Transposon
Name: Tn6005
Family: Tn3        Group: Tn21
Evidence of Transposition: yes
 Host     

Host Organism:Enterobacter cloacae JKB7 Molecular Source:Plasmid pUB307
Place of Origin:Australia Date of Isolation:2008

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTCGTCTCAGAATTCGGAAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  23737 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCGTCT CAGAATTCGG AAAATAAAGC ACGCTAAGGC GTAGTCACCC CGTGACTCCC CCGCGCCGAT GCAGCGAGCT TCGTTCCGTC TTGCAGTGAC 100
GCAATCAGCG GGCAGGAAAC GTTCCCTTTC CGCGCATGGC AGGCGCACAC CAGTTCAGAC AGCACGGCCT CCATGCGTGC CAAGTCGGCC ATCTTCTCGC 200
GCACATCCTT GAGCTTGTGC TCGGCCAGGC CGCTGGCTTC CTCGCAATGG GTGCCATCCT CCAGCCGCAG TAGCTCGGCG ATTTCGTCCA GGCTAAAGCC 300
CAGCCGCTGG GCCGATTTCA CGAACCGCAC TCGTGTTACA TCCGCCTCGC CATAGCGGCG AATGCTGCCA TAGGGCTTGT CTGGCTCCGG CAGCAGGCCC 400
TTGCGCTGGT AGAACCGGAT GGTCTCCACA TTGACCCCGG CCGCCTTGGC AAAAACGCCA ATGGTCAGAT TCTCAAAATT AATTTGCATA TCGCTTGACT 500
CCGTACATAA CTACGGAAGT AAGCTTAAGC TATCCAAACC AAATTTGAAA GGACAAGCGT ATGTCTGAAC CACAAAAGTC TGAACCACAA AAGTCTGAAC 600
CACAAAACGG GCGCGGCGCG CTCTTCGCCG GTGGGCTGGC CGCCATTCTT GCGTCGGCCT GCTGCCTGGG GCCGCTGGTT TTGATCGCCT TGGGGTTCAG 700
CGGGGCATGG ATCGGCAACC TGACGGTGCT GGAACCCTAT CGCCCGATCT TCATCGGCGC AGCGCTGGTC GCGCTGTTTT TCGCCTGGCG GCGCATCTAC 800
CGCCCCGCGC AAGCCTGCAA CCCGGGTGAG GTCTGCGCGA TTTCCCCAAG GTGCGAGGTA CTTACAAGCT CATTTTCTGG ATCGTGGCCG CGCTGGTCCT 900
GGTCTCGCTC GGATTTCCCT ACGTCATGCC ATTTTTCTAT TAATCACAGG AGTTCATCAT GAAAAAACTG TTTGCCGCCC TCGCCCTCGC TGCCGTTGTT 1000
GCCCCCGTGT GGGCCGCCAC CCAGACCGTC ACGCTGTCCG TGCCTGGCAT GACCTGCGCC TCTTGCCCGA TCACTGTCAA GCACGCGCTT TCCAAGGTTG 1100
AGGGCGTGAG CAAGACCGAC GTAAGTTTCG ACAAGCGCCA GGCCGTCGTC ACCTTCGACG ATGCCAAGAC CAACGTCCAG AAGTTGACCA AGGCGACCGA 1200
GGACGCGGGC TATCCGTCCA GCCTCAAACG CTGATCCGTT AACCGAACTC GGGAGCGACA CATGGGACTC ATCACGCGCA TCGCTGGCAA AACCGGCGCG 1300
CTCGGCAGCG TCGTTTCCGC GATGGGCTGC GCCGCCTGTT TTCCTGCCAT CGCCAGCTTT GGCGCGGCCA TCGGACTGGG CTTCTTGAGC CAGTACGAGG 1400
GGCTATTCAT TGGCATCCTG CTGCCGATGT TCGCCGGCAT CGCGTTACTC GCCAATGCTA TCGCTTGGCT CAATCATCGA CAGTGGCGAC GCACGGCGCT 1500
CGGCACGATA GGCCCGATCT TGGTGCTGGC AGCGGTGTTT TTAATGCGGG CTTACGGCTG GCAGAGCGGT GGACTGCTCT ATGTCGGCCT GGCCTTGATG 1600
GTTGGGGTGT CGGTCTGGGA TTTCATCTCG CCAGCACATC GCCGCTGCGG GCCGGACAGC TGTGAATTGC CAGAACAACG TGGCTGACGG CAACAGCCGT 1700
AGCCACCACA GAAAAGGAAA AATACATGAC CACCCTGAAA ATCACCGGGA TGACCTGCGA CTCGTGCGCG GCTCACGTCA AGGAAGCCTT GGAGAAAGTG 1800
CCCGGCGTGC AATCGGCGCT GGTGTCCTAT CCGAAGGGCA CAGCGCAACT CGCCATTGAG GCGGGCACGT CATCGGATGC GCTGACTACC GCCGTGGCCG 1900
GACTGGGCTA CGAGGCAACG CTTGCCGATG CGCCACCGAC GGACAACCGC GCCGGCCTGC TCGACAAGAT GCGCGGCTGG ATAGGGGCCG CTGATAAGCC 2000
CAGTGGCAAC GAACGCCCGT TGCAGGTCGT CGTCATTGGT AGCGGTGGAG CCGCGATGGC GGCAGCACTG AAGGCCGTCG AGCAAGGCGC GCAGGTCACG 2100
CTGATTGAGC GCGGCACCAT CGGCGGCACC TGCGTCAACG TCGGTTGTGT GCCGTCCAAG ATCATGATCC GCGCCGCCCA CATCGCCCAT CTGCGCCGGG 2200
AAAGCCCATT CGACGGCGGC ATGCCACCCA CACCGCCGAC GATCTTGCGC GAGCGGCTGC TGGCCCAGCA GCAGGCCCGT GTCGAAGAAC TCCGTCATGC 2300
CAAGTACGAA GGCATCCTGG ACGGCAATTC AGCCATCACC GTTCTGCACG GTGAAGCGCG TTTCAAGGAC GACCAGAGCC TTATCGTTAG TTTGAACGAG 2400
GGTGGCGAGC GCGTCGTGAT GTTCGACCGC TGCCTGGTCG CCACGGGTGC CAGCCCGGCG GTCCCGCCGA TTCCGGGCTT GAAAGAGTCA CCCTACTGGA 2500
CTTCCACCGA GGCCCTGGCG AGCGACACCA TTCCCGAACG CCTTGCCGTA ATCGGCTCGT CGGTGGTGGC GCTGGAGCTG GCGCAAGCCT TTGCCCGGCT 2600
GGGCAGCAAG GTCACGGCCC TGGCGCGCAA TACCTTGTTC TTCCGTGAAG ACCCGGCCAT CGGCGAGGCG GTGACAGCCG CTTTCCGTGC CGAGGGCATC 2700
GAGGTGCTGG AGCACACGCA AGCCAGCCAG GTCGCCCATA TGGACGGTGA ATTCGTGCTG ACCACCACGC ACGGTGAATT GCGCGCCGAC AAGCTGCTGG 2800
TCGCCACCGG CCGGACACCG AACACGCGCA GCCTGGCATT GGAAGCGGCG GGGGTAGCCG TCAATGCGCA GGGGGCCATC GTCATCGACA AGGGCATGCG 2900
CACCAGTAGC CCGAACATCT ACGCGGCCGG CGACTGCACC GACCAGCCGC AGTTCGTCTA TGTGGCGGCA GCGGCCGGCA CTCGTGCGGC GATCAACATG 3000
ACTGGCGGCG ATGCGGCCCT GGACCTGACC GCAATGCCGG CCGTGGTGTT CACCGACCCG CAGGTCGCCA CCGTGGGCTA CAGCGAGGCG GAAGCACATC 3100
ACGACGGGAT CGAGACCGAC AGTCGCCTGC TAACACTGGA TAACGTGCCG CGTGCGCTTG CCAACTTCGA CACACGCGGC TTCATCAAGC TGGTCATCGA 3200
GGAAGGTAGC GGACGGCTCA TCGGCGTGCA AGCGGTGGCC CCGGAAGCGG GTGAACTGAT CCAGACGGCG GTGCTCGCCA TTCGCAACCG TATGACCGTG 3300
CAGGAACTGG CCGACCAATT GTTCCCCTAC CTGACCATGG TCGAAGGGCT GAAGCTCGCG GCGCAGACCT TCAGCAAGGA CGTGAAGCAG CTTTCGTGCT 3400
GCGCCGGATG AGGAAAAGGA GGTGTTCAAT GAGCGCCTAC ACAGTGTCCC GGCTGGCCCT TGATGCCGGG GTGAGCGTGC ATATCGTGCG CGACTACCTG 3500
CTGCGCGGAT TGCTACGGCC GGTCGCGTAC ACCACGGGCG GCTACGGCTT GTTCGATGAC ACCGCGTTGC AACGGCTGCG CTTTGTACGG GCTGCCTTCG 3600
AAGCGGGTAT CGGCCTGGAC GCACTGGCGC GGCTGTGCCG GGCGCTGGAT GCTGCGGACG GTGACGGTGC GTCTGCGCAG CTTGCCGTGT TGCGGCAACT 3700
CGTCGAGCGT CGGCGCGAGG CCCTGGCCAG CCTCGAAATG CAACTGGCCG CCATGCCAAC CGAACCGGCA CAGCACGCGG AGAGTCTGCC ATGAACAGCC 3800
CAGAGCACTT GCCGTCTGAG ACGCACAAAC CGATCACCGG CTACTTGTGG GGCGCGCTGG CCGTGCTCAC CTGTCCCTGC CATTTGCCGA TTCTCGCCAT 3900
TGTGCTAGCC GGCACGACGG CCGGCGCGTT CATCGGGGAG CACTGGGGTA TTGCAGCCCT CACGCTGACC GGCTTGTTTG TCCTGTCTGT GACGCGGCTG 4000
CTGCGGGCCT TCAAGGGAAG ATCATGACCG CTTCCCAGCC AGCCGAGAGT GGGCAGCTTT GAGCTTCGCT ACCAATCTGG AGGAGTACCA CCATGAACGC 4100
AAACGCCCCG AACACTGCCA GTTGCACCAC CTGCTGCGTA TGCTGCAAAG AAATTCCGCT CGATGCCGCC TTCACCCCGG AAGGCGCGGA ATACGTCGAA 4200
CATTTCTGCG GGCTGGATTG CTATGAACGC TTCCAGGCAC GCGCCAAGGC CGCGACAGAA TCTGACATTG CGCCTGTCCC TGGCGGTTCG CAGCCGTCAG 4300
ATTGAGGCAT ACCCTAACTT GATGTCAGAT GCCATGTGCA AATGTCGTTT TCAGAAGACG ACCGCACCAT CTGACTGGAT GTAACGCCTG GTGTGCATAC 4400
GGCTCCTGAC AGCCCAATAT CAGGAGTCGT CTGCACCAAT CTCGACTATG CTCAATACTC GTGTGCACCA AAGCGAGGTT TGGGCATGAC ATCAGACACT 4500
CCACCGATTG CCGCGCAAGG CGTGGCCACC CTGCCCGACG AGGCATGGGC GCAAGCCCGG CACCGGACGG AAATCATCGG GCCACTGGCA GCGCTTGAGG 4600
TGGTCGGGCA TGAAGCCGCC GATGAGGCAG CCCAAGCGCT GGGCCTGTCC CGGCGACAGG TATATGTCCT GATCCGTCGC GCCCGGCAGG GTACTGGCCT 4700
GGTAACAGAC CTGACGCCCG GCCGATCCGG CGGCGGCAAA GGCAAGGGGC GCTTGCCGGA ACCGGTCGAG CGCATCATCC GCGAGCTGCT GCAAAAGCGC 4800
TTCCTGACCA AGCAGAAACG CAGCCTGGCG GCGTTCCACC GCGAAGTCGC GCAGGCGTGC AAAACCCAGA AGCTGCCGGT GCCGGCGCGC AACACCGTGG 4900
