Transposon
Name: Tn6346
Family: Tn3
Evidence of Transposition: yes
 Host     

Host Organism:Achromobacter sp. LM16 Molecular Source:plasmid pLM16A1
Place of Origin:Lubin, Poland Date of Isolation:2014
Other Geographic Information:Lubin copper mine

 Map     



 Terminal Inverted Repeats (IR)     

IRR (Length: 38 bp)GGGGTCGTCTCAGAAAACGGAAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  8230 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCGTCT CAGAAAACGG AAAATAAAGC ACGCTAAGGC ATAGCCGAAC CTGCCAAGCT TGCTCCACCC TGTAGTGACG CGATCAGCGG GCAGGAAACG 100
TTCCCCCTTC GCGCATGGCA GGCGCACACC AACTCAGACA GCACGGCCTC CATGCGCGCC AGGTCAGCCA TTTTCTCGCG CACGTCCTTG AGCTTGTGCT 200
CGGCCAGACT GCTGGCTTCC TCGCAATGGG TGCCATCCTC CAGCCGCAGC AGCTCGGCGA TCTCATCCAG GCTGAAGCCC AGCCGCTGGG CTGATTTCAC 300
GAAGCGCACC CGCGTTACAT CCGCCTCGCC ATAGCGGCGG ATGCTGCCAT AGGGCTTGTC AGGCTCCAGC AACAAGCCCT TGCGCTGATA GAAACGGATG 400
GTCTCCACAT TGACCCCGGC CGCCTTGGCG AAAACGCCAA TGGTCAGGTT CTCCAAATTG TTTTCCATAT CGCTTGACTC CGTACATGAG TACGGAAGTA 500
AGGTTACGCT ATCCAATTTC AATTCGAAAG GACAAGCGCA TGTCTGAACC AAAAACCGGG CGCGGCGCGC TCTTCACTGG AGGGCTTGCC GCCATCCTCG 600
CCTCGGCTTG CTGCCTCGGG CCGTTGGTTC TGATCGCCTT GGGGTTCAGC GGCGCTTGGA TCGGCAACTT GGCGGTGTTG GATCCCTATC GCCCCATCTT 700
TATCGGCGTG GCGCTGGTGG CGTTGTTCTT CGCCTGGCGG CGCATCTACC GGCAGGCAGC GGCCTGCAAA CCGGGTGAGG TCTGCGCGAT TCCCCAAGTG 800
CGAGCTACTT ACAAGCTCAT TTTCTGGATC GTGGCCGCGC TGGTTCTGGT CGCGCTCGGA TTTCCCTACG TCATGCCATT TTTCTACTGA TCGGAGTTCA 900
CCATGAAGAA ACTGTTTGCC TCCCTCGCCC TCGCCGCCGT TGTTGCCCCC GTCTGGGCCG CCACCCAGAC CGTCACGCTG TCCGTACCGG GCATGACCTG 1000
CTCCGCCTGC CCGATCACTG TCAAGAAGGC GATTTCCAAG GTCGAAGGCG TCAGCAAAGT TGACGTGACT TTCGAGACAC GCCAAGCGGT CGTCACCTTC 1100
GACGATGCCA AGACCAGCGT GCAGAAGCTG ACCAAGGCAA CCGCAGACGC GGGCTATCCG TCCAGCGTCA AGCAGTGAGT CACTGAAAAC GGCACCGCAG 1200
CACAACGGAC GTCATTGTCT GGCGCCACAA ACGATAAAGG ATCTGTTGCA TGACCCATCT AAAAATCACC GGCATGACTT GCGACTCGTG CGCGGCGCAC 1300
GTCAAGGAAG CGCTGGAAAA AGTGCCAGGC GTGCAGTCGG CGCTGGTGTC CTATCCGAAG GGCACAGCGC AACTCGCCAT CGTGCCGGGC ACATCGCCGG 1400
ACGCGCTGAC TGCCGCCGTG GCCGGACTGG GCTACAAGGC AACGCTAGCC GATGCGCCAC TGGCGGACAA CCGCGTCGGA CTGCTCGACA AGGTGCGGGG 1500
