Transposon
Name: Tn5501
Family: Tn3        Group: Tn3000
Evidence of Transposition: Yes
 Host     

Host Organism:Delftia sp. KV29 Molecular Source:plasmid pKV29
Date of Isolation:1998

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTTCTAAGCCGGAACCGCCGAAAATTCCGTCAGCC
IRR (Length: 38 bp)GGGGTTCTAAGCCAGAACCGCCGAAATTTCCGTCATCC

 Sequence     
DNA SequenceLength  7928 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTTCTAA GCCGGAACCG CCGAAAATTC CGTCAGCCGA TCAACGTGGC TTGTCCCGCG CCCGGTCGAT GGGGTAGACC CAACAGTCGT GTCACTAGCC 100
GCCATTTCGA TCACGGCAAT GCCAGCCGGA CGTCACGTCC AGATTGTTCC GGTCTGGATG AGGCCGACTG ACGTCTCGGA TGACGGGTGG CATACAACTG 200
CTGTGAGTCC TGCAGGGGGG CAGCTGCCTG ACCGGACGGC GAGCATCAGC CCATCTCATG TATTAGTCAT GTCAGCTTTG ACACTGCGCA CGCGACGGCA 300
CCCGACCCGT TGCAGACCCC CAGACATATG GAAAGCTGAC GCTCAACGTG GAGTTAGCCG GCGCGGCGCG GCTTCATCGC GCAGCGTCCG TGTTGATGGA 400
TGGGTTAGGG AAATCCTGCA AAACCTCGTG AACAACCTGA TAGACGCGGC CCAGTCATGG CATGCTCACA GGCATGAAGC AAAGCAGCCT TGAGCTGAAC 500
CTGAGCACCA GGAAGACCCG CAAACAAGAG CTGCTGGCCC AGATGGATCG GGTGGTTCCC TGGGCCGCCT TGGTCGAACT CATTGCGCCC TATTACCCCG 600
AAGGCAAGAA CGGGCGCCCA CCCTTTGCTC TGGAGGCCAT GCTGCGCGTT CACTGCATGC AGCAGTGGTT CACCCTGTCG GATCTGGCGA TGGAAGAAGC 700
CTTCTTTGAC ACCCCGATCT ACCGGGAGTT TGCCGGGCTT GATGCACATG GCCGAATGCC CGATGAGAGC ACCATCTTGC GCTTTCGCCA CCGGCTGGAG 800
AAACACAGGC TGGCCGAGCA GATTCTGGCC ACCGTCAACG ACCTGTTGGC AGCCCGGGGC TTGCTGCTCA AGGCCGGTAC TGCGGTGGAT GCCACCTTGA 900
TTGCAGCGCC CAGCTCCACC AAGAACAAGG ACAGAAAGCG CGATCCGGAG ATGCATTCGA GCCAAAAGGG CAACGAGTGG CACTTTGGCA TGAAGGCCCA 1000
CATCGGCGTG GATGCAGACT CAGGCTTGGT ACACACCGTC ATTGGCACCT CGGGCAACGT GGCCGACGTC ACTGAAGGCA ACAGCTTGCT CCATGGTGAG 1100
GAAACGGATG CCTTTGGTGA TGCTGGCTAC CAAGGCGCAC ACAAGCGCCC GGATGCCAGG AAGGATGTCA CCTGGCATGT GGCGATGCGC CCAGGCAAGC 1200
GCAAAGAGCT GGACAAAGAG AACAACCCCG TTGATGCGCT CATAGACCAA GTGGAGAAGA TCAAGGCCAG CATCCGGGCC AAGGTGGAAC ACCCCTTCAG 1300
GGTGATCAAA CGACAGTTTG GCTATACCAA GGTGCGTTAC CGGGGGCTCA AGAAGAACAC GTTGCAGCTC AAGACGCTGT TTGCACTATC GAACCTGTGG 1400