CCCAGCGGAT TGCCGGACTA CACCCGGCGA AAATAGCCCG CAGCCGGGGC GGGCAGGACG CTGCCCGTCC CTTGCAAGGC GCGGGTGGCA TTCCGCCAGA 5000
AGTCACCATG CCGCTGGAAC AGGTGCAGAT CGACCACACC GTCATCGACC TGATCGTGGT CGACGAGCGC GACCGGCAAC CGATTGGCCG CCCATATTTG 5100
ACCCTCGCCA TCGACGTGTT CACGCGCTGC GTACTCGGCA TGGTGGTCAC GCTGGAAGCG CCGTCCGCCG TCTCGGTCGG CCTATGCCTC GCGCATGCCG 5200
CCTGCGACAA GCGGCCCTGG CTGGAAGGGC TGAATGTGGA AATGGACTGG CCGATGAGCG GCAAGCCCAG GCTGCTCTAT CTGGACAACG CGGCCGAGTT 5300
CAAAAGCGAA GCGCTGCGCC GTGGCTGCGA ACAGCATGGC ATCCGGCTGG ACTATCGCCC ACCAGGCCAG CCGCACTACG GCGGCATCGT GGAACGGATC 5400
ATCGGCACGG CGATGCAGAT GATCCACGAC GAATTACCGG GGACGACCTT CTCCAATCCC GGCCAGCGCG GCGAGTACGA TTCCGAGAAG ATGGCCACCC 5500
TGACGCTGCG CGAGCTGGAG CGCTGGCTCG CGTTGGCGGT AGGCACCTAT CACGGCTCCG TGCACAACGG CCTGCTCCAG CCGCCGGCCG CGCGCTGGGC 5600
CGAGGCCGTG GAGCGCGTTG GCGTCCCGGC CGTCGTTACC CGCCCCACCG CGTTTTTGGT CGATTTCCTG CCGGTGATCC GCCGCACCCT GACCCGCACC 5700
GGCTTTGTCA TCGACCACAT CCACTACTAC GCCGACGCCC TCAAGCCGTG GATTGCCCGG CGCGAGCGCT TGCCCGCCTT CCTGATCCGG CGCGATCCGC 5800
GCGACATCAG CCGCATCTGG GTACTGGAAC CGGAAGGTCA GCACTATCTG GAGATCCACT ACCGCACCTT GTCCCATCCG GCCGTCACCC TCTGGGAACA 5900
ACGCCAGGCG CTGGCCAAAT TGCGTCAGCT CGGGCGCGAG CAGGTGGACG AGTCGGCGCT GTTCCGCATG ATCGGGCAGA TGCGCGAGAT CGTGACCACC 6000
GCCCAGAAGG CCACGCGCAA GGCGCGGCGC GACGCTGATC GCCGCCAGCA CCTCAAGACG TCGGAGCCAC CGGCCAAGCC CATACCGCCG GATGTGGACA 6100
TGGCTGACCC GCAGGCAGAC AACCTGCCGC CGGCCAAACC GTTCGATCAG ATCGAGGAGT GGTCGCCGTC GATGAATATA AGAGGACTTG CCATGGAATG 6200
CTCTCGGACA TAGGAAATCA GGAGTTCCAA TCTTCAGTGA GGGGCTAAGA TAGGAAAAGT TGAATTTCTA AACGATGAAA TTCAGCTTTT CTGAACAAGG 6300
AGTGACTCAT GCGCGAAATC AGCCTGGACC GTCTGCGCAC GTTGGTGGCC ATTGCCGACC TGGGTTCGTT TGCCGAGGCG GCCCGTGTGC TGCACCTCGC 6400
GCCACCCACG GTCAGTTTGC ATATTGCCGA CCTGGAGTCG CGGGTTGGCG GAAAGCTGTT GTCGCGCACA CGTGGGCGCA TTCAGCCTTC GGCGATTGGA 6500
GAAACGCTGG TGGAGCGCGC GCGGCGCCTG TTGGCGGATG CGGAGCAGGC GCTTGAGGAC GTGGAGCGTC AGGTGCAGGG CTTGGCCGGG CGTGTGCGGC 6600
TGGGTGCCTC CACAGGGGCC ATCGCACAGT TGATGCCGCA AGCTTTGGAG ACGTTGGGCC AACGCCATCC CGCTATCGAT GTGCAGGTCG CGGTGCTCAC 6700
GTCGCAGGAA ACTTTGAAGA AGCTTGCCGA GGGCTCTTTG GAGATCGGTC TGGTCGCGCT GCCACAGACC CCGGTGAAGG AATTGCGGAT CGAGCCATGG 6800
CGGCGGGACC CGGTCATGGC CTTCTTGCCG GCTCGCTGGG AATGCCCGGA TGTTGTGACC CCCGGTTGGC TGGCCGCCCA GCCATTAATT CTGAATGACA 6900
AAACTACTCG GCTTTCGCGC TTGACCTCGG AGTGGTTCGC CAGTGATGGA CGGCAGCCCA CGCCGCGTAT TCAACTGAAC TACAACGATG CGATCAAAAG 7000
CCTAGTGGCG GCCGGTTATG GTGCGACGTT GTTGCCGCAT GAAGCCTCCA CGCCATTGCC CGATACCAGG ATCGTCATGC GGCCATTACA GCCCTTATTG 7100
TGGCGTCAAC TTGGTATTGC CCACCGTGGT GGGGACGTCG AGCGGCCTAC GCAACATGTG CTGGATGTGT TGTGGGGGTT GAGTGCGGGC TAGGGCGATG 7200
TTGTCAGAGA AAGGACCGCT TTCGACCCGG TCATACGGTG ATTGAGGTCC CAGGCGTCAG CTACCGCACC TGAAGCCGTC GTTCATCGCT CCAAAAGCCG 7300
GTGCCTGTCT CCGTTCGCCC AGGCCAGGGT GTCGTAGTAC TTGTGCAGCA GCTCGGTAAT GGCGGCGGTG TCGTCGGTCA TGGGGTTTCC TTGGGGTTGG 7400
CGGTGAGGAC TGCCTGGACG CGTGCTTGCA GCGCGGGCAG CACGTCTTGT TGGAACCAGG GGTTGCGCAC CAGCCAGCGA TTGTTGCGCG GGCTAGGGTG 7500
AGGCAGGGGG AACGCTTGCG GCCAGTGCTC GCGCCAGGCT TCGACCACCC GGGTGAGCGG CGTCTTGCCA GTACCGAGGT GGTAGTCCAT GGCGTAGCTG 7600
CCCAGCACGA TGACCAGCGA CAGGCGCTCG AAACGCTGCA TGAAGGCTTC GCGCCAGGCG GGGGGCGCAC TCCGGGCGTA GCGGCAGGTC ACCGCTTTTG 7700
CCGGTGCCCG GATAACAGAA GCCCATGGGC AGAATGGCGA TGCGGGTAGG GTCGTAGAAG GTGTCGCGGT CCACGCCCAG CCAGGCGCGC AGACGCGCGC 7800
CGCTGGCGTC GTCGAAGGGC ACGCCTGAGG CATGGACCCG GGCCCCCGGT GCTTGGCCGG CGATGAGGAT GGGCGCACTC GGGTGAAACT GGAAGACCGG 7900
CTGCACGCCG TGTGGCAGAT GCGGTGCGCA GCGCGTGCAG GCGCGGACGT CGGTCAGAAA GGCGTCGAGT GTCGGCATGG CGCGCTTCCG GAAAGGGTGG 8000
CTCGCGCAGG ACGGAGGTGC CATCCTGCGC GAAGCGTAAC CCGGCAGCAA GTCAGTGCTG GGTCAGTGTC GGATAGCCCT GGATGAATAC GCGGTCGGTC 8100
TTGGCCGCCG GCACATGGCA GCCCATGCAG TCGGCTTCGT AGCTGACGGC GACATTCTTG GCGGGGGCGT CGGCCTTGAA CAGCGCCCAG CCCCAGCCGT 8200
CGCCCCACAA GGGGTTGCTG GCGAAACGGC CTTTGGCGTC CTTGACCATC ACGAACCACA CGGCCGCATC GGAACCCCAG ACCACAGGGT TGCCAGTGGT 8300
CATGGCGCTG GTTTCGAGCT TGCGGATCTC TTTCACCAGC GTGGCGCCGT CCAAGAACTT GCCGGTCTTG CGGTAGTGCT CGGCCGAGGC CTTTAGTCGC 8400
CGGCCGTGAC GGCCAGTGGC AGGACGAGGG CGCTGGCGAG CAGAGCGCCG GTGAGTGCGA TTTTCATCGT GTTCTCCTTA TATGCCTATG GAGATCAGAC 8500
GGCGACCACG GGGAAATCCA CCGTGGGGTC GGCGATGTGG TTGGTGTAGT TGGTGAGCGT GTTCAGCGCG ACGTTGGCGA TCACTTCCAG TATCAGGCCG 8600
TCGTCGAGCC CCGCGCGGCG GTAGTTGGCC ATGGCGTCGG CCGACACCAC GCCGCGTTGC TCGACCAGCG CGCGGGCAAA GCCGGCGATT GCATCGTCAA 8700
GTGCGTTGGC CGCCTGGCCG GTGCGGGCCG CGGCGATGGC CTCTGCCGAC AGTCCGGCAC CTTTGCCGAT CAGGGTGTGT GCGCTCAGGC AATACTGGCA 8800
GCGATTGGCT TGAGCGGCAG CGAGCGCAAC GATCTCGCGC TGGGAGGCAT TCAGGCGGCC GGTGCCCAGC GTTTCGGACA AGCCGAGGTA GCCATTGAGC 8900
GCCGCCGGCG CGTGGGCCAG CGTGGCGAAC AGGTTCGGCA CCATGCCAAG CTTGGCTTTG ACGGCCTTGA GTGTGGCAGC GGTAGCGGCG TCAGCGGTGT 9000
CGATGGTCAG GGGGGCGATT TGGGTCATGT CTATCTCCGT AGTGGGTGAG GTGCAAGAGC ACGTGGGCAT GATCGCCCTT TGTTTGGTAC GATATGGCAC 9100
GTAAAGTATC AAATACGTAA CCTATCGTCT TATATGGAGA GTGGAATGGC GGATCGACTG GCCGGCTTGC TCCGGCACTA CTCGCTTTCG GCGCGCGTTT 9200
TTCACAGCGG CGCCTTCTGT GGGCAGCATC ATTACGCGGC GCCGCATGGC TATATCCATC TGGTGCGGCG CGGCCCGATT ACGGCGCGTT CGCCCGTGCA 9300
TGAAGATCTG CTGGTTACCG AGCCGAGCCT GCTGTTTTAT CCGCGCGTGG CGTCGCATCG TTTTGTCGCC GCCCCCGGCG ATACCGCTGA GCAGTTGTGT 9400
GCGGAGGTCG ACCTGGGCGC TTCGACGGGC AATCCGTTGG CCATGGCCTT GCCGTCGATG CTGCTGATTC CGTTGGCGGA CTTGCCCGGC CTCGGGCCGA 9500
CGCTAGAGTT GCTGTTTGCC GAAGCCGAGC GCGACCAGTG CGGTCGGCAG GCCGCCATCG ACCGCTTGTG CGAGTTGCTA CTGATCCAGT TGCTGCGTTA 9600
TCTGATGGAT GGGCGGCTTG GCGCCACCGG ACTGCTGGCG GGCCTGGCCG ACCCGAAACT CGCGCGCGCC ATAACCGCCA TGCACGATGC GCCGCAGACC 9700
GCGTGGTCGC TCGAGGCGCT GGCGGCGAAG GCGGGCATGT CACGCGCGCG CTTCGCCGCC GCGTTCAAGG ACGCGGTGGG CGTCACGCCG GGCGACTATC 9800
TGGCCGACTG GCGGATGAAC GTCAGTTGCA CCCTGCTCAA GCAGGGGCGG CCGGTGGCGG TGGTGGCCGA CCGCGTCGGC TACGGCAGCC CGAACGCTCT 9900
GGCGCGCGCC TTCCGCGTGC GCATGGGCTG CGCCCCGCGC GACTGGCTGG CGCAGCAGCG CGGTGACGCG GCGCTCAGCG GTTCGTGAGT TTGAGTTCGA 10000
TTCGCCGGTT CTTGGCGTAG GCGGCGCCGG TGTTGCGCTC GTCGAGCGGG TGAAATTCGC ATCACGCCGG AACAACTGGC GGAACTCCAG GTGGCGATCC 10100
GTCAACGGCT GGTCAGTCTG TTCGTGCGGC GCGGCCGGCT GGACAAGGCT GAGTCAGTGG CGCAGGTAGC TGGATGACGC TGTCCCGCCC TGAGCCGACG 10200