ATGGATGGCC GCCGCCGAAA AGCACAGTGG CAACGAGCCC CCGGTGCAGG TAGCGGTCAT TGGCAGCGGT GGAGCCGCGA TGGCGGCGGC GCTGAAGGCC 1600
GTCGAGCAAG GCGCGCAGGT CACGCTGATC GAGCGCGGCA CCATCGGCGG CACCTGCGTC AATGTCGGCT GTGTGCCGTC CAAGATCATG ATCCGCGCCG 1700
CCCACATCGC CCATCTGCGC CGGGAAAGCC CGTTCGATGG CGGTATTGCG GCAACTGTGC CTACGATTGA CCGCAGTAAG CTGCTGGCCC AGCAGCAGGC 1800
CCGCGTCGAC GAACTGCGGC ACGCCAAGTA CGAAGGCATC CTGGGCGGTA ATCCGGCCAT CACCGTTGTG CACGGTGAGG CGCGCTTCAA GGACGACCAG 1900
AGCCTTACCG TCCGTTTGAA CGAGGGTGGC GAGCGCGTCG TGATGTTCGA CCGCTGCCTG GTCGCCACGG GTGCCAGCCC GGCGGTCCCG CCGATTCCGG 2000
GCTTGAAAGA GTCACCCTAC TGGACTTCCA CCGAGGCCCT GGCGAGCGAC ACCATTCCCG AACGCCTTGC CGTAATCGGC TCGTCGGTGG TGGCGCTGGA 2100
GCTGGCGCAA GCCTTTGCCC GGCTGGGCAG CAAGGTCACG GTCCTGGCGC GCAATACCTT GTTCTTCCGT GAAGACCCGG CCATCGGCGA GGCGGTGACA 2200
GCCGCTTTCC GTGCCGAGGG CATCGAGGTG CTGGAGCACA CGCAAGCCAG CCAGGTCGCC CATATGGACG GTGAATTCGT GCTGACCACC ACGCACGGTG 2300
AATTGCGCGC CGACAAACTG CTGGTTGCCA CCGGTCGGAC ACCGAACACG CGCAGCCTCG CGCTGGACGC AGCGGGGGTC ACTGTCAATG CGCAAGGTGC 2400
CATCGTCATC GACCAAGGCA TGCGCACGAG CAACCCGAAC ATCTACGCGG CCGGCGACTG CACCGACCAG CCGCAGTTCG TCTATGTGGC GGCAGCGGCC 2500
GGCACCCGTG CCGCGATCAA CATGACCGGC GGCGATGCGG CGCTCGACCT GACCGCAATG CCGGCCGTGG TGTTCACCGA TCCGCAAGTG GCGACCGTGG 2600
GCTACAGCGA GGCGGAAGCC CACCACGACG GGATCGAGAC CGACAGCCGC ACCTTGACCT TGGACAACGT GCCGCGTGCG CTCGCCAACT TCGACACACG 2700
CGGCTTCATC AAGTTGGTTA TCGAGGAAGG CAGCCATCGG CTGATCGGCG TACAGGCGGT CGCGCCGGAA GCGGGTGAAC TGATCCAGAC GGCGGCTCTG 2800
GCCATTCGCA ACCGCATGAC GGTGCAGGAA CTGGCCGACC AGTTGTTCCC CTACCTGACG ATGGTCGAGG GGTTGAAGCT CGCGGCGCAG ACCTTCAACA 2900
AGGATGTGAA GCAGCTTTCC TGCTGCGCCG GGTGAGAAAA AGGAGGTGTT CAATGAACGC CTACACGGTG TCCCGGCTGG CTCTTGATGC CGGGGTGAGC 3000
GTGCATATCG TGCGCGACTA CCTGCTGCGC GGATTGCTGC GCCCGGTGGC GTGCACACCA GGCGGCTACG GCTTGTTCGA TGACGCCGCC TTGCAACGGC 3100
TGTGCTTCGT GCGGGCGGCC TTCGAGGCGG GCATCGGCCT CGACGCGCTG GCGCGGCTGT GCCGGGCGCT GGATGCGGCG GACGGCGACG AAGCGGCCGC 3200
GCAGCTTGCC CTGCTGCGTC AGTTCGTCGA GCGTCGGCGC GAAGCGTTGG CCGATCTGGA AGTGCAGTTG GCCACCCTGC CGACCGAGCC GGCACAGCAC 3300
