Transposon
Name: Tn6136
Family: Tn3        Group: Tn163
Evidence of Transposition: no
 Host     

Host Organism:Sphingobium japonicum Molecular Source:plasmid pIP1202
Place of Origin:Japan Date of Isolation:2011

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 45 bp)GGGGTGACTGCACGAAAGTGACTTATCTGCACGCTAAGAGCGAAC
IRR (Length: 45 bp)GGGGTGACTACACGAAAGTGACGTATCTGCACGCTAAGGGCGAAC

 Sequence     
DNA SequenceLength  3782 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
AGGGGTGACT GCACGAAAGT GACTTATCTG CACGCTAAGA GCGAACGGAC CGGGAACGCT GGGACTTTGT GTTCTTCTCC GTGGCTTCGA GGGCTTTGTA 100
GAGGGCGGTT TTGCCGATCT TGAGGCGCGC GGCGGCCTCG CGAACTGTGA GGCCGGAAGC GATATGTTCG CGCGCCTTGC GGAGCTTGTC AGGTGTGACC 200
ACTGGCCGCC GCCCACCGGG GCGACCTCGC TCGCGAGCGG CCTTGAGGCC TGCATGGGTG CGCTCCCGGA TCAGATCGCG CTCAAACTGG GCAAGCGAGC 300
CGAAGATGTT GAACACCAGC ATCCCGCCCG AAGTGGTGGT GTCGATGTTC TCGGTGAGCG AGCGGAACCC GATACCTCGC GTCGCTAGCT CGCCGACCTT 400
CTCAATCAGA TGGCTCATCG AGCGCCCAAG ACGGTCGAGT TTCCAAACCA CCAGCGTGTC GCCGCTGCGC AGATAGGCGA GCGCCTCGGC CAGGCCGGGC 500
CGATCGGCTT TTGCACCAGA TGCGTGATCG TCGAATATCC GGTCGCACCC GGCCGCGTTC AGCGCGTCGA GCTGGAGTGA GAGCTTCTGG TCTGCCGTCG 600
AGACGCGCGC ATAGCCGATC AACGCCACAT GCAGCCCAAT CCTGTCCGTT TTCCCATCAT TATCTGATCT TGTCCGAATC GCCGTTATAG GTCCAGAGTT 700
AACGGACATA TTCCTGCTGG CCGCCAGAGG ACCGTCTGAC GGACAGGCAC AGCGAAGGAG ATGATGCTTG GCGAGGCGGC GACTGGTGAG CCTGGAAATC 800
TGGGCGGGGC ATTATGACGC GCCGCTCGAT GAGCGCGAGA TTGCACGTCA CTATACGCTG ACCAGTGACG ACCTGGAAAT TGTCGGTCGC CGTCGCGGCG 900
ATGCCACCCG GCTCGGTTTC GCGATGCTCC TGCTCACCAT GAGATGGCCT GGCCGTGCGC TGGAAGCGGG CGAAGTCCCG CCCGCCCCTG TGCTCGGTTA 1000
TGTGGCCCGC CAACTCGGCG TCGCGCCCGA CGCCTTTGCG GACTATGCTC GTCGGGATCA GACCCGCCGC GAGCATCTTG TCGAAATCCG ACGATCGCAC 1100
GGGTTCAGGA TTTTCGATCG CGACGCATTC CGCGAAGTCG TCGCCTTCTC GATCCCTATC GCACAGACCA TCATCCACCC CGGCCAGATG GCAGGCGTCA 1200
TCGTCGACGA ACTCCGGCGT CGGCAGATCC TCCTACCTTC TTCTTCGATT CTAGAAGCGG TGCTGCGGCG GGCTCGCCAG CAAGCCGAAC AGCTTACCTA 1300
TGAAGTGCTC ACAAACGGTC TGCGGCCCGA CACCCTTCAG GACCTGGACG ATTTGCTGGC CCGACGAACG GGGCAAGCCG CGACATGGCT ATCCTGGCTT 1400
CGCAATGCGT CACAATCGCC GGCAGCGCGC AACATTCTGC GCCTGATCGA ACGGCTCGCC TATGTCCGCG CACTGGGCCT CGATCGCGGG CGGGCTGACA 1500
TGATTCCGGC TTCGACTTTT GACAGGCTCG CGGACGAGGG CAGCCGCATC ACGCCCCAGC ATCTTGGCGA ACTCAATGCC CTGCGCCGAC ATGCGACGCT 1600
GGCGGCAACC GGCATCCGCC TTGAGGAAGA CCTGACCGAC GCAACCCTGA CGATGTTCGA CAAGCTGTTG GGCAGCATGG TGCGCCGCGC CGAAAACCGG 1700