CTCACAGGCG GGGATTTCCA GTGTCGTCAT TGTCGGCTAT TGGCCGGCAG CAGCCCGTCG TTGCCTGATG GATCCAACCC CTCCGCTGCT ATAGTGCAGT 10300
CGGCTTCTGA CGTTCAGTGC AGCCGTCTTC TGAAAACGAC ACCGTCATAG GTCAGGACCG ATGGAACGCC GGCGTCACCA TGATGCGGGT GGCCGATCCC 10400
CGAAGCTGGC GCGGCGTGGC CGATTCCTCG CAGCTCGTGC GCGACAATGC CGAGGCGATC GGGCAATGCG CCGAGGCCGC GCGCACGGCC GGTTCAGATC 10500
AGCAATGCAC CATCACCGTG AAAGCGCCGG CAGCACCGGC GCAGTAGGGT TGTGGGGGGA CACCAGTTAT TTCGGGAGGT TTTCTTCCGC CTCAACAGGT 10600
CCGGCGGCCA TCGCGACGAG GCGCGCCGCG ATACGCTTGC GCAGTTGCTC GGGGAGCGGG CGCGACGACA GCGCCTCGTG AATCCACAGC CCATCGGCGG 10700
CAAGGCGCGA AATGAACCTG TCCAACTCGG CAGCGTCGTT TCCAATCGGC GCAGGAGGTG CCCAGCGGTC GATGACCTGT TGCCACAGAT CGCCAAGCTG 10800
CCGATTGTCG GAGCTTTCCA GTATGAGCAG CAGTTCGACC CGCCGGGCAG CTCTTGCGCA GGTGTTGATG TAGGCGGCGT GTCGTTCGGC GTCTGTCGCC 10900
CTGTCCGAGG TGTTGCCGGC GCTCGCTTCC AGCTCCTGTT CCCATGAGCG AGTCAGATGC TCATGGGTGG CGAGGATCAG GGCTTCGCGC GACGGGAAAT 11000
GATACAGAAG GCCGGCGCGT GTCATGCCGG TTTCGAGCGC TACGGCGTCG AGGGTGACGG CGGTGAGGCC GTCACGCTCG ATGATGCTCA CAATGGCTTC 11100
AAGCACTTCG AGGCGCTTGC TGGCTCTCGC CATGTCGGCT TCCTTAGTGT TGTGTGGGAT AGGCTGACGA TTGCGAGCCG GGACCGTAGC GCCGCAACAG 11200
GATGCCGGTG ATCAGGGCAC CCACGGCCAG AACACCCGCC GCCACGTACA TGACGACCGT ATAGGCGTGG TCGAATGCGA TTCCTGCCGC TTGACGCACG 11300
ACAACACCAT CGGCCCCCGC CTCGTTGGCA AAGACCAGCG CCGACGCCAT GCTGTCGCGG GCCGCTTCCG AGGTTCCGGC GGGGAACACG ACGTTGACCG 11400
TATAGAGGTA GGCCAAAAGA CTTCCGAGAA TTGTGACAGC GAACAGACTG CCAAACTCGT AGGACACTTC CTCGACCGAC GACGCCATGC CGGCGCGATG 11500
CACAGGCACA TTGCCCACAA TAGCCGTTGA TGCCACCGAC ATTGTTGCAC CTACGCCGGC ACCGGTCAGC GCCAGACCGG CGATCAGCCA GCCAAGGCCA 11600
TGAGTGATGC CCCATGTCGC AAGCAGGACC GCCAGCGATC CCGCCGCAAG CCCGCCAGCT ATAAGGATAC GTAGGCCAAT ACGATGCAGG AATGCACCAC 11700
CGAGCAGCGC AGTCGGCAAT GATCCGAGCG CCGCCGCCGA AACCAGCATC CCGGCTTCCA GCGGCGTGAA GCCCGCAACG AGCTGGAAGC GTTGCGTCGT 11800
AGCAAGCTCA ACACCGCCGA TGGCGAACAG GGAGAACGCG GCCGCTAGAA CGCCCGATGT GAACGCGGCA TTGCGGAAGA TCGAGAAGTC GAGCAGCGGG 11900
AACGGCAGGC GCAGTTGCCG GCGGACGAAC AGCGCTCCGG CGAGGATGGC AACCAGCAGC GAAATAGCGG GGACGGCCCA CGACTGCCCG GCATGGGCAG 12000
ATTCCTTGAT CGCGATCACA AAAGCCGACA GCGCCACCAA TGCCTGAAAC GACGACACCA CGTCCCAAGG CTTGGTCGCA TCGCCGGCCA CCTTCGGCGC 12100
AACGATCAGC GCCGAAATGA AGGCAGCGAC CACTACCGGC ACATTGATGA GGAACACCGA CCCCCACCAG AAATGGCCGA GCAGAAAACC GCCGATGATC 12200
GGTCCGAGCG CAGCGCCGAC GACCGACAAC GACCCCCAGA TCGCAATGGC GATGTTGCGT TCCCGGTCAT CCTCGAAGGT GACGCGGATG AGGGCGAGTG 12300
TCGCGGGCAT CATCGCCGCC GCGCCGACCG CCAGAAAGGC CCGCGCCCCG ATCAGGATTT CCGCTGTAGG CGAATAGGCC GCCACAATCG ACGCGACACC 12400
GAACAGCACG AGGCCGATGA GGAACATGCG CCGGTGACCG ATCCTGTCAC CCAGCGTCCC GGTGCCGAGC AGCAGGCCGG CCATGACGAG GGGGTATGCG 12500
TTGATGATCC ACAACCCTTG CGTTGCCGTC GCGCCAAGCT CGCGCGTCAG GGTAGGCAGG GCCGTGTAGA GGACCGAATT GTCCAGAACG ATAAGCAGGA 12600
GACCGGCGGC GACGGTCACC AGAAGAACCC AGCGGTTCGA GTGGGCGGCA GGCATGATAG CACCATTCAG TGAGAGTAGC CAAACTTTAC AGACAAGTTA 12700
GTAAAGTATC AAGCGCCTGC CCGTGAGGAA CTTCAGACAA TGGCCGACAG CGGGGCTTCG CATTCCGGGG CGCGATCAAT TTGTCGCGAA ATTCCTAAGT 12800
TGTGCGACAG CTTGCCGCCT GTCATTTTCA GAAGACGACT GCACCAATTG ACGGGGCGTA ACGCCAGGTG TGCAGTCGGC TCCTGACCAC GCAATATCAG 12900
AAGTCATCTG CACCAATCTC GACTATGCTC AATACTCGTG TGCACCAAAG CGAGGTGTGA GCATGGCGTC AGACACATTA CCAATTGCCG AGCAGGGCGT 13000
GGCCACCCTG CCCGATGCGG CATGGGCACA GGCCCGGCAC CGGACCGAAA TCATCGGGCC GCTGGCAGCG CTTGAAGTGG TTGGGCATGA AGCCGCCGAT 13100
GCCGCTGCTC AAGCGCTGGG CCTATCCAGG CGGCAGGTGT ATGTCCTGAT CCGGCGTGCC CGGCAAGGTG CTGGGTTTGT GACGGACCTG GTTCCCGGCC 13200
AGTCCGGCGG CGGAAAAGGC AAGGGACGCT TGCCGGAATC AGTTGAGCGC ATCATCCGCG AGTTGCTGCA AAAGCGCTTC CTGACCAAGC AGAAGCGTAG 13300
CCTGGCGGCG TTCCACCGCG AGGTCGCGCA GGCTTGCAAA GCGCAAAAGC TACGGGTGCC GGCGCGCAAC ACTTTGGCCC TGCGGATCGC CGGCCTCGAC 13400
CCGCTCAAGG CCACTCGCCG CCGGGAAGGT CAGGATGCGT CCCGCAGCCT GCAAGGTGTC GGTGGTGAGC CTCCCGCCGT GACCGCGCCA CTGGAACAAG 13500
TGCAGATTGA TCACACGGTC ATCGACCTGA TCGTGGTGGA CGAGCGCGAC CGGCAACCGA TTGGCCGTCC GTATCTGACC ATCGCCATCG ACGTGTTTAC 13600
CCGCTGCGTG CTCGGCATGG TCGTCACGCT GGAAGCGCCG TCATCTGTTT CGGTCGGCCT GTGCCTTGTG CATGTCGCCT GCGACAAGCG TCCCTGGCTG 13700
GAGGGTCTGA ATATAGAAAT GGATTGGCCG ATGAGCGGCA AGCCCAGGCT GCTCTACTTG GACAACGCGG CCGAGTTCAA GAGCGAGGCG CTGCGCCGTG 13800
GCTGCGAGCA GCACGGCATC CGGTTGGACT ATCGTCCGCC AGGGCAGCCG CACTACGGCG GCATCGTGGA ACGGATCATC GGTACGGCGA TGCAGATGAT 13900
CCACGATGAA TTGCCAGGGA CGACCTTCTC CAACCCTGAC CAGCGCGGGG ACTACGATTC CGAAAACAAG GCCGCCCTGA CATTGCGTGA GCTGGAGCGC 14000
TGGCTCACGT TGGCGGTGGG CACCTATCAC GGCTCTGTGC ACAACGGCCT GCTTCAGCCG CCGGCGGCGC GCTGGTCAGA AGCCGTGGCG CGTGTCGGTG 14100
TACCGGCTGT CGTCACCCGC GCCTTGGCTT TTTTGGTCGA TTTCCTGCCC ATCATTCGCC GTACTCTGAC TCGCACCGGC TTTGTCATCG ACCACATTCA 14200
CTACTACGCC GATGCGCTCA AACCGTGGAT CGCACGACGC GACCGCTTGC CCGCTTTCCT GATCCGGCGC GACCCGCGTG ACATCAGCCG TATCTGGGTG 14300
CTGGAACCGG AGGGGCAGCA TTACCTGGAA ATCCCCTACC GTACCTTGTC GCACCCGGCT GTCACCCTCT GGGAACAACG GCAGGCGCTG ACGAAATTGC 14400
GGCAGCAGGG ACGCGAACAG GTGGATGAGT CGGCGCTGTT CCGCATGATC GGGCAGATGC GCGAGATCGT GACCACCGCA CAGAAGGCCA CGCGCAAGGC 14500
GCGGCGCGAC GCGGATCGAC GCCAGCACCT CAAGGCATCG CCTCCGCCGG ACAAGCCGAT TCCGCCGAAA ACGGACGTTG CTGATCCGCA GGCAGACAAC 14600
CTGCCTCCGG CCAAACCGTT CGACCAGATC GAGGAGTGGT AGCCGTGGAC GAATATCCCA TCATCGACTT GTCACACCTG CTGCCAGCTG CACAGGGGCT 14700
GGCTCGGCTG CCGGCGGACG AGCGCATCCA GCGCCTTCGC GCCGACCGCT GGATCGGCTA CCCGCGCGCG GTCGAGGCGC TGAACCGGCT GGAAACCCTG 14800
TATGCGTGGC CAAACAAGCA ACGCATGCCC AACCTGCTGC TGGTTGGCCC GACCAACAAC GGCAAGTCGA TGATCATCGA GAAATTCCGG CGCACGCATC 14900
CGGCCAGCTC CGACGCGGAC CAGGAACACA TGCCGGTGCT GGTCGTGCAG ATGCCGTCCG AACCGTCGGT GATCCGCTTC TACGTCGCGC TACTTGCCGC 15000
GATGGGGGCA CCATTGCGCC CGCGCCCACG GCTGCCGGAA ATGGAGCAAC TGGCGCTGGC ACTGCTGCGC AAGGTCGGCG TGCGCATGCT GGTGATCGAC 15100
GAGCTGCACA ACGTCTTGGC CGGCAACAGC GTCAACCGGC GGGAATTTCT CAACCTGCTG CGCTTCCTCG GCAATGAGCT GCGCATCCCA TTGGTCGGGG 15200
TCGGCACGCG CGACGCCTAC CTGGCCATCC GCTCGGATGA CCAATTGGAA AACCGCTTCG AGCCCATGAT GCTGCCGGTG TGGGAGGCCA ACGACGATTG 15300
CTGCTCACTG CTGGCCAGCT TCGCCGCTTC GCTTCCATTG CGGCGACCCT CGTCGATTGC CACGCTGGAC ATGGCCCGCT ACCTGCTCAC ACGCAGCGAG 15400