ATGGTGCGCC ATCAATTGCT GGGGGCGCAG GGATGAGTGC GCCTGAAATC AGGCAAACGG TCGCCAAAGC GGCGAAAAGG GCCTCAGGGC TCCATAAAAG 1500
CAGACCCACC TGAGGCAAAA AAGGCAGCCT TTGCGCCATT CTGAAAACGG CGGCCATGTA GCACTCACGA GTTCGAGTTG TTCAGGACAT CCTTAGAACT 1600
CTCTGGGGCA CACATTTGAG AAAGACTATT TTTCAGCCAA CGCAAAACCC GCGTTGCCAG ATGCAACCAC TGAGACAAAT ACAAACGGCA CTGGACTAGT 1700
ATTTAGAGCG CCATGCACTT GGCCAGGTTT TGCTATGGCA ATATCTCCAG CCTTTAGATG AGCGACTTTG CCGCCTCCTT GGTAATACTC AGCCTCTCCA 1800
GAGATAACCG TCCAAGTATC TTGGCCGTCC GGGTGAACAT GAGCGGTTAT TTCTTGCCCA GGATGGGCAT GCCAAACAAC AACTGCTGAG TCCTTGGTTT 1900
CCAGAACCAC TGAACGAATT GGTTCGCCGT CAGACGGACG AATATATTCT GTTACCGAAA ATATTCTTGA TTCCATTTCC ATATCCACTC CAAAAATCAA 2000
TTTGGCTTGA GAAGTTATTA CAGAACAACT GTATCCGAGA GTTCTACGTT GCCGATAACC GGCCCGAAAC GGCGGCGCAA CGCGCCGCTG TTGGGGGGCT 2100
TTGTTGCACA AGTCGAAAAA AGTCGATATG ACCCCTACCC CAGACGCAGC TACGCCACAG CAGGCACCGC CACCGTTGTG GGGCACCCAA GTTGCGTGAA 2200
TCGGTTGAGC AAGGCCACCC GCACATGCAA CTCTGTCACC TGACGCTCGA ATGTGCGGGC CATCACCCGC TCGCCCAGGC GCTTGAAGCA ATGCATCTTG 2300
GTCTCCACCA GACTCCTGCG GTGGTAGCCG CTCCACTTCT TCCAGATACG CCAACCCAGC CTCTTGCACG CCAGCACCGC TTCGTTACGC ACCATGGCCC 2400
CAGGCGTTTG GGACTTCCAC ACCTGGGCGT TCTTGCGCGG CGGGATGATC GCTTGTGCCC CACGTTCCAT GATCGCCGCA TGGCACGCCT TGGTGTCGTA 2500
TGCACCGTCG GTACTCACAC TGGCGATCGG TTCACCCGGT GGTATCTGCC CCAGCAGCCC AGGCAGCATG GGCGCGTCGC CCACGCTGTT GTCTGTGACT 2600
TCAATGGCCC GTATCTCCAG CGTGCTGGCA TCAATACCCA GGTGCACTTT GCGCCACTGG CGCCGGTACT CTGCCCCGTG TTTCTTGCGT TTCCACTCCC 2700
CCTCGCCCAG GAACTTGATG CCGGTGCTGT CCACCAGCAG GTTCAGCGCG CTGGTAGAGG CTCGGTAGGG CAGTTGCACC TGCAGTGTCT TTTGGCGTCG 2800
GCTCACGGTG CTGAAGTCGG GCACCCTCCA ATCCAGGTCT GCCAGGTGCA GCAGGCTTTG CACCAGTCCC AGGCTTTGGC GCAGGGCCAA ACCAAAAAGG 2900
CATTTGATGC TCAGGCAGAA CTGGATGGCG GCGTCGCTGA ACACGTGCTG CCTACCCCGC TTGCCGCTGG CGGGTGCGTA CCACTGCATG TCTTTGTCCA 3000
GCCAGATCGC CAGCGAGCCC CGGGCTTTGA GCGCTGCGTT GTACGCTGCC CAGTTGGTGG TCTTGTAGCG GGGCTTGGCG CTCTTGGATT CACTCATGTC 3100
CCGAGGCTAA CAGTTCGGGG GGCAGGGTTT GTGCAACAGA GCCGCATCAT CGCCTCCGCG CAACTGCGAC GACCGCCCGC AGCAATCACA TTGAACTTTC 3200