GCGGAGAGTC TGCCATGAAC AACCCCGAGC GCTTGCCGTC CGAGACGCAC AAACCGATCA CCGGCTACCT GTGGGGCGGA CTGGCTGTGC TGACTTGCCC 3400
CTGCCACCTG CCCATCCTCG CTGTCGTGCT GGCCGGCACA ACCGCCGGTG CTTTCCTCGG CGAGCATTGG GTCATCGCGG CGCTCGGTTT GACCGGCCTG 3500
TTCCTTCTGT CCCTGTCGCG GGCGTTGCGG GCATTCAGGG AAAGAGAATG AGCGCTTTCC GGCCGGATGG ATGGACGACG CCGGAACTGG CCCAAGCGGT 3600
CGAGCGCGGG CAGCTTGAAC TGCACTACCA GCCCGTCGTC GATCTGCGCA GTGGTGGGAT TGTCGGCGCG GAAGCCCTGT TGCGCTGGCG TCATCCGACG 3700
CTTGGACTAT TGCCACCGGG CCAGTTCCTG CCCGTGGTCG AATCGTCCGG CCTGATGCCT GAAATCGGCG CTTGGGTGCT GGGCGAAGCC TGCCGCCAGA 3800
TGCGTGACTG GCGAATGCTG GCATGGCGAC CGTTCCGGCT GGCCGTCAAT GTTTCGGCGA GCCAAGTGGG ACCGGACTTC GACGGGTGGG TAAAGGGCGT 3900
GCTGGCTGAT GCCGAGTTGC CCGCCGAGTA TCTCGAAATC GAGCTGACCG AATCGGTCGC GTTTGGTGAT CCGGCGATCT TCCCCGCCCT GGACGCCTTG 4000
CGGCAGATCG GTGTGCGCTT CGCCGCCGAT GACTTCGGGA CGGGGTATTC CTGTCTGCAA CATCTGAAGT GCTGCCCAAT CAGCACGCTC AAGATCGACC 4100
AATCGTTTGT CGCCGGGCTC GCCAACGACC GCCGCGACCA AACCATCGTG CACACCGTGA TTCAGCTTGC GCACGGGCTG GGCATGGATG TGGTGGCTGA 4200
AGGCGTGGAA ACATCGGCGA GTCTTGATCT ATTGCGACAA GCGGACTGCG ACACAGGACA AGGCTTCCTG TTCGCGAAGC CAATGCCGGC GGCGGCATTC 4300
GCCGTCTTCG TCAGTCAATG GAGGGGTGCC ACCATGAATG CAAGTGACTC GACCACCACC AGTTGCTGCG TGTGCTGCAA GGAAATCCCG CTCGATGCCG 4400
CCTTCACCCC GGAAGGCGCG GAATACGTCG AGCACTTCTG CGGGTTGGAG TGTTATCAAC GCTTCGAAGC GCGTGCCAAG ACAGGGAACG AAACCGATGC 4500
CGATCCGAAC GCCTGCGACT CGCTACCGTC AGATTGAGGC ATACCCTAAC TTGGCGTCAG ACCATCCGGC GCTAAATCGT CAGAATAGAG TTGCCTTCCG 4600
AATTGATTGA CATACGCCGT CAAGGGTCAT AGATTTCTTC CTGACACATT TCCCTCAGGA GGATACCTTG CACGGTCAGC GCATCGGTTA CGTCCGCGTC 4700
AGCAGCTTCG ACCAGAACCC AGAACGGCAG CTCGAACAGA TCCAGGTGGA TAAAGTGTTC ACCGACAAGG CGTCGGGCAA GGACACACGG CGGCCCGAAC 4800
TGGAACGGCT GCTCGCCTTC GTGCGCGAAG GCGACACGGT CGTGGTGCAC AGCATGGATC GTCTGGCGCG CAACCTCGAC GACCTGCGCC GCCTGGTGCA 4900
GGGCCTCACC CAGCGCGGCG TACGCATCGA GTTCCTTAAG GAGCATTTGA CCTTCACCGG CGAGGACTCG CCGATGGCGA ACCTGATGCT GTCGGTAATG 5000
GGCGCGTTCG CCGAGTTCGA ACGCGCCTTG ATCCGCGAGC GGCAGCGCGA GGGCATCGCG CTCGCCAAGC AGCGCGGGGC CTACCGTGGC AGGAAGAAAT 5100
CCCTGTCGTC TGAGCGTATT GCCGAACTGC GCCAACGTGT CGAGGCTGGC GAGCAAAAGA CCAAGCTGGC TCGTGAATTC GGAATCAGTC GCGAAACCCT 5200