ACCCGCGACA AAGCCCTCAA GACGGTGCGC GAGCTGCAGG GTCATCTCCG GACGCTCACA GGGTCTTGCC GCATCCTCAT CGACGCGCGA ACCAACGGCG 1800
TGGACTCGCT GGCGCAGATC GAGGCGCTGG ACTGGCAGCG CTTCGCCGTG TCGGTCGAGC AAGCCGAAGT GCTCAGCCGA CCGGAAACCG TCGATCGCAC 1900
CGCTGAATTG ATTGAGCGGC ATCGCACGGT AAAGCTCTTT GCCGGCGCCT TTCTCAACAC CTTCGAATTT CGCGGTGCCG GTGCGGTGCA GGGACTTCTG 2000
TCGGCGCTGG CCATTATCGC GGAGCTATAC CGGACCGGCA AACGGCGCTT GCCTGATCGC GTGCCGCTGC GCTTTGTGCC GTCCGCATGG CGGCCGTTCA 2100
TCCTGCGCGA TGGCATCGTC GACCGCGCCG CCTATGAACT ATGCGCTCTG TCGCAGCTAC GTGAGCGGCT GCGAGCGGGA GACATATGGG TCGCGGGCAG 2200
CCGCCAGTTT CGCGATTTCG ACAGCTACCT CATCCCACCG GCCACCTATG CGGCGCTTCG CGAGAAGGGA CCACTGCCGC TCGCCATCGA AACGGATTTC 2300
GAGCGCCATA TTGAGGAAAG GCGCACCAGG CTCGACACGG CCATCGAACA GGTAACGGTC CTCGCGCGAC AAGGCGAGCT GCCCCAGGTC AGGCTTGACG 2400
AAAACGGCCT CATCATCTCG CCGCTGAAGG CGGCAACGCC GCCCGCTACC GAAATTGCCC GTCGCGCAGC CTATGATCGC CTGCCACGGG TGAAGATCAC 2500
CGACCTGCTG CTTGAGGTCG ATGCTTGGAC CGGGTTCAGC GAATGCTTCA TCCACCGACG TTCGGGCCGG GAGGCCGACG ATCGCAATGC GCTTCTCACC 2600
GTCATCCTCG CCGATGGCAT CAATCTCGGC CTCACGCGCA TGGCGGAAAC CTGCCGGGGC GCAAGTCTGC GCCAGCTTGC TCACTTGCAT GACTGGCACA 2700
TCAGCGAGGC CGCCTATGGC GAGGCGCTGG GAAGGCTGAT CAACGCCCAT CGCACCATGC CGCTCGCCGC GCTGTGGGGA GACGGCACCA CCTCGTCGAG 2800
CGACGGACAG CAGTTTCATG CCGGCGGTCG TGGGGCCGCG ATCGGTGACA TCAACGCGCG CAGCGGCAAC GAACCGGGCG TCGCCTTCTA CACCCATGTC 2900
TCGGATCGAT ATGATCCCTT TGCGAGCCGG GTGATCGCGG CGACCGCAGG CGAAGCGCCC TATGTCCTGG ATGGCTTGCT GTATCACCAG ACCGGCATGA 3000
CGATCGAGGA GCACTACACC GATACGGGTG GAGCATCGGA CCATGTGTTC GGTCTCATGC CCTTCTTCGG CTACCGCTTC GCGCCGCGCT TGCGCGACAT 3100
TAAGGAGCGT CGTTTGCACC TCCTTCCCGG CCAGGAATCC GGCCCCTTGC TCGCCGGCAT GACGACCGAA CCGATCGCAT TGGGCCATGT CGCGGCGCAT 3200
TGGGACGAAC TGCTACGGTT CGCCACGTCG ATCCGCACCG GCACCGTCAC TGCTTCGGCG ATGCTGCGCC GGCTATCCGG CTATCCGCGA CAGAACGGAC 3300
TGGCCCTCGC GCTGCGCGAG CTTGGCCGCC TCGAACGCTC GATCTTCATG CTCGACTGGC TGCGCGACAT CGACCTGCGC CGGCGCACCC AGGCGGGCCT 3400
CAACAAGGGC GAAGCCCGCA ACGCGCTCGC CCGCGCGCTC TTCTTTAACC AGCTCGGCGA ATTGCGTGAT CGGCGGTTCG AAAACCAGAC TTATCGCGCC 3500
TCCGGCCTCA ACCTGCTCGT CGCCGCCATC ATCCTGTGGA ACACTCGCTA TCTCGAAATG GCGCTGGCTG ACATCGGCAC GCCCGACGAG ATCGCGCGCC 3600
ACGTCGCGCC ATTGGGCTGG GAGCATATCT CGCTGACGGG GGACTATAGC TGGAATGTCG AAGATCGGCC CGATCCGGAT GCCTTGCGGC CGCTGCGCGC 3700
CGTCAGCTCC CTGCTCGCCG CGTGAAGTTC GCTATCCGTT CGCCCTTAGC GTGCAGATAC GTCACTTTCG TGTAGTCACC CCT