GAATCGAAAC TGCTGAAGCG AACCTACGCG GACGTACGGC CGCAGTCTGT GCGCTGCCGG ACGGAGCGCT GCCAATTTGC GCCTACTGGC AGGCTGTGAG 3300
TGCGCGGATG GGCCAGCGAC CTCCCTTCAT AGAGGGAGCG AAGCAGGTCA GAGACACTAT TGAACGTCCG CTACCGGGAA GATGCTTGAC CGTCCGCAAC 3400
TGGCCGCCTG CCGCCGACCG CGGTCTGGCT CGAAAGCAGT CTGTCAACGC GCCGTTTCAT TGTTGCCATG ATCATCTCTT AATCGCGCAC AGGCGGCCAC 3500
AGGCGGGCAG TATGAACCAG CGTCAGTATC CACACCGTTT CGCCGTCGAT CTGATACACC AGGCGATAGC TTTCGTGCGG GATCAACTCG CGGGTCCCGG 3600
GAATCTTTCC CGGCTTGCCC AGCATGGGGT GCTGGATCAA GCGGGCGGCC GCGTCGCTGA AAATCTCATC CATCCGGGCC GCCGCGCGCG GATTGTCGGC 3700
TGCGATGTAG TCCCACACAT CGGCACGGTC TTGCTGCGCT TCGGGCGTCC AAACAACCCT CACGCCTGGC TCGCCACACT GGCACGCCGT GCGGCGAATT 3800
CGGCCTCAAC TTCATCGTTC GACCGCCCCA ATCCAGCGCG CATCGAAGCC CGGCCGGCTT CGACCTTGCG GCGCAGGAAC TCGTCGTACT CGCGCGACTC 3900
GCGCTGGCGC TGAACGAACT CGCGCATCAG CTCGCGCAGC ACTTGCGACG CCGGGCGATG GGCCGCCTCG GCTTCGGCCA TAAACTCGGC GCGCAACTCA 4000
GGCTCCAGCT TCATCGTGAA AACGGCTTGT TTTGACATGA TCGGGGCCTC CTGCCACTTG ATACTAACAA AGTATATACG CCGTCATTAC TAAGCGCTAT 4100
TCACAGAACG CTGCAAGGCG GGCGTGCGCT AGGCCAAGGC CTGTCGGAAA ACATTTGTTT TTCGACAGGC CTTCAACGGT CCTCTGCACC AACCTCCGAG 4200
TGGCCGCAAA ATTGTGCGGA AAACTCTGTC GCCAGACGCT ACCATACGGA AACCTCGTCT TAATGGTTTT CCGCTTATGT TGGTAGGTTA CATGCGCGTG 4300
TCGTCGGACT CCGACCGCCA GAGCACGAAC TTGCAGCGCG ATGCGCTGCT CGCCGTCGGC GTCGATGCGC GGCATCTGTT CGAGGATCAT GCTTCCGGCG 4400
CGAAGGACGA CCGCGCGGGC CTGGCGCGGG CGCTCGAATT CGTTCGCCCT GGCGACGTGT TGGTCGTGTG GAAGCTCGAC CGGCTCGGCC GTTCGTTGTC 4500
GCACTTGCTC GCCATCGTGA CCTCGCTCAA GAAAAAGCAG GTGGCGTTCC GCTCGCTGAC GGAGAACCTG GATACCACGA CGCCCTCGGG CGAGTTTCTG 4600
TTCCAGGTGT TCGGCGCGCT CGCGCAGTAC GAACGCGCCT TGATCCAGGA ACGTGTCGTC GCCGGTCTGG CTGCCGCCCG CAAACGCGGC CGGATCGGCG 4700
GCCGGCCGCA GGCGATCACC GGCGAGAAGC TGGAGGCCAT CGTCGCTGCG CTCGATGGCG GCATGTCCAA GGCGGCGGTG TGCCGCAACT TCGGCGTCAA 4800
GCGAACCACG CTGATCGAGA CCCTGGCACG GGTTGGTTGG ACGGGCTCTC GTGGAGCGTC ATCGCGATGA CGACCAAGAG CGAACGATTG ACCGTCCTGT 4900
