Transposon
Name: Tn551       (Synonyms: Tn917)
Family: Tn3        Group: Tn4330
Evidence of Transposition: Yes
 Host     

Host Organism:Staphylococcus aureus Molecular Source:plasmid pI258 (Tn551) and pAD2 (Tn917)
Date of Isolation:1977

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTCCCGAGCGCCTACGAGAAATTTGTATCGATAAG
IRR (Length: 38 bp)GGGGTCCCGAGCGCTTAGTGGGAATTTGTATCGATAAG

 Sequence     
DNA SequenceLength  5266 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCCCGA GCGCCTACGA GAAATTTGTA TCGATAAGAA ATAGATTTAA AAATTTCGCT GTTATTTTGT ACATTTAACT TGACGGTGAC ATCTCTCTAT 100
TGTGAGTTAT TAGTGGTACA GTTTTCAACC GTTTTAATTA TAAAAAAGTG GTGCATTTTT AAATTGGCAC AAACAGGTAA CGGTTATTGC AGGTGTATTT 200
CTTATCTATG GGTTTAACAT GGATTTTATC ATTAAAATCA TGAGTATTGT CCGAGAGTGA TTGGTCTTGC GTATGGTTAA CCCTAAAGTT ATGGAAATAA 300
GACTTAGAAG CAAACTTAAG AGTGTGTTGA TAGTGCATTA TCTTAAAATT TTGTATAATA GGAATTGAAG TTAAATTAGA TGCTAAAAAT TTGTAATTAA 400
GAAGGAGGGA TTCGTCATGT TGGTATTCCA AATGCGTAAT GTAGATAAAA CATCTACTGT TTTGAAACAG ACTAAAAACA GTGATTACGC AGATAAATAA 500
ATACGTTAGA TTAATTCCTA CCAGTGACTA ATCTTATGAC TTTTTAAACA GATAACTAAA ATTACAAACA AATCGTTTAA CTTCTGTATT TATTTATAGA 600
TATAATCACT TCAGGAGTGA TTACATGAAC AAAAATATAA AATATTCTCA AAACTTTTTA ACGAGTGAAA AAGTACTCAA CCAAATAATA AAACAATTGA 700
ATTTAAAAGA AACCGATACC GTTTACGAAA TTGGAACAGG TAAAGGGCAT TTAACGACGA AACTGGCTAA AATAAGTAAA CAGGTAACGT CTATTGAATT 800
AGACAGTCAT CTATTCAACT TATCGTCAGA AAAATTAAAA CTGAACATTC GTGTCACTTT AATTCACCAA GATATTCTAC AGTTTCAATT CCCTAACAAA 900
CAGAGGTATA AAATTGTTGG GAATATTCCT TACCATTTAA GCACACAAAT TATTAAAAAA GTGGTTTTTG AAAGCCATGC GTCTGACATC TATCTGATTG 1000
TTGAAGAAGG ATTCTACAAG CGTACCTTGG ATATTCACCG AACACTAGGG TTGCTCTTGC ACACTCAAGT CTCGATTCAG CAATTGCTTA AGCTGCCAGC 1100
GGAATGCTTT CATCCTAAAC CAAAAGTAAA CAGTGTCTTA ATAAAACTTA CCCGCCATAC CACAGATGTT CCAGATAAAT ATTGGAAGCT ATATACGTAC 1200
TTTGTTTCAA AATGGGTCAA TCGAGAATAT CGTCAACTGT TTACTAAAAA TCAGTTTCAT CAAGCAATGA AACACGCCAA AGTAAACAAT TTAAGTACCG 1300
TTACTTATGA GCAAGTATTG TCTATTTTTA ATAGTTATCT ATTATTTAAC GGGAGGAAAT AATTCTATGA GTCGCTTTTG TAAATTTGGA AAGTTACACG 1400
TTACTAAAGG GAATGTAGAT AAATTATTAG GTATACTACT GACAGCTTCC AAGGAGCTAA AGAGGTCCCT AGCGCCTACG GGGAATTTGT ATCGATAAGG 1500
AATAGATTTA AAAATTTCGC TGTTATTTTG TACAATAAGG ATAAATTTGA ATGGTACCAT AAACGACCGT TTATGGTACC ATTTCATTTT CCTGCTTTTT 1600
CTAAATGTTT TTTAAGTAAA TCAAGTACCA AAATCCGTTC CTTTTTCATA GTTCCTATAT AGTTATACTT AATGAGTTAT GGTACATTTA AATTATAAAA 1700
TTAAGGAGGT TTTTTTATGA TTTTTGGCTA TGCTCGAGTG AGTACGGATG ATCAAAATCT TAGTTTACAA ATTGATGCAC TTACTCATTA TGGAATTGAT 1800
AAATTATTTC AAGAAAAAGT AACTGGTGCG AAAAAAGACC GACCGCAATT AGAAGAAATG ATCAACCTAC TACGTGAAGG AGATTCTGTT GTCATTTACA 1900