GTATCAATAC TTGAGAACGG ATCAGTAAAT ATGCCACGTC GTTCAATCCT GTCCGCCGCC GAGCGCGAAA GCCTGCTGGC GTTGCCGGAC ACCAAGGATG 5300
AGTTGATCCG TCACTACACG TTCAGCGAAA CCGACCTCTC CATCATCCGG CAGCGGCGCG GCCCGGCCAA CCGGCTGGGC TTCGCCGTGC AGCTCTGTTA 5400
CCTGCGCTTT CCTGGTGTCA TCCTGGGCGT CGATGAGCCG CCGTTTCCGC CCTTGTTGAA ACTGGTCGCC GACCAGCTCA AGGTCAGCGT CGAAAGCTGG 5500
GACGAATACG GGCAGCGGGA GCAGACCCGG CGCGAGCACC TGGTCGAACT GCAAACGGTG TTCGGCTTCC AGCCCTTTAC CATGGGCCAC TACCGGCAGG 5600
CCGTCCAGTT GCTGACCGAG ATGGCCTTGC AGACCGACAA GGGCATCGTG CTGGCCAGCA CCTTGATCGA GCACCTGCGG CAGCAGTCGG TCATTCTGCC 5700
TGCCCTCAAC GCCGTCGAGC GGGCGAGCGC CGAAGCAATC ACCCGCGCCA ACCGGCGCAT CTACGATGCC TTGGCCGAAC CGCTGTCGGA CGCGCATCGC 5800
CGCCGCCTCG ACGATCTGCT CAAGCGTCGG GACAACGGCA AAACGACCTG GCTGGCCTGG CTGCGCCAAT CGCCCGTCAA ACCGAATTCG CGGCACATGC 5900
TGGAACACAT CGAACGCCTC AAAGCGTGGC AGGCGCTCGA CCTGCCTTCT GGCATCGAGC GGTCGGTGCA CCAGAACCGC CTGCTCAAGA TCGCCCGTGA 6000
GGGTGGCCAG ATGACGCCCG CCGACCTGGC CAAGTTCGAG GCGCAGCGAC GCTATGCCAC CCTGGTGGCG CTTGCCATCG AGGGCATGGC CACCGTCACC 6100
GACGAAATCA TCGACCTGCA CGACCGCATC CTGGGCAAGC TGTTCAACGC CGCCAAGAAC AAGCATCAGC AGCAATTCCA GGCGTCCGGC AAGGCGATCA 6200
ACGCCAAGGT GCGGCTGTTC GGCCGCATCG GCCAGGCGCT GATCGAGGCC AAGCAGGCGG GCCGCGATCC GTTCGCCGCC ATCGAGGCCG TCATGTCCTG 6300
GGATGCCTTC GCCGAGAGCG TCACCGAAGC GCAGAAGCTT GCGCAGCCCG AGGACTTCGA TTTCCTGCAC CGCATCGGCG AAAGCTACGC CACGCTGCGC 6400
CGCTACGCGC CGGAATTCCT TGCCGTGCTC AAGCTGCGGG CCGCTCCCGC CGCGAAGGAC GTGCTCGACG CCATCGAGGT GCTGCGCGGC ATGAACAGCG 6500
ACAACGCCCG CAAGGTGCCC GCCGACGCGC CGACCGAGTT CATCAAGCCG CGCTGGCAGA AGCTGGTCAT GACCGACACC GGCATCGACC GGCGCTACTA 6600
CGAACTGTGC GCGCTGTCGG AGATGAAGAA CGCGTTGCGT TCCGGCGACA TCTGGGTGCA GGGGTCGCGC CAGTTCAAGG ACTTCGAGGA CTACCTGGTG 6700
CCGCCCGCGA AATTCGCCAG CCTCAAGCAG GCCAGCGAAT TGCCGCTGGC CGTGGCCACC GACTGCAACC GGTACCTGAA CGACCGGCTG ACGCTGCTGG 6800
AAACACAGCT TGCCACCGTC AACCGTATGG CGACGGCCAA CGAGCTGCCG GACGCCATCA TCACCGAGTC AGGCTTGAAG ATCACGCCGC TCGACGCGGC 6900
GGTACCCGAC ACCGCCCAAG CGCTGATCGA CCAGACGGCA ATGATCCTGC CGCACGTCAA GATCACCGAA CTGCTGCTGG AGGTGGACGA ATGGACGGGC 7000
