7 posttransposition complex: an elaborate nucleoprotein structure. J Mol Biol. 2010 Aug 13;401(2):167-81. doi: 10.1016/j.jmb.2010.06.003. Epub 2010 Jun 9. PubMed ID: 20538004
31.Peters JE, Craig NL. Tn7 transposes proximal to DNA double-strand breaks and into regions where chromosomal DNA replication terminates. Mol Cell. 2000 Sep;6(3):573-82. doi: 10.1016/s1097-2765(00)00056-3. PubMed ID: 11030337
32.Stellwagen AE, Craig NL. Gain-of-function mutations in TnsC, an ATP-dependent transposition protein that activates the bacterial transposon Tn7. Genetics. 1997 Mar;145(3):573-85. PubMed ID: 9055068
33.Skelding Z, Sarnovsky R, Craig NL. Formation of a nucleoprotein complex containing Tn7 and its target DNA regulates transposition initiation. EMBO J. 2002 Jul 1;21(13):3494-504. doi: 10.1093/emboj/cdf347. PubMed ID: 12093750
34.May EW, Craig NL. Switching from cut-and-paste to replicative Tn7 transposition. Science. 1996 Apr 19;272(5260):401-4. doi: 10.1126/science.272.5260.401. PubMed ID: 8602527
35.Lu F, Craig NL. Isolation and characterization of Tn7 transposase gain-of-function mutants: a model for transposase activation. EMBO J. 2000 Jul 3;19(13):3446-57. doi: 10.1093/emboj/19.13.3446. PubMed ID: 10880457
36.Stellwagen AE, Craig NL. Analysis of gain-of-function mutants of an ATP-dependent regulator of Tn7 transposition. J Mol Biol. 2001 Jan 19;305(3):633-42. doi: 10.1006/jmbi.2000.4317. PubMed ID: 11152618
37.Gary PA, Biery MC, Bainton RJ, Craig NL. Multiple DNA processing reactions underlie Tn7 transposition. J Mol Biol. 1996 Mar 29;257(2):301-16. PubMed ID: 8609625
38.Arciszewska LK, Craig NL. Interaction of the Tn7-encoded transposition protein TnsB with the ends of the transposon. Nucleic Acids Res. 1991 Sep 25;19(18):5021-9. doi: 10.1093/nar/19.18.5021. PubMed ID: 1656385
39.Arciszewska LK, Craig NL. Interaction of the Tn7-encoded transposition protein TnsB with the ends of the transposon. Nucleic Acids Res. 1991 Sep 25;19(18):5021-9. doi: 10.1093/nar/19.18.5021. PubMed ID: 1656385
40.Peters JE, Craig NL. Tn7 recognizes transposition target structures associated with DNA replication using the DNA-binding protein TnsE. Genes Dev. 2001 Mar 15;15(6):737-47. doi: 10.1101/gad.870201. PubMed ID: 11274058
41.Ronning DR, Li Y, Perez ZN, Ross PD, Hickman AB, Craig NL, Dyda F. The carboxy-terminal portion of TnsC activates the Tn7 transposase through a specific interaction with TnsA. EMBO J. 2004 Aug 4;23(15):2972-81. doi: 10.1038/sj.emboj.7600311. Epub 2004 Jul 15. PubMed ID: 15257292
42.Kubo KM, Craig NL. Bacterial transposon Tn7 utilizes two different classes of target sites. J Bacteriol. 1990 May;172(5):2774-8. doi: 10.1128/jb.172.5.2774-2778.1990. PubMed ID: 2158980
43.Peters JE, Craig NL. Tn7: smarter than we thought. Nat Rev Mol Cell Biol. 2001 Nov;2(11):806-14. doi: 10.1038/35099006. PubMed ID: 11715047
44.Shi Q, Straus MR, Caron JJ, Wang H, Chung YS, Guarné A, Peters JE. Conformational toggling controls target site choice for the heteromeric transposase element Tn7. Nucleic Acids Res. 2015 Dec 15;43(22):10734-45. doi: 10.1093/nar/gkv913. Epub 2015 Sep 17. PubMed ID: 26384427