CGGACGCCGA GCAGGAAGCC CTGTACGGCC TGCCGGACTT CGACGACGCC CAGCGGCTGG AATACTTGGC GTTGACTGAA ACCGAACTGG CGCTCGCCAG 5000
CAGCCGGCCT GGTCTCCATG CCCAGGTCTA TTGCATCTTG CAGATCGGTT ACTTCAAGGC CAAGCATGCC TTCTTCCGCT TCGACTGGAG TGAGGTCGAG 5100
CACGATTGCG CCTTCGTGCT GAGCCGCTAC TTCCACGGCG AGTCCTTCGA GCACAAGCCA ATCTCCAAGC ACGAGCACTA CACCCAGCGC GAGTGGATTG 5200
CCGATCTGTT CGGCTACCGG CCGTGGGCGG CCGAGTTCCT GGCGCAGCTC GCGCAGCAGG CCGCGCAGAC CGTGCGGCGC GACGTGATGC CGGGGTTCAT 5300
CGCCGCCGAG CTGATCGTCT GGCTAAACGA GCACAAGATC ATCCGGCCCG GCTATACCAC CCTGCAAGAG CTGGTGAGCG AAGCCCTGTC CGCCGAGCGT 5400
CGGCGGCTGG CTGGCCTGCT GTCGGAAGTG TTGGACGAAT CGGCCAAGGC CGCGCTGGGT CGGCTTCTAG TGCGTGACGA CACCCTGTCG CAATTGGCGG 5500
CGCTCAAGCA GGACGCCAAG GACTTTGGCT GGCGTCAGAT GGCCCGCGAA CGCGAAAAGC GCGCCACGCT GGAGCCGCTG CACCGGATCG CCAAGGCGCT 5600
GCTGCCCAAG CTCGGCGTCT CGCAGCAGAA TCTGCTGTAC TACGCCAGCC TGGCGAACTT CTACACCGTC CACGATCTAC GCAACCTGAA GGCCGATCAG 5700
ACCTACCTCT ACCTGCTTTG CTATGCCTGG GTGCGCTACC GGCAGCTTTC CGACAACCTG GTCGATGCGA TGGCCTACCA CATGAAGCAG TTGGAGGACG 5800
AAAGCAGTGC GGGCGCAAAG CAATCCTTTG TCGCCGAGCA GGTGCGCCGT CAGCAAGACA CACCGCAGGT CGGCCGCCTG CTGTCGCTTT ACATCGACGA 5900
CAGCGTGCCC GATCCCACGC CGTTCGGCGA TGTGCGCCAG CGCGCCTACA AAATCATGCC CCGCGATACG CTGCAAACCA CCGCGCAGCG CATGAGCGTG 6000
AAGCCGGTGA GCAAGCTGGC TTTGCACTGG CAGGCGGTGG ACGGCCTGGC TGAGCGCATC CGCCGCCATC TTCGGCCGCT GTATGTCGCG CTCGACCTCG 6100
CTGGCACTGA TCCGGGCAGC CCGTGGCTCG TGGCGCTGGC CTGGGCCAAG GACGTGTTCG CCAAACAGCA GCGCCTATCG CAACGGCCGC TCGCCGAATG 6200
TCCAGCGGCC ACGCTGCCGA AACGCTTGCG ACCGTACCTG CTGACCTTCG ATGCCGATGG CAAGCCGACG GACCTGCATG CCGACCGCTA CGAGTTCTGG 6300
CTGTACCGCC AGGTCAGGAA GCGCTTCCAG TCGGGTGAAC TCTACCTCGA CGACAGCTTG CAGCACCGGC ATTTTTCCGA CGAGCTGGTT TCGCTGGATG 6400
AGAAGGCCGC CGTGCTGGCG CAGATCGACA TCCCGTTCCT GCGGCAGCCA CTCGATGCCC AGCTCGATGC GCTCGCGACC GAGCTGCGCG CTCAGTGGCT 6500
GGCCTTCAAC CGCGAGCTGA AGCAGGGCAA GCTGACGCAC CTAGAATACG ACAAGGACAC GCAGAAGCTG ACATGGCGCA AGCCCAAGGG CGAGAACCAG 6600
AAGGCGCGCG AGAAGGCGTT CTACGAGCAA CTGCCGTTCT GCGACGTGGC CGACGTGTTC CGCTTCGTCA ACGGCCAGTG CCAGTTCCTG TCGGCGCTGA 6700