TTCACTCGGC ATTTCGCGCA TCTGAAATCG GGCGACCCGG CCAAAGACAA GAACCTGTTG CTGACCACGA TCCTCGCCGA CGCGATCAAC CTGGGCCTGA 7100
CCAAGATGGC GGAGTCTTGC CCCGGCACGA CCTACGCCAA GCTGGCTTGG CTGCAAGCCT GGCACATCCG CGACGAAACC TACGGGGCGG CGCTGGCCGA 7200
TCTGGTCAAC GCACAGTTCC GCCATCCCTT CGCCGAGCAC TGGGGCGACG GCACCACCTC ATCGTCGGAC GGCCAGAACT TCCGCACCGG CAGCAAGGCC 7300
GAGAGCACCG GCCACATCAA CCCGAAATAC GGGAGCAGCC CAGGGCGGAC GTTCTACACC CACATTTCTG ACCAGTACGC GCCATTTCAC ACCAAGGTCG 7400
TGAACGTCGG CGTGCGCGAT TCGACCTACG TGCTCGACGG CCTGCTGTAC CACGAGTCCG ACTTGCGGAT CGAGGAGCAT TACACCGACA CGGCGGGCTT 7500
CACCGATCAC GTCTTCGCCC TGATGCACCT CCTGGGCTTC CGCTTCGCGC CGCGCATCCG CGACCTGGGC GACACCAAGC TCTACATCCC GAAGGGCGAC 7600
GCCGCCTATG ACGCGCTGAA ACCCATGATC GGCGGCACGC TCAACATCAA GCACGTCCGC GCCCATTGGG ACGAAATCCT GCGGCTGGCC ACCTCGATCA 7700
AGCAGGGCAC GGTGACGGCC TCCCTGATGC TCCGAAAGCT CGGCAGCTAC CCACGCCAGA ACGGCCTGGC CGTGGCGCTC CGCGAGCTGG GCCGCATCGA 7800
GCGCACGCTG TTCATCCTGG ACTGGCTGCA AAGCGTGGAA CTGCGCCGCC GCGTGCATGC CGGCCTGAAC AAGGGCGAGG CGCGCAATGC GCTGGCCAGG 7900
GCAGTGTTTT TCAACCGCCT GGGTGAAATC CGCGACCGCA GTTTCGAGCA GCAGCGCTAC CGGGCTAGCG GCCTCAATCT GGTAACGGCT GCCGTCGTGT 8000
TGTGGAACAC GGTCTATCTG GAACGGGCTG CGCACGCGCT GCGTGGCAAC GGCCATGCCG TTGATGACGC GCTGTTGCAG TACCTGTCGC CGCTCGGTTG 8100
GGAGCACATC AACCTCACCG GCGATTACCT CTGGCGCAGC AGCGCCAAGA TCGGCGCGGG CAAGTTCAGG CCGCTACGAC CGCTGCAACC GGCTTAGCGT 8200
GCTTTATTTT CCGTTTTCTG AGGCGACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res_site_I 4522-4558 37 GCTACCGTCA GATTGAGGCA TACCCTAACT TGGCGTC
res 4574-4650 77 AAATCGTCAG AATAGAGTTG CCTTCCGAAT TGATTGACAT ACGCCGTCAA GGGTCATAGA
TTTCTTCCTG ACACATT
res_site_II 4574-4616 43 AAATCGTCAG AATAGAGTTG CCTTCCGAAT TGATTGACAT ACG
res_site_III 4621-4650 30 CAAGGGTCAT AGATTTCTTC CTGACACATT

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn6346 34-468 Passenger Gene Heavy Metal Resistance -
merT Tn6346 540-890 Passenger Gene Heavy Metal Resistance +
merP Tn6346 903-1178 Passenger Gene Heavy Metal Resistance +
merA Tn6346 1250-2935 Passenger Gene Heavy Metal Resistance +
merD Tn6346 2953-3318 Passenger Gene Heavy Metal Resistance +