GGCACCATCG GCGAACTGGC GCACTTGCTG ATGGCGGCGG CCCTCGTCGC CGTGGAGAGC GGCGAGGAAG CGATCAACCA CCGCACGCTC AGCATGGCCG 15500
ATTACACCGG CCCAAGCGAG CGGCGTCGGC AATTCGAGCG GGAACTGATG TGAAGCCAGC GCCACGCTGG CCGCTGCATC CGGCTCCCAA GGAAGGCGAA 15600
GCCTTGTCTT CATGGCTCAA CCGCGTGGCC CTTTGCTATC ACATGGAGGT GTCCGACCTG CTGGAGCACG ATCTTGGTCA CGGCCAGGTT GATGACCTGG 15700
ATACCGCGCC ACCACTGTCG CTGCTGATGA TGCTCTTCCA GCGGAGCGGC ATCGAGCTGG ACCGGCTGCG TTGCATGAGT TTCGCCGGCT GGGTGCCTTG 15800
GCTACTGGAT AGCCTTGATG ATCAGATTCC AGACGCATTG GAAACCTATG CGTTCCAGCT CTCGGTGCTG CTGCCGAAAC TCCGCCGTAG GACGCGATCC 15900
ATCACGAACT GGCGTGCCTG GCTGCCCAGC CAGCCGATAC ATCGCGCCTG TCCGCTCTGT CTGAACGACC CGGCAAACCA AGCCGTACTG CTTGCATGGA 16000
AGCTGCCCCT GATGCTGAGC TGCCCGCTGC ATGGTTGCTG GCTGGAATCC TATTGGGGCG TGCCTGGGCG GTTTCTCGGC TGGGATAACG CCGACACTGC 16100
GCCGCGCACC GCCAGCGACG CGATTGCAGT GATGGACCGG CGTACCTGGC AGGCACTGAC GACCGGCCAT GTGGAGCTGC CGCGCCGACG CATCCACGCT 16200
GGATTGTGGT TTCGGCTAAT ACGCACGCTG CTCGATGAGC TGAACACCCC GCTTTCGACG TGCGGAACCT GCGCGGGGTA TCTCCGCCAA GTATGGGAAG 16300
GCTGCGGGCA TCCGCTGCGT GCTGGGCAAA GTCTGTGGCG ACCGTATGAA ACCCTGAACC CGGCAGTACG ATTGCAGATG CTGGAGGCGG CGGCAACGGC 16400
AATCAGCTTG ATTGAGGTGA GGGATATTAG CCCGCCAGGC GAGCATGCAA AGCTGTTCTG GTCCGAGCCC CAAACCGGGT TCACCAGTGG CCTGCCGGCG 16500
AAAGCGCTGA AGCCCGAACC CGTCGATCAC TGGCAGCGTG CGGTCAAGGC CATTGATGAC GCCATCATTG AAGCGCGGCA CGACCCCGAG ACGGCACGCT 16600
CGCTGTTCGC GTTGGCTTCC TATGGTCGGC GCGACCCCGC TTCCCTGGAA CAGTTGCGCG CTACCTTCGC GAAGGAAGGC ATCCCCACGG AATTTTTGTC 16700
ACATTACGAG CCTGATGAGC CCTTTGCATG TCTTAGACAG AATGACGGGT TAAGTGACAA ATTTTGACGA CCAGAACTTT CCGGTTCACA CTGTCACATA 16800
ATCGAACGTA TACGTGACGG GTGAAAAGGT GCTGATCGGC TACATGCGGG TATCGAAGGC GGACGGATCC CAGTCCACCA ATTTGCAACG CGATGCGCTC 16900
ATCGCCGCTG GTGTGAGCCT TGCGCACCTT TACGAGGATC TGGCCTCGGG CAGGCGCGAT GATCGCCCAG GGTTGGCTGC TTGCCTGAAG GCGCTTCGTG 17000
AAGGGGACAC GCTGATCGTG TGGAAGCTCG ATCGGCTTGG CCGTGATCTG CGCCACCTGA TCAACACCGT GCACGACCTA ACTGCGCGTA GCGTGGGCCT 17100
GAAGGTCCTG ACCGGTCACG GTGCGGCGGT CGACACGACG ACTGCCGCCG GCAAGCTTGT GTTCGGTATT TTTGCCGCGC TGGCCGAGTT CGAGCGTGAG 17200
TTGATTTCCG AGCGAACAGT CGCTGGACTT ATCTCGGCGC GCGCTCGCGG CAGGAAAGGG GGGCGCCCCT TCAAGATGAC CGCCGCCAAG CTACGCCTGG 17300
CGATGGCCAG CATGGGGCAA CCGGAAACCA AGGTGGGCGA TCTCTGCGAA GAACTCGGGA TTACCCGGCA GACGCTCTAC CGGCACGTGT CGCCCAAGGG 17400
CGAACTGCGG CCAGACGGCG TAAAGCTGCT CTCCCTCGGT TCAGCCGCAT AAATGGAGGC GACCTGGAAC GGGGCGCTGT TCAGTGCGGC AACGATCCGA 17500
TTACCGGTGT CGACCCAGAG CAGCCGTAGA GCTTTTGGGA AAGCTGTCGT TCAACGTTTG ACGTGAGGGG CCGCCGTAGC GGCGAAGCCG CGAAGGGAAC 17600
CCGCAAGCGC AGCTTGTGGG CGGTCCCTCT CGACGGAATG GTTAGATGCG ACCGTTTTAG TGAACACTTG CCTTAGATAG CAAGTTGAGC ACAGCAACGC 17700
CGCTGATAAT GAAGCCGACA CCAACAAATC CCCACATATC TAGTTTTTGA CCATGCAAAA CCCATGCAAT CGCAGTGACC AAGACGATCC CGAGGCCCGA 17800
CCAAACTGCG TAGGCGATTC CAACAGGAAT CGATTTGAGT GTCAGCGACA GGAAATAAAA AGCAGCAGCG TATCCCGCTA CGACGATAAA AGACGGTACT 17900
AACCTAGTAA AGCCCTCACT AGACTTGAGC GCAGAGGTTG CAATGACCTC AAAAATAATG GCCGTAGCCA GAAATAACCA ATTTTTCAAA ATATTTCTCC 18000
ATGGAGTTCC GCGAAGAAAT TTTAGGTTCG ATTTAAGAAA AAAAAACAGT CTTGTTGCTG GCCGAAATTT GTGCGCACAG CAAAGCATCT AACGCTGGAG 18100
TTAAGCCGCG GCGCGTAGCG CCGTCGGCTT GAACGACTTG TTATACAAAT TTTGCTGGTA ACCAGATTGA CCATTTTGGA AATCAATTGT TTTTTACAAG 18200
ATGAATAAAC CTATCAACAT CGGCTTGGTA ATCTTGAGAA TTGAAACCGT TTTCGCAGTT TGCGTGAACA TAGCCGCCAT AGCCCATGCC AAGATATCTG 18300
AAGGTATCTT TAAATGAATT GAGAAATGAG CTATCAGCAT CGCTGCTAAT GGATGTGCAA ACAACAAAAC CTGTTTTACT GCGCAGCCGC CTACCAATAT 18400
CCTTTAGCTC ATCAACATCC AGAAAATCCG ATGTTCTATC AATAAATACC TTCATTTGAG CACTTGGGCC GTACCAATAA ACTGGCGTTG CCAAAATTAT 18500
ATTCTCGTAA TCTAGCAATT GATTCATCAC AGAAAGAAAA TCATCGCCTA TGTTTTTGTG ATCATAGTCA TAGGGTGATA TGTCTTTATC CAACAAATTG 18600
ATTACACCAA TATCTAGCTC AGAAGAGATC CAATCTATAA GTCTACCTGT ATTGCCATTC CTTCTGGCAC TCGCAAATAC TGCTATTGTT TTGCTCACTG 18700
CTGACTCCTT TCATTTGTAT AACTTTGTTT TAGGGCGACT GCCCTGCTGC GTAACATCGT TGCTGCTCCA TAACATCAAA CATCGACCCA CGGCGTAACG 18800
CGCTTGCTGC TTGGATGCCC GAGGCATAGA CTGTACAAAA AAACAGTCAT AACAAGCCAT GAAAACCGCC ACTGCGCCGT TACCACCGCT GCGTTCGGTC 18900
AAGGTTCTGG ACCAGTTGCG TGAGCGCATA CGCTACTTGC ATTACAGTTT ACGAACCGAA CAGGCTTATG TCCACTGGGT TCGTGCCTTC ATCCGTTTCC 19000
ACGGTGTGCG TCACCCGGCA ACCTTGGGCA GCAGCGAAGT CGAGGCATTT CTGTCCTGGC TGGCGAACGA GCGCAAGGTT TCGGTCTCCA CGCATCGTCA 19100
GGCATTGGCG GCCTTGCTGT TCTTCTACGG CAAGGTGCTG TGCACGGATC TGCCCTGGCT TCAGGAGATC GGAAGACCTC GGCCGTCGCG GCGCTTGCCG 19200
GTGGTGCTGA CCCCGGATGA AGTGGTTCGC ATCCTCGGTT TTCTGGAAGG CGAGCATCGT TTGTTCGCCC AGCTTCTGTA TGGAACGGGC ATGCGGATCA 19300
GTGAGGGTTT GCAACTGCGG GTCAAGGATC TGGATTTCGA TCACGGCACG ATCATCGTGC GGGAGGGCAA GGGCTCCAAG GATCGGGCCT TGATGTTACC 19400
CGAGAGCTTG GCACCCAGCC TGCGCGAGCA GCTGTCGCGT GCACGGGCAT GGTGGCTGAA GGACCAGGCC GAGGGCCGCA GCGGCGTTGC GCTTCCCGAC 19500
GCCCTTGAGC GGAAGTATCC GCGCGCCGGG CATTCCTGGC CGTGGTTCTG GGTTTTTGCG CAGCACACGC ATTCGACCGA TCCACGGAGC GGTGTCGTGC 19600
GTCGCCATCA CATGTATGAC CAGACCTTTC AGCGCGCCTT CAAACGTGCC GTAGAACAAG CAGGCATCAC GAAGCCCGCC ACACCGCACA CCCTCCGCCA 19700
CTCGTTCGCG ACGGCCTTGC TCCGCAGCGG TTACGACATT CGAACCGTGC AGGATCTGCT CGGCCATTCC GACGTCTCTA CGACGATGAT TTACACGCAT 19800
GTGCTGAAAG TTGGCGGTGC CGGAGTGCGC TCACCGCTTG ATGCGCTGCC GCCCCTCACT AGTGAGAGGT AGGGCAGCGC AAGTCAATCC TGGCGGATTC 19900
ACTACCCCTG CGCGAAGGCC ATCGGTGCCG CATCGAACGG CCGGTTGCGG AAAGTCCTCC CTGCGTCCGC TGATGGCCGG CAGCAGCCCG TCGTTGCCTG 20000
ATGGATCCAA CCCCTCCGCT GCTATAGTGC AGTCGGCTTC TGACGTTCAG TGCAGCCGTC TTCTGAAAAC GACAGCAAAC GATGTCAGAA TAGAGTTAAA 20100
TTTCCTATTG ATTGACATAT TCCGTCAAAG GTAATAGATT TCATCCTGAC ACTTTTGCCT TTGGAGGCAT CTTGCAAGGT CAACGCATCG GCTATGTCCG 20200
CGTCAGCAGC TTCGACCAGA ACCCGGAACG GCAATTGGAG GGTGTTCAGG TGGCGCGGGT GTTCACCGAC AAGGCTTCTG GCAAGGACAC CCAGCGTCCC 20300
GAGCTGGAAA GGCTGCTGGC CTTCGTCCGC GAGGGCGACA CCGTGGTGGT GCATAGCATG GACAGGCTGG CACGCAACCT TGATGACCTG CGCCGCATCG 20400
TCCAAGGGCT GACACAACGG GGCGTGCGCA TGGAGTTCGT CAAAGAAGGG CTGAAGTTCA CCGGCGAGGA CTCACCGATG GCCAATCTGA TGCTGTCGGT 20500
CATGGGAGCC TTCGCTGAGT TCGAGCGCGC CCTGATCCGC GAACGTCAGC GCGAGGGAAT CGTGCTGGCC AAGCAGCGCG GTGCCTACCG GGGACGAAAG 20600