CGCCTTTGCA GCCGCGCTAT GCGAAGAAGG TCGCCGACGC CGACAGCCTG ATGGCGGTCA TCATCGCGCA GGCGATGAAC CACGGCAACC AGGTCATGGC 6800
ACGCACCAGC GACATCCCGT ACCACGTGCT GGAGAGCGCC TACCAACAGT ACCTGCGCCA CGCAACGCTG CACGCGGCCA ACGACTGCAT CAGCAACGCC 6900
ATCGCCGCGC TGCCGATCTT CCCGTACTAC TCGTTCGACC TCGATGCACT GTACGGTGCC GTCGATGGTC AGAAATTCGG CGTCGAGCGG CCGACCGTGA 7000
AAGCGCGCCA CTCGCGCAAA TACTTTGGGC GCGGCAAGGG CGTGGTCGCC TACACGCTGC TGTGCAACCA CGTGCCGCTC AACGGCTACC TGATCGGCGC 7100
GCACGATTAC GAGGCCCATC ACGTGTTCGA CATCTGGTAT CGCAACACGT CGGACATCGT GCCGACCGCG ATCACCGGCG ACATGCACAG CGTCAACAAG 7200
GCCAACTTCG CTATCCTGCA CTGGTTCGGC CTGCGTTTCG AGCCGCGCTT CACCGACCTT GGCGATCAGT TGAAGGAACT CTACAGTGCC GACGATCCGG 7300
CGCTGTACGA TCAGTGCCTG ATCCGGCCGG CCGGGAGAAT CGACCGCGAT CTCATAGTCA GCGAGAAGCC GAACCTCGAC CAGATTGTCG CCACGCTCGG 7400
ACTGAAGGAG ATGACGCAGG GCACGCTGAT CCGCAAGCTA TGCACCTACA CCGCGCCGAA CCCCACGCGG CGCGCGGTGT TCGAGTTCGA CAAGCTCATC 7500
CGCAGCATCT ACACGCTGCG CTACCTGCGC GATCCGCAAC TGGAGCGCAA CGTTCACCGC TCACAGAACC GCATCGAGTC CTATCACCAG CTACGCTCAA 7600
CCATCGCCCA GGTCGGCGGC AAGAAGGAAT TGACCGGGCG CACCGACATC GAAATTGAGA TCAGCAACCA GTGCGCCAGG CTGATCGCCA ACGCGGTCAT 7700
CTTCTACAAC TCGGCCATCC TCTCGCGGCT GCTGATGAAG TACGAGGCGA GCGGCAACGC CAAGGCGCAC GCTCTCCTGA CCCAGATATC GCCGGCGGCC 7800
TGGCGGCACA TCCTGCTGAA CGGGCATTAC ACCTTCCAGA GCGACGGCAA GATGATCGAC CTGGATGCGC TCGTGGCGGG GCTGGAGCTG GGATGACGGA 7900
AATTTCGGCG GTTCTGGCTT AGAACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 4139-4269 131 GCCTGTCGGA AAACATTTGT TTTTCGACAG GCCTTCAACG GTCCTCTGCA CCAACCTCCG
AGTGGCCGCA AAATTGTGCG GAAAACTCTG TCGCCAGACG CTACCATACG GAAACCTCGT
CTTAATGGTT T
res_site_I 4139-4167 29 GCCTGTCGGA AAACATTTGT TTTTCGACA
res_site_II 4201-4244 44 TGGCCGCAAA ATTGTGCGGA AAACTCTGTC GCCAGACGCT ACCA
res_site_III 4245-4269 25 TACGGAAACC TCGTCTTAAT GGTTT

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnp ISDlsp1 462-1436 Transposase   +
cupin2 Tn5501 1626-2111 Passenger Gene Other -
tnpA ISGNB1-1 2150-3097 Transposase   -
parE Tn5501 3479-3763 Passenger Gene Toxin -