merE Tn6346 3315-3551 Passenger Gene Heavy Metal Resistance +
urfM Tn6346 3548-4537 Passenger Gene Other +
tnpR Tn6346 4746-5228 Accessory Gene Resolvase +
tnpA Tn6346 5231-8197 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn6346 435 34-468 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLLEPDKPY GSIRRYGEAD VTRVRFVKSA QRLGFSLDEI AELLRLEDGT HCEEASSLAE HKLKDVREKM
ADLARMEAVL SELVCACHAR RGNVSCPLIA SLQGGASLAG SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn6346 351 540-890 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPKTGRGA LFTGGLAAIL ASACCLGPLV LIALGFSGAW IGNLAVLDPY RPIFIGVALV ALFFAWRRIY RQAAACKPGE VCAIPQVRAT YKLIFWIVAA
LVLVALGFPY VMPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn6346 276 903-1178 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFASLAL AAVVAPVWAA TQTVTLSVPG MTCSACPITV KKAISKVEGV SKVDVTFETR QAVVTFDDAK TSVQKLTKAT ADAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn6346 1686 1250-2935 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MTHLKITGMT CDSCAAHVKE ALEKVPGVQS ALVSYPKGTA QLAIVPGTSP DALTAAVAGL GYKATLADAP LADNRVGLLD KVRGWMAAAE KHSGNEPPVQ
VAVIGSGGAA MAAALKAVEQ GAQVTLIERG TIGGTCVNVG CVPSKIMIRA AHIAHLRRES PFDGGIAATV PTIDRSKLLA QQQARVDELR HAKYEGILGG
NPAITVVHGE ARFKDDQSLT VRLNEGGERV VMFDRCLVAT GASPAVPPIP GLKESPYWTS TEALASDTIP ERLAVIGSSV VALELAQAFA RLGSKVTVLA
RNTLFFREDP AIGEAVTAAF RAEGIEVLEH TQASQVAHMD GEFVLTTTHG ELRADKLLVA TGRTPNTRSL ALDAAGVTVN AQGAIVIDQG MRTSNPNIYA
AGDCTDQPQF VYVAAAAGTR AAINMTGGDA ALDLTAMPAV VFTDPQVATV GYSEAEAHHD GIETDSRTLT LDNVPRALAN FDTRGFIKLV IEEGSHRLIG
VQAVAPEAGE LIQTAALAIR NRMTVQELAD QLFPYLTMVE GLKLAAQTFN KDVKQLSCCA G

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn6346 366 2953-3318 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MNAYTVSRLA LDAGVSVHIV RDYLLRGLLR PVACTPGGYG LFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGDE AAAQLALLRQ FVERRREALA
DLEVQLATLP TEPAQHAESL P

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn6346 237 3315-3551 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MNNPERLPSE THKPITGYLW GGLAVLTCPC HLPILAVVLA GTTAGAFLGE HWVIAALGLT GLFLLSLSRA LRAFRERE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM UrfM Tn6346 990 3548-4537 +