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnpR Tn6136 35-628 Accessory Gene Resolvase -
tnpA Tn6136 768-3725 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn6136 594 35-628 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   recombinaseactivity (GO:0000150)
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MALIGYARVS TADQKLSLQL DALNAAGCDR IFDDHASGAK ADRPGLAEAL AYLRSGDTLV VWKLDRLGRS MSHLIEKVGE LATRGIGFRS LTENIDTTTS
GGMLVFNIFG SLAQFERDLI RERTHAGLKA ARERGRPGGR RPVVTPDKLR KAREHIASGL TVREAAARLK IGKTALYKAL EATEKNTKSQ RSRSVRS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn6136 2958 768-3725 +
Class:   Transposase
Function:   transposase activity (GO:0004803)
Transpoase Chemistry:   DDE
Comment:   uniProt accession: D4YY99 (D4YY99_SPHJU)
Protein Sequence:  
MARRRLVSLE IWAGHYDAPL DEREIARHYT LTSDDLEIVG RRRGDATRLG FAMLLLTMRW PGRALEAGEV PPAPVLGYVA RQLGVAPDAF ADYARRDQTR
REHLVEIRRS HGFRIFDRDA FREVVAFSIP IAQTIIHPGQ MAGVIVDELR RRQILLPSSS ILEAVLRRAR QQAEQLTYEV LTNGLRPDTL QDLDDLLARR
TGQAATWLSW LRNASQSPAA RNILRLIERL AYVRALGLDR GRADMIPAST FDRLADEGSR ITPQHLGELN ALRRHATLAA TGIRLEEDLT DATLTMFDKL
LGSMVRRAEN RTRDKALKTV RELQGHLRTL TGSCRILIDA RTNGVDSLAQ IEALDWQRFA VSVEQAEVLS RPETVDRTAE LIERHRTVKL FAGAFLNTFE
FRGAGAVQGL LSALAIIAEL YRTGKRRLPD RVPLRFVPSA WRPFILRDGI VDRAAYELCA LSQLRERLRA GDIWVAGSRQ FRDFDSYLIP PATYAALREK
GPLPLAIETD FERHIEERRT RLDTAIEQVT VLARQGELPQ VRLDENGLII SPLKAATPPA TEIARRAAYD RLPRVKITDL LLEVDAWTGF SECFIHRRSG
READDRNALL TVILADGINL GLTRMAETCR GASLRQLAHL HDWHISEAAY GEALGRLINA HRTMPLAALW GDGTTSSSDG QQFHAGGRGA AIGDINARSG
NEPGVAFYTH VSDRYDPFAS RVIAATAGEA PYVLDGLLYH QTGMTIEEHY TDTGGASDHV FGLMPFFGYR FAPRLRDIKE RRLHLLPGQE SGPLLAGMTT
EPIALGHVAA HWDELLRFAT SIRTGTVTAS AMLRRLSGYP RQNGLALALR ELGRLERSIF MLDWLRDIDL RRRTQAGLNK GEARNALARA LFFNQLGELR
DRRFENQTYR ASGLNLLVAA IILWNTRYLE MALADIGTPD EIARHVAPLG WEHISLTGDY SWNVEDRPDP DALRPLRAVS SLLAA

 References     

Nagata Y, Natsui S, Endo R, Ohtsubo Y, Ichikawa N, Ankai A, Oguchi A, Fukui S, Fujita N, Tsuda M. Genomic organization and genomic structural rearrangements of Sphingobium japonicum UT26, an archetypal γ-hexachlorocyclohexane-degrading bacterium. Enzyme Microb Technol. 2011 Dec 10;49(6-7):499-508. doi: 10.1016/j.enzmictec.2011.10.005. Epub 2011 Nov 7. PubMed ID: 22142724