Transposon
Name: Tn6138
Family: Tn3        Group: Tn163
Evidence of Transposition: no
 Host     

Host Organism:Sphingobium japonicum UT26 Molecular Source:plasmid pCHQ1
Place of Origin:Japan Date of Isolation:2011
Other Geographic Information:upland experimental field treated with gamma-HCH

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 45 bp)GGGGTGACTACACGAAAGTGACGTATCTGCACGCTAAGAGCGAAC
IRR (Length: 45 bp)GGGGTGACTACACGAAAGTGACGCATCCGCACGCTAAGCGCGAAC

 Sequence     
DNA SequenceLength  4615 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
TGGGGTGACT ACACGAAAGT GACGTATCTG CACGCTAAGA GCGAACAAAT CCGGTACAAT GCCAGCAGAG GCTACCTGTA GGTACTCAAC GGCGTGTTCA 100
ACCTATCCTT TGAGCATGTG TCGATCATTG CGGGCGCCGA TATGGGAGTG CCGCAAGCCG GCTCACCAAC GATCGAGGTA GAGCCCTGCT CGCCAAGTAT 200
GTGAGTCGGT TGCCCATCCC CGGTATGGCG AAGGATCGCC GATGAACCAG AGCGTCGACG GCAAGGGTCG CGCAGCGATC AACGTTCATC AAGCCCAACT 300
TTCCCCACTT CAAATCGCTG AGGGCAGCCA TGTCGGTGTC AATGCCACCG GGTGCAAAAG ACCCAACGCT CACACCCGTC CCGGCAAGCT CGATGGAAAG 400
TGCCCGCATG AGGGTACTCA CATAGGCCTT CGACGCGCCG TAGACCGCTT GGAAGGGTAC GGATGTTTCG CCCGCCAGGC TCGACACTGC GATTATTGAG 500
GATTCAAACG GCTGCTGCCG GAAGATCGCA ATCAGGCGGG CCAGCAAATC CGTGAAGCCG GCTACGTTTG TTCCAATCAC CTCGGCATAG GCGTCGGCAC 600
GGCTAGCATC AAACGGACCG GCGCTCGTCA GCCCGGCAGC CAAGAAAGCC GCATTGACTT TCAATTCTAT AACCTTGGCC GCAATCTTCT CCCTGCCCTC 700
AATTTCACGT TGATCGGCCA CTATGATCTC GCACGGGACA TTAAACCGCT CGCCAATTTC GGATTGTAGC TCCCGCAAGT TGTCGAGCCT TCGCCCAACA 800
ATCAGGGGCT TGGCCTGGTA CGATGCCGCC AAACGGAGGG CTGACGCCCT GCCCAAACCG GTTGAGGCCC CTGTAACCAG CACCCACGAG TTCTGGATCG 900
GCAGCGGTTT CATGCGCTTT CCAGAGCCTT GTACAGGGCG GTTTTCCCGA TCTTGAGCCG AGCCGCCGCC TCACGAACAG TTAGGCCCGC TGCGATGTGC 1000
GCCCGCGCCT TGCGCAGCTT GTCGGGAGTG ACGACAGGGC GGCGACCGCC CTGACTACCG CGCTCGCGCG CGGCTCGCAG GCCAGCATGG GTGCGTTCCC 1100
GGATCAGATC GCGCTCGAAT TGGGCAAGCG AGCCGAAGAT GTTGAATACC AGCATCCCGC CTGACGTGGT GGTATCGATC TGCTCGGTGA GCGAGCGGAA 1200
ACCCACGCCG CGCGCCGCCA GCTCGCCGAC TTTCTCGATC AGGTGGCTCA TCGAACGCCC AAGACGATCG AGTTTCCAGA CCACCAGCGT GTCGCCGGTA 1300
CGCAGATAGG TGAGCGCCTC GGCCAGGCCG GGCCGATCGG CTTTTGCTCC AGATGCATAA TCGTCGAATA TGCGATCGCA ACCGGCAGCG CTCAACGCGT 1400