AGTTAGATCG AATTTCACGA TCAACTAAAC ATTTGATTGA ACTTTCTGAA TTATTTGAAG AACTTAGTGT CAATTTTATA TCTATTCAAG ATAACGTAGA 2000
TACTTCAACG TCTATGGGAA GATTCTTTTT CCGAGTTATG GCTAGTTTAG CAGAACTGGA ACGGGATATT ATTATTGAAC GAACTAACTC TGGTCTTAAG 2100
GCAGCCAGAG TCCGAGGAAA AAAAGGGGGC CGTCCAAGTA AAGGTAAGCT ATCAATTGAT TTAGCTTTAA AAATGTATGA CAGCAAAGAG TATTCTATTC 2200
GTCAAATTCT TGATGCCTCT AAATTAAGCA AAACAACCTT TTACCGTTAC CTCAATAAAA GGAATGCTTA AGATATGGCT ATGAAAAGAA TTTTAACTAC 2300
TTCACAGCGT GAACAACTTC TTTCTGTAGA CCACTTATCA GAAGAGGATT TTAAAGCGTA TTTTAGTTTT TCTGATTATG ATCTGGAGGT TATTAATCAA 2400
CACCGTGGAA AGGTCAATAA ACTAGGATTT GCGATACAAC TTTGTTTGGC CCGGTATCCT GGGTGTTCTT TAAGTAATTG GCCGATTAAA TCAACCAGAC 2500
TAACTTCTTA TGTGAGTCGA CAGCTCCATC TTGATGCAAT TGATTTAAAT TCATATGATC ATAGAAATAC ACGTGCAAAT CACTTCAACG AGATCTTAGA 2600
AGTATTCAAC TATCATCGAT TCGGTAGTGC TAATACACAA AAACAGTTAA TAGAATATTT AATTGAACTA GCTTTAGAAA ATGATGACTC TATCTATCTA 2700
ATGAAAAAAA CAATTGATTT CTTAACTCGA AAAAGAATTA TTTTTCCATC TATAGCTACA CTTGAAGACA TTATAAGCCG CTGTCGAGAT AAAGCAGAAA 2800
ACAACTTATT TTCAATATTG CTCTGTTCAT TAACAGATAT ACAAATTGAA AAACTAGAGA GTTTGTTTCA AATTTATGAA GAGACGAAAA TAACTAAACT 2900
CGCTTGGCTA AAAGACATTC CAGGTAAGGC AAATCCAGAA AGCTTTATGA GTATTTGTAA AAAAGTGGAA GTGATTGCTT CCATGGGACT CGGGACAATT 3000
AATGTCTCCC ATATTAATCG GAACAGGTTT CTTCAGCTAG CTAGACTAGG GGAAAATTAT GATGCATATG ACTTCTCCCG TTTTGAGCTT GAAAAAAGAT 3100
ACTCTTTACT TATTGCTTTT TTAGTCAATC ATCATCAATA TCTGATCGAT CAACTGATTG AGATTAATGA CCGCATTTTA GCAAGTATTA AACGCAAAGG 3200
GACACGTGAT TCACAAGAAC AGTTAAAAGA AAAAGGAAAA TTGGCTACTA AAAAATTGGA ACATTATGCT TCTTTAATTG ATGCTCTTCA CTTTGCAAAA 3300
GATAATGATA GTAATCCTTT TGACGAAATT GAACGAATCA TGCCTTGGGA AGATTTAGTA CAAGATGGAG AAGAAGCTAA AAAAATTACA GGTAATAAAA 3400
ATCATGGCTA TTTAGAAATG GTTCGAAATA AAGCTAATTA CCTCCGAAGA TACACGCCAA TGTTATTGAG GACCCTTTCG TTCAAAGCAA CTCCGGCAGC 3500
AAATCCAGTC CTCATGGCCC TAACTCAACT AACTGATTTA CACAATAGTG GTAAAAGAAA AATACCGGCA GATACTTCTA CTGATTTTGT GAGTAAAAAA 3600
TGGAAAAGCC TTGTTCGGCC AGAAGAGGGG AAAATAGATC GGTCTTACTA TGAGTTAGTA GCTTTCACCG AGCTAAAGAA CAATATTCGA TCAGGAGATA 3700
TTTCAGTTGA AGGAAGTATG ATCCATCGAA ATATTGATGA TTACTTAGTT GATTTATCTG CTTGTATTGA TTCAGAAACT ATTCCAGACA CGTTTGAGGA 3800
CTATTTAAAG GATCGGGAAA TAATTTTAGA TTTACAGCTT CAATTTTATT CGACAGTTGA TAAGAGAATT TCAAGAGCAA ACCTTAAAAA GTTGGAAAAA 3900
GTTACACCTA GCGAAGCAGA AATATATAGA AAAAAACTTT ATTCAATAAT TCCTAAGATA AGGCTTAGTG ATCTTTTAAT TGAGGTGGAC AGTTGGACCA 4000
ACTTTTCACA AGAATTTAGT CATGATTCTA CAGGGAAACC GCCGAGTGAA CAAGAAAGAA AAATTATTTT TGCTGCTTTG CTGGGTTTAG GGATGAATAT 4100