AAATCGCTGA ACAGCGAACA AATTGCCGAG TTGAAACGGC GAGTTGCGGC AGGCGACCAA AAAACCTTGG TGGCCCGTGA CTTCGGCATC AGCCGCGAAA 20700
CCTTGTACCA GTACCTGCGG GAAGACTGAC CATGCCACGC CGCTCAATCC TGTCCGCCAC CGAGCGCGAA AGCCTGCTGG CACTGCCAGA TGCCAAAGAC 20800
GAACTGATAC GGCACTACAT GTTCAACGAA ACCGACCTGT CGGTGATCCG TCAGCGTCGC GGCGCCGCGA ATCGATTGGG CTTCGCTGTG CAGCTTTGCT 20900
ACTTGCGATT CCCTGGCACC TTTTTGGGCG TCGATGAGCC TCCGTTTCCG CCCCTGTTGC GCATGGTGGC CGCGCAACTC AAGATGCCAG TGGAAAGTTG 21000
GAGCGAGTAC GGCCAGCGCG AACAGACACG GCGGGAGCAC TTGGTCGAGC TGCAAACGGT TTTTGGGTTC AAGCCCTTCA CCATGAGCCA CTATCGGCAA 21100
GCCGTGCATA CATTGACCGA GCTGGCCTTG CAGACCGACA AAGGCATCGT GCTGGCGAGC GCACTTGTCG AGAATCTGCG GCGGCAGAGC ATTATCCTGC 21200
CCGCCATGAA TGCCATCGAG CGCGCAAGCG CCGAGGCCAT CACCCGTGCC AACCGACGCA TTTACGCGGC GCTGACCGAT TCTTTGTTAT CACCCCACCG 21300
TCAGCGCCTG GACGAACTTC TCAAGCGCAA GGACGGCAGT AAAGTGACGT GGCTGGCATG GCTGCGCCAG TCGCCTGCCA AACCGAACTC TCGCCACATG 21400
CTCGAACATA TTGAGCGCCT GAAATCCTGG CAAGCACTTG ATCTGCCCGC AGGCATCGAG CGGCAGGTTC ACCAGAACCG CCTGCTCAAA ATCGCTCGTG 21500
AAGGTGGCCA GATGACGCCT GCTGATCTGG CAAAGTTCGA GGTGCAACGA CGCTATGCCA CGCTGGTAGC GCTGGCCATC GAAGGCATGG CCACCGTCAC 21600
CGATGAAATC ATCGACCTTC ACGATCGCAT CATCGGCAAG CTGTTCAACG CGGCCAAGAA CAAGCATCAG CAGCAGTTCC AGGCTTCCGG CAAGGCGATC 21700
AACGACAAGG TGCGGATGTA TGGGCGCATC GGTCAAGCGT TGATTGAGGC CAAGCAAAGC GGCAGCGATC CGTTCGCCGC CATCGAGGCC GTTATGCCCT 21800
GGGACACCTT CGCCGCCAGC GTCACCGAAG CGCAAACATT GGCGCGGCCT GCCGACTTTG ATTTCCTGCA CCACATCGGT GAAAGCTATG CCACGCTACG 21900
CCGCTACGCG CCGCAGTTCC TGGGCGTGCT CAAATTGCGG GCTGCGCCCG CCGCCAAGGG TGTGCTCGAT GCCATCGACA TGCTGCGCGG CATGAACAGC 22000
GACAGCGCGC GCAAGGTGCC CGCCGATGCG CCAACCGCAT TCATCAAGCC GCGCTGGGCA AAGCTGGTTC TGACCGACGA CGGCATCGAC CGGCGTTACT 22100
ACGAGTTATG CGCCCTGTCG GAGCTGAAGA ACGCGCTGCG CTCCGGTGAT GTCTGGGTGC AGGGTTCTCG CCAGTTCAAG GACTTCGACG AATACCTGGT 22200
GCCGGTCGAG AAGTTCGCCA CTTTGAAGCT GGCCAGCGAA TTGCCGCTGG CAGTGGCCAC CGACTGCGAC CAATACCTGC ATGACCGGTT GGAATTGTTG 22300
GAGGCGCAAC TCGCCACAGT CAACCGCATG GCTGCGGCCA ACGACTTACC GGATGCCATC ATCACCACCG CGTCAGGCCT GAAGATCACG CCGCTGGACG 22400
CGGCAGTACC AGACGCCGCG CAAGCCATGA TCGACCAGAC AGCTATGCTG CTGCCGCACC TCAAAATCAC CGAGTTGCTG ATGGAGGTCG ATGAATGGAC 22500
GGGCTTCACC CGCCACTTCA CACACCTGAA GACCAGCGAC ACGGCCAAGG ACAAAACCTT GCTGTTGACG ACGATCCTGG CCGACGCGAT CAACCTGGGT 22600
CTGACCAAAA TGGCCGAGTC CTGCCCTGGC ACCACCTACG CCAAGCTGTC TTGGCTGCAA GCCTGGCACA TCCGCGATGA AACCTATTCG ACGGCGCTGG 22700
CCGAGCTGGT GAATGCGCAG TTTCGGCAAC CCTTCGCCGG CAACTGGGGT GACGGCACCA CGTCATCGTC GGACGGCCAG AACTTCAGAA CCGGCAGCAA 22800
AGCAGAAAGC ACTGGTCATA TCAACCCGAA GTATGGAAGC AGTCCAGGAC GGACTTTCTA CACCCATATC TCCGACCAGT ACGCGCCCTT CAGTGCCAAG 22900
GTGGTCAACG TGGGCATTCG TGATTCAACT TACGTGCTTG ATGGCCTGCT GTACCACGAG TCGGACTTGC GCATCGAGGA ACACTACACC GACACGGCAG 23000
GCTTCACCGA TCACGTGTTT GGCTTGATGC ATTTGCTGGG ATTTCGCTTC GCGCCGCGTA TCCGTGACTT GGGCGAAACC AAGCTATTCA TCCCCAAGGG 23100
CGATGCCGCC TATGACGCGC TCAAGCCGAT GATTAGCAGC GACAGGCTGA ACATCAAGCA AATACGCGCC CATTGGGATG AAATTCTGCG GCTGGCCACC 23200
TCCATCAAGC AAGGCACGGT AACGGCTTCG CTGATGCTGC GCAAACTCGG CAGCTACCCG CGCCAGAACG GCTTGGCCGT GGCGTTGCGC GAGCTGGGGC 23300
GCATCGAGCG CACGCTGTTC ATTTTGGATT GGCTGCAAAG CGTGGAGCTG CGCCGCCGCG TCCATGCGGG GCTGAATAAG GGCGAGGCGC GCAACGCGCT 23400
GGCCAGGGCG GTCTTCTTCT ACCGATTGGG TGAAATCCGC GACCGCAGTT TTGAGCAGCA GCGCTACCGG GCCAGCGGCC TCAATCTGGT GACGGCGGCC 23500
ATCGTGTTGT GGAACACGGT ATATCTGGAG CGTGCCACCA GTGCTTTGCG TGGCAACGGC ACGGCGCTGG ACGACACATT GTTGCAATAT CTGTCGCCGC 23600
TGGGGTGGGA GCACATCAAC CTGACCGGCG ATTACCTATG GCGCAGCAGC GCCAAGGTCG GTGCGGGGAA GTTTAGGCCA TTGCGACCGC TGCCACCGGC 23700
TTAGCGTGCT TTATTTTCCG TTTTCTGAGA CGACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res_site_I 4295-4325 31 CGTCAGATTG AGGCATACCC TAACTTGATG T
repeat t3 12897-12916 20 TCAGAAGTCA TCTGCACCAA
r4 16696-16709 14 TTGTCACATT ACGA
r3 16747-16760 14 GGGTTAAGTG ACAA
res 16788-16822 35 ACACTGTCAC ATAATCGAAC GTATACGTGA CGGGT
r2 16791-16804 14 CTGTCACATA ATCG
r1 16807-16820 14 CGTATACGTG ACGG
attC qacL core 17555-17647 93 CGTTTGACGT GAGGGGCCGC CGTAGCGGCG AAGCCGCGAA GGGAACCCGC AAGCGCAGCT
TGTGGGCGGT CCCTCTCGAC GGAATGGTTA GAT
attC JK007 core 18093-18146 54 CGCTGGAGTT AAGCCGCGGC GCGTAGCGCC GTCGGCTTGA ACGACTTGTT ATAC
attI 18723-18778 56 CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCA
res_site_II 20083-20117 35 TGTCAGAATA GAGTTAAATT TCCTATTGAT TGACA
res_site_III 20120-20151 32 TTCCGTCAAA GGTAATAGAT TTCATCCTGA CA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn6005 34-489 Passenger Gene Heavy Metal Resistance -
merT Tn6005 561-962 Passenger Gene Heavy Metal Resistance +
merP Tn6005 959-1234 Passenger Gene Heavy Metal Resistance +
merC Tn6005 1262-1687 Passenger Gene Heavy Metal Resistance +
merA Tn6005 1726-3411 Passenger Gene Heavy Metal Resistance +
merD Tn6005 3429-3794 Passenger Gene Heavy Metal Resistance +
merE Tn6005 3791-4027 Passenger Gene Heavy Metal Resistance +
urf-2Y-WP_000993245.1 Tn6005 4093-4305 Passenger Gene Hypothetical +
tniA Tn6008 4486-6162 Transposase   +
lysR family Tn6008 6309-7193 Passenger Gene Other +
uracil-DNA glycosylase family Tn6008 7493-8023 Passenger Gene Other -
ahpD Tn6008 8495-9070 Passenger Gene Other -
araC family Tn6008 9134-9988 Passenger Gene Other +
TetR family Tn6006 10567-11133 Passenger Gene Other -
MFS transporter Tn6006 11144-12655 Passenger Gene Other -
tniA Tn6007 12963-14642 Transposase   +
tniB Tn6007 14645-15553 Accessory Gene   +
tniQ Tn6007 15550-16767 Accessory Gene Target Site Selection +
tniR Tn6007 16829-17452 Accessory Gene Resolvase +
qacL (ARO:3005098) Tn6007 17657-17989 Passenger Gene Antibiotic Resistance -
NAD(P)H-dependent oxidoreductase Tn6007 18183-18698 Passenger Gene Other -
intI1 Tn6007 18859-19872 Integron Integrase Class 1 +
tnpR Tn6005 20172-20729 Accessory Gene Resolvase +
tnpA Tn6005 20732-23704 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn6005 456 34-489 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Protein Sequence:  
MQINFENLTI GVFAKAAGVN VETIRFYQRK GLLPEPDKPY GSIRRYGEAD VTRVRFVKSA QRLGFSLDEI AELLRLEDGT HCEEASGLAE HKLKDVREKM
ADLARMEAVL SELVCACHAR KGNVSCPLIA SLQDGTKLAA SARGSHGVTT P