CGAGCTGGAG CGCCAGCTTC TGGTCTGCGG TCGAGACGCG CGCATAGCCG ATCAGCGCCA CATGCTGCCC GATCGTGTCC GTTTTCCCAT CATTTTGCGA 1500
TCTTGTCCGA ATCGCCATCA CAGGTCCAGA GTTGACGGAC ATATTCATCC TGGCCGCCAG AGGACCGTCT GACGGACAAG GACGCGGAAG GAGATAGTGC 1600
TTGGCGAGAC GGCGACTGGT GAGCGCGGAA ATCTGGGCAG GGCATTATGG CGCGCCGCTC GATGAGCGCG AGATTGCGCG GCACTATACG CTGACCGGTG 1700
ACGACCTGGA AATTGTCGGC CGCCGTCGCG GCGATGCCAC CCGGCTCGGC TACGCGATGC TCCTACTCTA TATGAGATGG CCTGGCCGTG CGCTGGAAGC 1800
GGGTGAAGTC CCGCCCGCTC CTGTGCTCGC CTATGTGGCG CAGCAACTCG GCGTCGCGCC CGAAGCCTTC GCGGACTATG CCCATCGGGA CCAGACCCGT 1900
CGCGAACATC TCGTTGAAAT CCGACGATCG CACGGGTTCA GGATTTTCGA CCGCAAGGCT TTCCACGAAG TTGTCGCATT CTCGATCCCG ATCGCACAGA 2000
CCATCGTCCA CCCCGGCCAG ATGGCGGGGG TCATCGTTGA CGAACTTCGG CGCCGGCAGA TCCTCCTGCC TTCTTCATCG GTTCTCGAAG CGGTACTCCG 2100
GCGTGCTCGC CAGCAGGCCG AACAGCTTAC CTATGAAGTG CTCACGAACG GCCTGCGGCC CGATACGCTG CAGGGGCTGG ACGATCTGCT GGCCCGACGA 2200
ACAGGGCAAG CCGCGACATG GCTATCCTGG CTGCGCAATG CACCACAGTC GCCGGCAGCG CGCAACATCC TACGCCTGAT CGAACGGCTC ACTCATATCC 2300
GCGCGCTGGA TCTCGATCGC GCCCGTGCCG ACATGATCCC GGCTTTGACT TTTGACAGGC TGGCGGACGA AGGCAGCCGG ATCACACCCC AGCACCTTGG 2400
CGAACTCAAT GCCCTGCGCC GCCATGCGAC GCTGGCGGCG CAGGGCATCC GTCTTGAGGA AAGCCTGACC GATGCCACCC TGACGATGTT CGACAAGCTG 2500
TTGGGCAGCA TGTCGCGTCG CGCCGAGAAC CGGACCCGTG ACAAAGCCCT CAAGACGGTG CGCGAGTTGC AAGGCCATCT CCGGACGCTC ACAGGGTCTT 2600
GCCGCATTCT CATCGAAGCG CGCACCAACG GTGTGGACTC TCTGGCGCAG ATCGAGGCGC TGGATTGGCA GCGCTTCGCC GTGGCGGTCG CGCGGGCCGA 2700
AGTACTCGGG CGACCGGAAA CCGTCGATCG CACCGCTGAA TTGATCGAGC GGCATCGCAC GGTGAAGCTC TTTGCCGGTG CCTTTCTCAA CACCTTCGAA 2800
TTTCGCGGCG CCGGTGCGGT GCAGGGACTC CTGTCGGCGC TTACCATCAT CGCGGAGCTA TACCGGACCG GCAAACGGCG CTTGCCTGAT CGCGTGCCGC 2900
TGCGCTTTGT GCCCTCCGCA TGGCGGCCGT TCGTCCTGCG GGACGGCATC GTCGATCGCG CCGCCTATGA ACTATGCGCC TTGTCCCAGC TACGGGAGCG 3000
GTTGCGAGCG GGAGACATAT GGGTCTCGGG AAGCCGCCAG TTCCGCGATT TCGATAGCTA CCTCATCCCG CCGGCCACCT TCGACGCGCT TCGCGAGAAG 3100
GGGCCGTTGC CGCTCGCCAT CGAAACGGAC TTCGATCGTC ATATCGAGGA AAGGCGCGCC AGGCTCGACA CGGCGATCGA ACAGGTGACG GTCCTCGCCC 3200
GACAGGGCGA GCTGCCCCAG GTCAGGCTTG ACGAAAGCGG CCTTATCATC TCGCCGCTGA AAGCGGCAAC GCCACCCGCC ACCGAGATTG CCCGTCGCGC 3300