Class:   Passenger Gene
Sub Class:   Other
Function:   possible diguanylate phosphodiesterase
Sequence Family:  EAL (Pfam:PF00563)||DUF3330 (Pfam:PF11809)
Comment:   similar to urfM from E.coli
Protein Sequence:  
MSAFRPDGWT TPELAQAVER GQLELHYQPV VDLRSGGIVG AEALLRWRHP TLGLLPPGQF LPVVESSGLM PEIGAWVLGE ACRQMRDWRM LAWRPFRLAV
NVSASQVGPD FDGWVKGVLA DAELPAEYLE IELTESVAFG DPAIFPALDA LRQIGVRFAA DDFGTGYSCL QHLKCCPIST LKIDQSFVAG LANDRRDQTI
VHTVIQLAHG LGMDVVAEGV ETSASLDLLR QADCDTGQGF LFAKPMPAAA FAVFVSQWRG ATMNASDSTT TSCCVCCKEI PLDAAFTPEG AEYVEHFCGL
ECYQRFEARA KTGNETDADP NACDSLPSD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn6346 483 4746-5228 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
VDKVFTDKAS GKDTRRPELE RLLAFVREGD TVVVHSMDRL ARNLDDLRRL VQGLTQRGVR IEFLKEHLTF TGEDSPMANL MLSVMGAFAE FERALIRERQ
REGIALAKQR GAYRGRKKSL SSERIAELRQ RVEAGEQKTK LAREFGISRE TLYQYLRTDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn6346 2967 5231-8197 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRSILSAA ERESLLALPD TKDELIRHYT FSETDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEP PFPPLLKLVA DQLKVSVESW DEYGQREQTR
REHLVELQTV FGFQPFTMGH YRQAVQLLTE MALQTDKGIV LASTLIEHLR QQSVILPALN AVERASAEAI TRANRRIYDA LAEPLSDAHR RRLDDLLKRR
DNGKTTWLAW LRQSPVKPNS RHMLEHIERL KAWQALDLPS GIERSVHQNR LLKIAREGGQ MTPADLAKFE AQRRYATLVA LAIEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLF GRIGQALIEA KQAGRDPFAA IEAVMSWDAF AESVTEAQKL AQPEDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKD VLDAIEVLRG MNSDNARKVP ADAPTEFIKP RWQKLVMTDT GIDRRYYELC ALSEMKNALR SGDIWVQGSR QFKDFEDYLV PPAKFASLKQ
ASELPLAVAT DCNRYLNDRL TLLETQLATV NRMATANELP DAIITESGLK ITPLDAAVPD TAQALIDQTA MILPHVKITE LLLEVDEWTG FTRHFAHLKS
GDPAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHIRDET YGAALADLVN AQFRHPFAEH WGDGTTSSSD GQNFRTGSKA ESTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AVVLWNTVYL ERAAHALRGN GHAVDDALLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
repeat i4 Tn6346 10-28 TCAGAAAACG GAAAATAAA
IRR Tn4380 8193-8230 GAATCGCACG AAATAAAAGG CAAAAGACTC CGCTGGGG

 References