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn6005 402 561-962 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   response to mercury ion (GO:0046689)
Target:   Mercury
Comment:   ProteinID:ACE81807.1
Protein Sequence:  
MSEPQKSEPQ KSEPQNGRGA LFAGGLAAIL ASACCLGPLV LIALGFSGAW IGNLTVLEPY RPIFIGAALV ALFFAWRRIY RPAQACNPGE VCAISPRCEV
LTSSFSGSWP RWSWSRSDFP TSCHFSINHR SSS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn6005 276 959-1234 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Protein Sequence:  
MKKLFAALAL AAVVAPVWAA TQTVTLSVPG MTCASCPITV KHALSKVEGV SKTDVSFDKR QAVVTFDDAK TNVQKLTKAT EDAGYPSSLK R

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn6005 426 1262-1687 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Protein Sequence:  
MGLITRIAGK TGALGSVVSA MGCAACFPAI ASFGAAIGLG FLSQYEGLFI GILLPMFAGI ALLANAIAWL NHRQWRRTAL GTIGPILVLA AVFLMRAYGW
QSGGLLYVGL ALMVGVSVWD FISPAHRRCG PDSCELPEQR G

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn6005 1686 1726-3411 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Protein Sequence:  
MTTLKITGMT CDSCAAHVKE ALEKVPGVQS ALVSYPKGTA QLAIEAGTSS DALTTAVAGL GYEATLADAP PTDNRAGLLD KMRGWIGAAD KPSGNERPLQ
VVVIGSGGAA MAAALKAVEQ GAQVTLIERG TIGGTCVNVG CVPSKIMIRA AHIAHLRRES PFDGGMPPTP PTILRERLLA QQQARVEELR HAKYEGILDG
NSAITVLHGE ARFKDDQSLI VSLNEGGERV VMFDRCLVAT GASPAVPPIP GLKESPYWTS TEALASDTIP ERLAVIGSSV VALELAQAFA RLGSKVTALA
RNTLFFREDP AIGEAVTAAF RAEGIEVLEH TQASQVAHMD GEFVLTTTHG ELRADKLLVA TGRTPNTRSL ALEAAGVAVN AQGAIVIDKG MRTSSPNIYA
AGDCTDQPQF VYVAAAAGTR AAINMTGGDA ALDLTAMPAV VFTDPQVATV GYSEAEAHHD GIETDSRLLT LDNVPRALAN FDTRGFIKLV IEEGSGRLIG
VQAVAPEAGE LIQTAVLAIR NRMTVQELAD QLFPYLTMVE GLKLAAQTFS KDVKQLSCCA G