TGGTCTTGAA AAAATGGCCC AATCAACTCC TGGAATTTCT TATTCTCAGT TAGCCAATGC CAAACAATGG CGCTTTTATA AAGAAGCTCT GACTCGTGCT 4200
CAATCTGTTT TGGTTAATTA TCAGTTAAAG CTTCCTGTTG CAGACTTTTG GGGTGAAGGA AAAACCACTG CTTCAGACGG AATGCGCGTC CCAGTGGGCG 4300
TCTCAGCTCT AAAATCCGAT GTTAATCCAC ATTACAAAAG TATGGAAAAA GGAGCTACAA TGATTCGATC AATAAATGAT AGGCATACGA CTCATCATAT 4400
CGAGGTTGCT TCAACTAATA CAAGGGAAGC TACTCATACC CTTGATGGCC TACTTTATCA TGAAACAGAT CTAGATATTG AGGAACATTT TACTGATACA 4500
AATGGGTATT CTGATCAGGT GTTTGGAATG ACCGCATTAC TAGGCTTTGA TTTTGAACCT CGCATCAGAA ATATAAAAAA ATCACAATTA TTTTCTATCA 4600
AATCACCTTC CTACTACCCT AACTTATCAG AAGATATAAG CGGAAAAATC AATGTAAAAA TTATTGAAGA AAACTATGAT GAAATTAAAC GAATCGCCTA 4700
TTCGATTCAA ACAGCAAAAG TATCTAGTTC TTTACTATTA GGAAAGCTAG GCTCATACGC ACGTAAGAAT AGAGTAGCTC TTGCACTGAG AGAACTAGGT 4800
CGCATTGAAA AGAGCATTTT TATGATAGAT TATATTACAG ATAGTGAGCT ACGGCGAAGG ATCACTCATG GACTAAATAA GACAGAAGCG ATTAATGCTT 4900
TAGCTAGAGA ACTATTTTTT GGGCGACGCG GAAAATTTAT GGAGCGCGAT ATTCGCCGAC AACTTCAAAG TGCTAGTGCG CTTAATGTGT TAATAAATGC 5000
AATAAGTATA TGGAACGCCG TCTACTTACA AGCAGCTTAT AATTATCTCG TCAAAATAGA TCCCGAAGTA ACTAAGTATA TGAAGCATGT ATCTCCTATT 5100
AATTGGGAGC ATATCACTTT TCTTGGAGAG TATAAATTTG ACTTGTTATC TATTCCTAAA CACTTAAGAG AATTGAATAT AAAAAATAAA TAGGCCTTGA 5200
AACATTGGTT TAGTGGGAAT TTGTACCCCT TATCGATACA AATTCCCACT AAGCGCTCGG GACCCC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
ErmB (ARO:3000375) Tn551 625-1362 Passenger Gene Antibiotic Resistance +
tnpR Tn551 1717-2271 Accessory Gene Resolvase +
tnpA Tn551 2275-5193 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
ErmB (ARO:3000375) ErmB Tn551 738 625-1362 +
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target alteration (ARO:0001001)
Target:   macrolide antibiotic (ARO:0000000)||lincosamide antibiotic (ARO:0000017)||streptogramin antibiotic (ARO:0000026)
Sequence Family:  Erm 23S ribosomal RNA methyltransferase (ARO:3000560)
Comment:   strict match to reference sequence for ARO:3000375 (97% identity, bitscore: 489)
Protein Sequence:  
MNKNIKYSQN FLTSEKVLNQ IIKQLNLKET DTVYEIGTGK GHLTTKLAKI SKQVTSIELD SHLFNLSSEK LKLNIRVTLI HQDILQFQFP NKQRYKIVGN
IPYHLSTQII KKVVFESHAS DIYLIVEEGF YKRTLDIHRT LGLLLHTQVS IQQLLKLPAE CFHPKPKVNS VLIKLTRHTT DVPDKYWKLY TYFVSKWVNR
EYRQLFTKNQ FHQAMKHAKV NNLSTVTYEQ VLSIFNSYLL FNGRK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn551 555 1717-2271 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   identical to tnpR (Tn917)
Protein Sequence:  
MIFGYARVST DDQNLSLQID ALTHYGIDKL FQEKVTGAKK DRPQLEEMIN LLREGDSVVI YKLDRISRST KHLIELSELF EELSVNFISI QDNVDTSTSM