parD Tn5501 3760-4038 Passenger Gene Antitoxin -
tnpR Tn5501 4292-4870 Accessory Gene Resolvase +
tnpA Tn5501 4867-7896 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp Tnp ISDlsp1 975 462-1436 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MLTGMKQSSL ELNLSTRKTR KQELLAQMDR VVPWAALVEL IAPYYPEGKN GRPPFALEAM LRVHCMQQWF TLSDLAMEEA FFDTPIYREF AGLDAHGRMP
DESTILRFRH RLEKHRLAEQ ILATVNDLLA ARGLLLKAGT AVDATLIAAP SSTKNKDRKR DPEMHSSQKG NEWHFGMKAH IGVDADSGLV HTVIGTSGNV
ADVTEGNSLL HGEETDAFGD AGYQGAHKRP DARKDVTWHV AMRPGKRKEL DKENNPVDAL IDQVEKIKAS IRAKVEHPFR VIKRQFGYTK VRYRGLKKNT
LQLKTLFALS NLWMVRHQLL GAQG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
cupin2 Cupin2 Tn5501 486 1626-2111 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   Cupin 2 conserved barrel domain protein
Protein Sequence:  
MCNKAPQQRR VAPPFRAGYR QRRTLGYSCS VITSQAKLIF GVDMEMESRI FSVTEYIRPS DGEPIRSVVL ETKDSAVVVW HAHPGQEITA HVHPDGQDTW
TVISGEAEYY QGGGKVAHLK AGDIAIAKPG QVHGALNTSP VPFVFVSVVA SGNAGFALAE K

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA ISGNB1-1 948 2150-3097 -
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MSESKSAKPR YKTTNWAAYN AALKARGSLA IWLDKDMQWY APASGKRGRQ HVFSDAAIQF CLSIKCLFGL ALRQSLGLVQ SLLHLADLDW RVPDFSTVSR
RQKTLQVQLP YRASTSALNL LVDSTGIKFL GEGEWKRKKH GAEYRRQWRK VHLGIDASTL EIRAIEVTDN SVGDAPMLPG LLGQIPPGEP IASVSTDGAY
DTKACHAAIM ERGAQAIIPP RKNAQVWKSQ TPGAMVRNEA VLACKRLGWR IWKKWSGYHR RSLVETKMHC FKRLGERVMA RTFERQVTEL HVRVALLNRF
TQLGCPTTVA VPAVA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
parE ParE Tn5501 285 3479-3763 -
Class:   Passenger Gene
Sub Class:   Toxin
Target:   DNA gyrase
Sequence Family:  ParE_toxin (Pfam:PF05016)
Protein Sequence:  
VRVVWTPEAQ QDRADVWDYI AADNPRAAAR MDEIFSDAAA RLIQHPMLGK PGKIPGTREL IPHESYRLVY QIDGETVWIL TLVHTARLWP PVRD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
parD ParD Tn5501 279 3760-4038 -
Class:   Passenger Gene
Sub Class:   Antitoxin
Sequence Family:  parD (PDB:4Q2U)
Comment:   RelB
Protein Sequence:  