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn6005 366 3429-3794 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Protein Sequence:  
MSAYTVSRLA LDAGVSVHIV RDYLLRGLLR PVAYTTGGYG LFDDTALQRL RFVRAAFEAG IGLDALARLC RALDAADGDG ASAQLAVLRQ LVERRREALA
SLEMQLAAMP TEPAQHAESL P

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn6005 237 3791-4027 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Protein Sequence:  
MNSPEHLPSE THKPITGYLW GALAVLTCPC HLPILAIVLA GTTAGAFIGE HWGIAALTLT GLFVLSVTRL LRAFKGRS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urf-2Y-WP_000993245.1 Urf-2Y-WP_000993245.1 Tn6005 213 4093-4305 +
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MNANAPNTAS CTTCCVCCKE IPLDAAFTPE GAEYVEHFCG LDCYERFQAR AKAATESDIA PVPGGSQPSD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA Tn6008 1677 4486-6162 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   homologous to TnsB of Tn7
Protein Sequence:  
MTSDTPPIAA QGVATLPDEA WAQARHRTEI IGPLAALEVV GHEAADEAAQ ALGLSRRQVY VLIRRARQGT GLVTDLTPGR SGGGKGKGRL PEPVERIIRE
LLQKRFLTKQ KRSLAAFHRE VAQACKTQKL PVPARNTVAQ RIAGLHPAKI ARSRGGQDAA RPLQGAGGIP PEVTMPLEQV QIDHTVIDLI VVDERDRQPI
GRPYLTLAID VFTRCVLGMV VTLEAPSAVS VGLCLAHAAC DKRPWLEGLN VEMDWPMSGK PRLLYLDNAA EFKSEALRRG CEQHGIRLDY RPPGQPHYGG
IVERIIGTAM QMIHDELPGT TFSNPGQRGE YDSEKMATLT LRELERWLAL AVGTYHGSVH NGLLQPPAAR WAEAVERVGV PAVVTRPTAF LVDFLPVIRR
TLTRTGFVID HIHYYADALK PWIARRERLP AFLIRRDPRD ISRIWVLEPE GQHYLEIHYR TLSHPAVTLW EQRQALAKLR QLGREQVDES ALFRMIGQMR
EIVTTAQKAT RKARRDADRR QHLKTSEPPA KPIPPDVDMA DPQADNLPPA KPFDQIEEW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
lysR family LysR family Tn6008 885 6309-7193 +
Class:   Passenger Gene
Sub Class:   Other
Comment:   putative transcriptional regulator, proteinID: ACA14445.1
Protein Sequence:  
MREISLDRLR TLVAIADLGS FAEAARVLHL APPTVSLHIA DLESRVGGKL LSRTRGRIQP SAIGETLVER ARRLLADAEQ ALEDVERQVQ GLAGRVRLGA
STGAIAQLMP QALETLGQRH PAIDVQVAVL TSQETLKKLA EGSLEIGLVA LPQTPVKELR IEPWRRDPVM AFLPARWECP DVVTPGWLAA QPLILNDKTT
RLSRLTSEWF ASDGRQPTPR IQLNYNDAIK SLVAAGYGAT LLPHEASTPL PDTRIVMRPL QPLLWRQLGI AHRGGDVERP TQHVLDVLWG LSAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
uracil-DNA glycosylase family Uracil-DNA glycosylase family Tn6008 531 7493-8023 -
Class:   Passenger Gene
Sub Class:   Other
Protein Sequence:  
MAPPSCASHP FRKRAMPTLD AFLTDVRACT RCAPHLPHGV QPVFQFHPSA PILIAGQAPG ARVHASGVPF DDASGARLRA WLGVDRDTFY DPTRIAILPM
GFCYPGTGKS GDLPLRPECA PRLARSLHAA FRAPVAGHRA GQLRHGLPPR YWQDAAHPGG RSLARALAAS VPPASP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
ahpD AhpD Tn6008 576 8495-9070 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   putative alkylhydroperoxidase || proteinID: ACA14447.1
Protein Sequence:  
MPTCSCTSPT TEIDMTQIAP LTIDTADAAT AATLKAVKAK LGMVPNLFAT LAHAPAALNG YLGLSETLGT GRLNASQREI VALAAAQANR CQYCLSAHTL
IGKGAGLSAE AIAAARTGQA ANALDDAIAG FARALVEQRG VVSADAMANY RRAGLDDGLI LEVIANVALN TLTNYTNHIA DPTVDFPVVA V

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
araC family AraC family Tn6008 855 9134-9988 +
Class:   Passenger Gene
Sub Class:   Other
Protein Sequence:  
MESGMADRLA GLLRHYSLSA RVFHSGAFCG QHHYAAPHGY IHLVRRGPIT ARSPVHEDLL VTEPSLLFYP RVASHRFVAA PGDTAEQLCA EVDLGASTGN
PLAMALPSML LIPLADLPGL GPTLELLFAE AERDQCGRQA AIDRLCELLL IQLLRYLMDG RLGATGLLAG LADPKLARAI TAMHDAPQTA WSLEALAAKA
GMSRARFAAA FKDAVGVTPG DYLADWRMNV SCTLLKQGRP VAVVADRVGY GSPNALARAF RVRMGCAPRD WLAQQRGDAA LSGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
TetR family TetR family Tn6006 567 10567-11133 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   TetR family (Tn6006) OtherInformation
Protein Sequence:  
MARASKRLEV LEAIVSIIER DGLTAVTLDA VALETGMTRA GLLYHFPSRE ALILATHEHL TRSWEQELEA SAGNTSDRAT DAERHAAYIN TCARAARRVE
LLLILESSDN RQLGDLWQQV IDRWAPPAPI GNDAAELDRF ISRLAADGLW IHEALSSRPL PEQLRKRIAA RLVAMAAGPV EAEENLPK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
MFS transporter MFS transporter Tn6006 1512 11144-12655 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   major facilitator superfamily-related protein || ProteinID: ACE81795.1
Protein Sequence:  
MPAAHSNRWV LLVTVAAGLL LIVLDNSVLY TALPTLTREL GATATQGLWI INAYPLVMAG LLLGTGTLGD RIGHRRMFLI GLVLFGVASI VAAYSPTAEI
LIGARAFLAV GAAAMMPATL ALIRVTFEDD RERNIAIAIW GSLSVVGAAL GPIIGGFLLG HFWWGSVFLI NVPVVVAAFI SALIVAPKVA GDATKPWDVV
SSFQALVALS AFVIAIKESA HAGQSWAVPA ISLLVAILAG ALFVRRQLRL PFPLLDFSIF RNAAFTSGVL AAAFSLFAIG GVELATTQRF QLVAGFTPLE
AGMLVSAAAL GSLPTALLGG AFLHRIGLRI LIAGGLAAGS LAVLLATWGI THGLGWLIAG LALTGAGVGA TMSVASTAIV GNVPVHRAGM ASSVEEVSYE
FGSLFAVTIL GSLLAYLYTV NVVFPAGTSE AARDSMASAL VFANEAGADG VVVRQAAGIA FDHAYTVVMY VAAGVLAVGA LITGILLRRY GPGSQSSAYP
TQH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA Tn6007 1680 12963-14642 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   Tn402-like || homologous to TnsB of Tn7 || original is nonfunctional due to 1 bp deletion
Protein Sequence:  
MASDTLPIAE QGVATLPDAA WAQARHRTEI IGPLAALEVV GHEAADAAAQ ALGLSRRQVY VLIRRARQGA GFVTDLVPGQ SGGGKGKGRL PESVERIIRE
LLQKRFLTKQ KRSLAAFHRE VAQACKAQKL RVPARNTLAL RIAGLDPLKA TRRREGQDAS RSLQGVGGEP PAVTAPLEQV QIDHTVIDLI VVDERDRQPI
GRPYLTIAID VFTRCVLGMV VTLEAPSSVS VGLCLVHVAC DKRPWLEGLN IEMDWPMSGK PRLLYLDNAA EFKSEALRRG CEQHGIRLDY RPPGQPHYGG
IVERIIGTAM QMIHDELPGT TFSNPDQRGD YDSENKAALT LRELERWLTL AVGTYHGSVH NGLLQPPAAR WSEAVARVGV PAVVTRALAF LVDFLPIIRR
TLTRTGFVID HIHYYADALK PWIARRDRLP AFLIRRDPRD ISRIWVLEPE GQHYLEIPYR TLSHPAVTLW EQRQALTKLR QQGREQVDES ALFRMIGQMR
EIVTTAQKAT RKARRDADRR QHLKASPPPD KPIPPKTDVA DPQADNLPPA KPFDQIEEW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB TniB Tn6007 909 14645-15553 +
Class:   Accessory Gene
Transpoase Chemistry:   Serine
Comment:   homologous to TnsC protein of Tn7 putative ATP-binding protein
Protein Sequence:  
MDEYPIIDLS HLLPAAQGLA RLPADERIQR LRADRWIGYP RAVEALNRLE TLYAWPNKQR MPNLLLVGPT NNGKSMIIEK FRRTHPASSD ADQEHMPVLV
VQMPSEPSVI RFYVALLAAM GAPLRPRPRL PEMEQLALAL LRKVGVRMLV IDELHNVLAG NSVNRREFLN LLRFLGNELR IPLVGVGTRD AYLAIRSDDQ
LENRFEPMML PVWEANDDCC SLLASFAASL PLRRPSSIAT LDMARYLLTR SEGTIGELAH LLMAAALVAV ESGEEAINHR TLSMADYTGP SERRRQFERE
LM