GRFFFRVMAS LAELERDIII ERTNSGLKAA RVRGKKGGRP SKGKLSIDLA LKMYDSKEYS IRQILDASKL SKTTFYRYLN KRNA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn551 2919 2275-5193 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Comment:   identical to tnpA (Tn917)
Protein Sequence:  
MAMKRILTTS QREQLLSVDH LSEEDFKAYF SFSDYDLEVI NQHRGKVNKL GFAIQLCLAR YPGCSLSNWP IKSTRLTSYV SRQLHLDAID LNSYDHRNTR
ANHFNEILEV FNYHRFGSAN TQKQLIEYLI ELALENDDSI YLMKKTIDFL TRKRIIFPSI ATLEDIISRC RDKAENNLFS ILLCSLTDIQ IEKLESLFQI
YEETKITKLA WLKDIPGKAN PESFMSICKK VEVIASMGLG TINVSHINRN RFLQLARLGE NYDAYDFSRF ELEKRYSLLI AFLVNHHQYL IDQLIEINDR
ILASIKRKGT RDSQEQLKEK GKLATKKLEH YASLIDALHF AKDNDSNPFD EIERIMPWED LVQDGEEAKK ITGNKNHGYL EMVRNKANYL RRYTPMLLRT
LSFKATPAAN PVLMALTQLT DLHNSGKRKI PADTSTDFVS KKWKSLVRPE EGKIDRSYYE LVAFTELKNN IRSGDISVEG SMIHRNIDDY LVDLSACIDS
ETIPDTFEDY LKDREIILDL QLQFYSTVDK RISRANLKKL EKVTPSEAEI YRKKLYSIIP KIRLSDLLIE VDSWTNFSQE FSHDSTGKPP SEQERKIIFA
ALLGLGMNIG LEKMAQSTPG ISYSQLANAK QWRFYKEALT RAQSVLVNYQ LKLPVADFWG EGKTTASDGM RVPVGVSALK SDVNPHYKSM EKGATMIRSI
NDRHTTHHIE VASTNTREAT HTLDGLLYHE TDLDIEEHFT DTNGYSDQVF GMTALLGFDF EPRIRNIKKS QLFSIKSPSY YPNLSEDISG KINVKIIEEN
YDEIKRIAYS IQTAKVSSSL LLGKLGSYAR KNRVALALRE LGRIEKSIFM IDYITDSELR RRITHGLNKT EAINALAREL FFGRRGKFME RDIRRQLQSA
SALNVLINAI SIWNAVYLQA AYNYLVKIDP EVTKYMKHVS PINWEHITFL GEYKFDLLSI PKHLRELNIK NK

 References     

1.Pattee PA, Thompson NE, Haubrich D, Novick RP. Chromosomal map locations of integrated plasmids and related elements in Staphylococcus aureus. Plasmid. 1977 Nov;1(1):38-51. PubMed ID: 618184
2.Tomich PK, An FY, Clewell DB. A transposon (Tn917) in Streptococcus faecalis that exhibits enhanced transposition during induction of drug resistance. Cold Spring Harb Symp Quant Biol. 1979;43 Pt 2:1217-21. PubMed ID: 114353
3.Tomich PK, An FY, Clewell DB. Properties of erythromycin-inducible transposon Tn917 in Streptococcus faecalis. J Bacteriol. 1980 Mar;141(3):1366-74. PubMed ID: 6245068
4.Khan SA, Novick RP. Terminal nucleotide sequences of Tn551, a transposon specifying erythromycin resistance in Staphylococcus aureus: homology with Tn3. Plasmid. 1980 Sep;4(2):148-54. PubMed ID: 6100928
5.Perkins JB, Youngman PJ. A physical and functional analysis of Tn917, a Streptococcus transposon in the Tn3 family that functions in Bacillus. Plasmid. 1984 Sep;12(2):119-38. PubMed ID: 6095351
6.Wu SW, de Lencastre H, Tomasz A. The Staphylococcus aureus transposon Tn551: complete nucleotide sequence and transcriptional analysis of the expression of the erythromycin resistance gene. Microb Drug Resist. 1999 Spring;5(1):1-7. doi: 10.1089/mdr.1999.5.1. PubMed ID: 10332716