TGCCTATGAC CGACTGCCGC GCGTGAAGAT CACCGATCTC CTGCTTGAGG TCGATGCCTG GACCGGGTTC AGCGAATGCT TCATCCATCG GCGTTCGGGC 3400
CGGGAGGCCG ACGACCGCAA TGCGCTGCTC ACCGTCATCC TTGCCGATGG CATCAATCTC GGCCTCACAC GCATGGCGGA AACCTGCCGA GGCGCAAGCC 3500
TGCGCCAGCT CGCCCATCTC CACGACTGGC ACATCAGCGA GGCCGCCTAT GGTGAAGCGC TGGGAAGGCT GATCGACGCC CATCGCGCCA TGCCGCTCGC 3600
CGCGCTGTGG GGAGACGGCA CCACCTCGTC GAGCGACGGA CAGCAATTCC ATGCCGGGGG CCGTGGCGCC GCAATCGGCG ACATCAACGC GCGCAGCGGC 3700
AACGAACCGG GCGTTGCCTT CTACACCCAT GTCTCGGATC GATATGACCC CTTCGCGACC CGGGTAATCG CGGCGACCGC CGGCGAAGCT CCCTATGTGC 3800
TGGATGGCTT GCTGTATCAG CAGACCGGCC TGACAATCGA GGAGCACTAC ACCGATACAG GCGGTGCATC GGACCATGTG TTCGGCCTTA TGCCCTTCTT 3900
CGGCTACCGC TTCGCGCCGC GCCTGCGCGA CATCAAGCAG CGTCGTTTGC ACCTCCTTCC CGGCCAGGAA GCCGGCCCCT TGCTTGCCGG CATGACGGCC 4000
GAACCGATCG CATTGGGTCA TGTCGCGGCG CATTGGGATG AACTGCTGCG GTTCGCCACA TCGATACGCA CCGGCACCGC CACCGCTTCG GCGATGCTTC 4100
GCCGCCTGTC CGCCTATCCG CGACAGAACG GACTGGCCCT CGCGATGCGC GAGCTGGGCC GCCTCGAACG CTCGATCTTC ATGCTCGACT GGCTGCGCGA 4200
CATTGATCTG CGCCGGCGTA CCCAGGCGGG CCTCAACAAG GGCGAGGCCC GCAACGCGCT CGCACGCGCG CTCTTCTTCA ACCAGCTCGG CGAATTGCGT 4300
GATCGGCGGT TCGAGAACCA GACCTATCGC GCCTCCGGCC TCAACCTGCT CGTCGCCGCC ATCATCCTGT GGAACACCCG CTATCTCGAA GTGGCGCTGG 4400
CTGATATCGG CACGCCCGAC GAAATCGCAC GTCACGTCGC GCCATTGGGC TGGGAACATA TCTCGCTCAC CGGCGACTAT AGCTGGAATG TTGAAGATCG 4500
GCCCGATCCG GATGTCCTGC GGCCACTGCG CGCCATCAGT TCGTTGCTCG CCGCGTAACG TTCACCATAC GTTCGCGCTT AGCGTGCGGA TGCGTCACTT 4600
TCGTGTAGTC ACCCCA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
sdr-family Tn6138 125-913 Passenger Gene Other -
tnpR Tn6138 910-1518 Accessory Gene Resolvase -
tnpA Tn6138 1601-4558 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
sdr-family Sdr-family Tn6138 789 125-913 -
Class:   Passenger Gene
Sub Class:   Other
Function:   oxidoreductase activity (GO:0016491)
Sequence Family:  SDR-family
Comment:   short-chain dehydrogenase
Protein Sequence:  
MKPLPIQNSW VLVTGASTGL GRASALRLAA SYQAKPLIVG RRLDNLRELQ SEIGERFNVP CEIIVADQRE IEGREKIAAK VIELKVNAAF LAAGLTSAGP
FDASRADAYA EVIGTNVAGF TDLLARLIAI FRQQPFESSI IAVSSLAGET SVPFQAVYGA SKAYVSTLMR ALSIELAGTG VSVGSFAPGG IDTDMAALSD