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniQ TniQ Tn6007 1218 15550-16767 +
Class:   Accessory Gene
Sub Class:   Target Site Selection
Comment:   Tn402-like || Protein: ACE81793.1
Protein Sequence:  
VKPAPRWPLH PAPKEGEALS SWLNRVALCY HMEVSDLLEH DLGHGQVDDL DTAPPLSLLM MLFQRSGIEL DRLRCMSFAG WVPWLLDSLD DQIPDALETY
AFQLSVLLPK LRRRTRSITN WRAWLPSQPI HRACPLCLND PANQAVLLAW KLPLMLSCPL HGCWLESYWG VPGRFLGWDN ADTAPRTASD AIAVMDRRTW
QALTTGHVEL PRRRIHAGLW FRLIRTLLDE LNTPLSTCGT CAGYLRQVWE GCGHPLRAGQ SLWRPYETLN PAVRLQMLEA AATAISLIEV RDISPPGEHA
KLFWSEPQTG FTSGLPAKAL KPEPVDHWQR AVKAIDDAII EARHDPETAR SLFALASYGR RDPASLEQLR ATFAKEGIPT EFLSHYEPDE PFACLRQNDG
LSDKF

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniR TniR Tn6007 624 16829-17452 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   resolution of cointegrates || Protein: ACE81792.1 || identical to tniR (Tn1721)
Protein Sequence:  
MLIGYMRVSK ADGSQSTNLQ RDALIAAGVS LAHLYEDLAS GRRDDRPGLA ACLKALREGD TLIVWKLDRL GRDLRHLINT VHDLTARSVG LKVLTGHGAA
VDTTTAAGKL VFGIFAALAE FERELISERT VAGLISARAR GRKGGRPFKM TAAKLRLAMA SMGQPETKVG DLCEELGITR QTLYRHVSPK GELRPDGVKL
LSLGSAA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacL (ARO:3005098) QacL Tn6007 333 17657-17989 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   quaternary ammonium salts
Sequence Family:  small multidrug resistance (SMR) antibiotic efflux pump (ARO:0010003)
Comment:   subunit of the qac multidrug efflux pump||loose match to reference sequence for ARO:3005098 (bitscore:173)
Protein Sequence:  
MKNWLFLATA IIFEVIATSA LKSSEGFTRL VPSFIVVAGY AAAFYFLSLT LKSIPVGIAY AVWSGLGIVL VTAIAWVLHG QKLDMWGFVG VGFIISGVAV
LNLLSKASVH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
NAD(P)H-dependent oxidoreductase NAD(P)H-dependent oxidoreductase Tn6007 516 18183-18698 -
Class:   Passenger Gene
Sub Class:   Other
Protein Sequence:  
MSKTIAVFAS ARRNGNTGRL IDWISSELDI GVINLLDKDI SPYDYDHKNI GDDFLSVMNQ LLDYENIILA TPVYWYGPSA QMKVFIDRTS DFLDVDELKD
IGRRLRSKTG FVVCTSISSD ADSSFLNSFK DTFRYLGMGY GGYVHANCEN GFNSQDYQAD VDRFIHLVKN N

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 Tn6007 1014 18859-19872 +
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LRTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn6005 558 20172-20729 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MQGQRIGYVR VSSFDQNPER QLEGVQVARV FTDKASGKDT QRPELERLLA FVREGDTVVV HSMDRLARNL DDLRRIVQGL TQRGVRMEFV KEGLKFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI VLAKQRGAYR GRKKSLNSEQ IAELKRRVAA GDQKTLVARD FGISRETLYQ YLRED

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn6005 2973 20732-23704 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRSILSAT ERESLLALPD AKDELIRHYM FNETDLSVIR QRRGAANRLG FAVQLCYLRF PGTFLGVDEP PFPPLLRMVA AQLKMPVESW SEYGQREQTR
REHLVELQTV FGFKPFTMSH YRQAVHTLTE LALQTDKGIV LASALVENLR RQSIILPAMN AIERASAEAI TRANRRIYAA LTDSLLSPHR QRLDELLKRK
DGSKVTWLAW LRQSPAKPNS RHMLEHIERL KSWQALDLPA GIERQVHQNR LLKIAREGGQ MTPADLAKFE VQRRYATLVA LAIEGMATVT DEIIDLHDRI
IGKLFNAAKN KHQQQFQASG KAINDKVRMY GRIGQALIEA KQSGSDPFAA IEAVMPWDTF AASVTEAQTL ARPADFDFLH HIGESYATLR RYAPQFLGVL
KLRAAPAAKG VLDAIDMLRG MNSDSARKVP ADAPTAFIKP RWAKLVLTDD GIDRRYYELC ALSELKNALR SGDVWVQGSR QFKDFDEYLV PVEKFATLKL
ASELPLAVAT DCDQYLHDRL ELLEAQLATV NRMAAANDLP DAIITTASGL KITPLDAAVP DAAQAMIDQT AMLLPHLKIT ELLMEVDEWT GFTRHFTHLK
TSDTAKDKTL LLTTILADAI NLGLTKMAES CPGTTYAKLS WLQAWHIRDE TYSTALAELV NAQFRQPFAG NWGDGTTSSS DGQNFRTGSK AESTGHINPK
YGSSPGRTFY THISDQYAPF SAKVVNVGIR DSTYVLDGLL YHESDLRIEE HYTDTAGFTD HVFGLMHLLG FRFAPRIRDL GETKLFIPKG DAAYDALKPM
ISSDRLNIKQ IRAHWDEILR LATSIKQGTV TASLMLRKLG SYPRQNGLAV ALRELGRIER TLFILDWLQS VELRRRVHAG LNKGEARNAL ARAVFFYRLG
EIRDRSFEQQ RYRASGLNLV TAAIVLWNTV YLERATSALR GNGTALDDTL LQYLSPLGWE HINLTGDYLW RSSAKVGAGK FRPLRPLPPA

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
Tn6006-EU591509.1 Tn6006 Transposon 4343-20074 15732
Tn6008-EU316185.1 Tn6008 Transposon 4343-10341 5999
Tn6007-EU591509.1 Tn6007 Transposon 12820-20074 7255

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRt Tn6006 4343-4367 TGTCGTTTTC AGAAGACGAC CGCAC
repeat t1 Tn6008 4351-4369 TCAGAAGACG ACCGCACCA
repeat t2 Tn6008 4391-4409 CACACGTATG CCGAGGACT
repeat t3 Tn6008 4420-4438 TCAGGAGTCG TCTGCACCA
repeat t4 Tn6008 4452-4470 TCAATACTCG TGTGCACCA
repeat i3 Tn6008 10250-10268 CGTCGGGCAG CAACGGACT
repeat i2 Tn6008 10292-10310 ATCACGTCAG CCGAAGACT
IRi Tn6008 10309-10341 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 Tn6008 10315-10333 GTCACGTCGG CAGAAGACT
repeat t1 Tn6007 12828-12846 TCAGAAGACG ACTGCACCA
repeat t2 Tn6007 12869-12886 ACACGTCAGC CGAGGACT
repeat t4 Tn6007 12929-12947 TCAATACTCG TGTGCACCA
repeat i4 Tn6007 19955-19973 AGGAGGGACG CAGGCGACT
repeat i3 Tn6007 19983-20001 CGTCGGGCAG CAACGGACT
repeat i2 Tn6007 20025-20043 ATCACGTCAG CCGAAGACT
IRi Tn6006 20042-20074 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 Tn6007 20048-20066 GTCACGTCGG CAGAAGACT
IRR Tn6005 23697-23737 GCCGAATCGC ACGAAATAAA AGGCAAAAGA CTCTGCTGGG G

 References     

1.Ghaly TM, ORCID: 0000-0002-5162-4054, Chow L, Asher AJ, Waldron LS, Gillings MR. Evolution of class 1 integrons: Mobilization and dispersal via food-borne bacteria. PLoS One. 2017 Jun 6;12(6):e0179169. doi: 10.1371/journal.pone.0179169. eCollection 2017. PubMed ID: 28586403