LKWGKLGLMN VDRCATLAVD ALVHRRSFAI PGMGNRLTYL ASRALPRSLV SRLAALPYRR PQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn6138 609 910-1518 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   recombinase activity (GO:0000150)
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   UniProt accession: D4YYA0
Protein Sequence:  
MAIRTRSQND GKTDTIGQHV ALIGYARVST ADQKLALQLD ALSAAGCDRI FDDYASGAKA DRPGLAEALT YLRTGDTLVV WKLDRLGRSM SHLIEKVGEL
AARGVGFRSL TEQIDTTTSG GMLVFNIFGS LAQFERDLIR ERTHAGLRAA RERGSQGGRR PVVTPDKLRK ARAHIAAGLT VREAAARLKI GKTALYKALE
SA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn6138 2958 1601-4558 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MARRRLVSAE IWAGHYGAPL DEREIARHYT LTGDDLEIVG RRRGDATRLG YAMLLLYMRW PGRALEAGEV PPAPVLAYVA QQLGVAPEAF ADYAHRDQTR
REHLVEIRRS HGFRIFDRKA FHEVVAFSIP IAQTIVHPGQ MAGVIVDELR RRQILLPSSS VLEAVLRRAR QQAEQLTYEV LTNGLRPDTL QGLDDLLARR
TGQAATWLSW LRNAPQSPAA RNILRLIERL THIRALDLDR ARADMIPALT FDRLADEGSR ITPQHLGELN ALRRHATLAA QGIRLEESLT DATLTMFDKL
LGSMSRRAEN RTRDKALKTV RELQGHLRTL TGSCRILIEA RTNGVDSLAQ IEALDWQRFA VAVARAEVLG RPETVDRTAE LIERHRTVKL FAGAFLNTFE
FRGAGAVQGL LSALTIIAEL YRTGKRRLPD RVPLRFVPSA WRPFVLRDGI VDRAAYELCA LSQLRERLRA GDIWVSGSRQ FRDFDSYLIP PATFDALREK
GPLPLAIETD FDRHIEERRA RLDTAIEQVT VLARQGELPQ VRLDESGLII SPLKAATPPA TEIARRAAYD RLPRVKITDL LLEVDAWTGF SECFIHRRSG
READDRNALL TVILADGINL GLTRMAETCR GASLRQLAHL HDWHISEAAY GEALGRLIDA HRAMPLAALW GDGTTSSSDG QQFHAGGRGA AIGDINARSG
NEPGVAFYTH VSDRYDPFAT RVIAATAGEA PYVLDGLLYQ QTGLTIEEHY TDTGGASDHV FGLMPFFGYR FAPRLRDIKQ RRLHLLPGQE AGPLLAGMTA
EPIALGHVAA HWDELLRFAT SIRTGTATAS AMLRRLSAYP RQNGLALAMR ELGRLERSIF MLDWLRDIDL RRRTQAGLNK GEARNALARA LFFNQLGELR
DRRFENQTYR ASGLNLLVAA IILWNTRYLE VALADIGTPD EIARHVAPLG WEHISLTGDY SWNVEDRPDP DVLRPLRAIS SLLAA

 References     

Nagata Y, Natsui S, Endo R, Ohtsubo Y, Ichikawa N, Ankai A, Oguchi A, Fukui S, Fujita N, Tsuda M. Genomic organization and genomic structural rearrangements of Sphingobium japonicum UT26, an archetypal γ-hexachlorocyclohexane-degrading bacterium. Enzyme Microb Technol. 2011 Dec 10;49(6-7):499-508. doi: 10.1016/j.enzmictec.2011.10.005. Epub 2011 Nov 7. PubMed ID: 22142724