MSKQAVFTMK LEPELRAEFM AEAEAAHRPA SQVLRELMRE FVQRQRESRE YDEFLRRKVE AGRASMRAGL GRSNDEVEAE FAARRASVAS QA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn5501 579 4292-4870 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MRVSSDSDRQ STNLQRDALL AVGVDARHLF EDHASGAKDD RAGLARALEF VRPGDVLVVW KLDRLGRSLS HLLAIVTSLK KKQVAFRSLT ENLDTTTPSG
EFLFQVFGAL AQYERALIQE RVVAGLAAAR KRGRIGGRPQ AITGEKLEAI VAALDGGMSK AAVCRNFGVK RTTLIETLAR VGWTGSRGAS SR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn5501 3030 4867-7896 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MTTKSERLTV LSDAEQEALY GLPDFDDAQR LEYLALTETE LALASSRPGL HAQVYCILQI GYFKAKHAFF RFDWSEVEHD CAFVLSRYFH GESFEHKPIS
KHEHYTQREW IADLFGYRPW AAEFLAQLAQ QAAQTVRRDV MPGFIAAELI VWLNEHKIIR PGYTTLQELV SEALSAERRR LAGLLSEVLD ESAKAALGRL
LVRDDTLSQL AALKQDAKDF GWRQMARERE KRATLEPLHR IAKALLPKLG VSQQNLLYYA SLANFYTVHD LRNLKADQTY LYLLCYAWVR YRQLSDNLVD
AMAYHMKQLE DESSAGAKQS FVAEQVRRQQ DTPQVGRLLS LYIDDSVPDP TPFGDVRQRA YKIMPRDTLQ TTAQRMSVKP VSKLALHWQA VDGLAERIRR
HLRPLYVALD LAGTDPGSPW LVALAWAKDV FAKQQRLSQR PLAECPAATL PKRLRPYLLT FDADGKPTDL HADRYEFWLY RQVRKRFQSG ELYLDDSLQH
RHFSDELVSL DEKAAVLAQI DIPFLRQPLD AQLDALATEL RAQWLAFNRE LKQGKLTHLE YDKDTQKLTW RKPKGENQKA REKAFYEQLP FCDVADVFRF
VNGQCQFLSA LTPLQPRYAK KVADADSLMA VIIAQAMNHG NQVMARTSDI PYHVLESAYQ QYLRHATLHA ANDCISNAIA ALPIFPYYSF DLDALYGAVD
GQKFGVERPT VKARHSRKYF GRGKGVVAYT LLCNHVPLNG YLIGAHDYEA HHVFDIWYRN TSDIVPTAIT GDMHSVNKAN FAILHWFGLR FEPRFTDLGD
QLKELYSADD PALYDQCLIR PAGRIDRDLI VSEKPNLDQI VATLGLKEMT QGTLIRKLCT YTAPNPTRRA VFEFDKLIRS IYTLRYLRDP QLERNVHRSQ
NRIESYHQLR STIAQVGGKK ELTGRTDIEI EISNQCARLI ANAVIFYNSA ILSRLLMKYE ASGNAKAHAL LTQISPAAWR HILLNGHYTF QSDGKMIDLD
ALVAGLELG

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
ISDlsp1-JN648090.1 ISDlsp1 Insertion Sequence 409-1592 1184
ISGNB1-1-EF628291 ISGNB1 Insertion Sequence 2097-3143 1047

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRL ISDlsp1 409-428 GGAAATCCTG CAAAACCTCG
IRR ISDlsp1 1574-1592 GCTCAACAAG TCCTGTAGG
IRR ISGNB1-1 2097-2111 GGCTTTGTTG CACAA
IRL ISGNB1-1 3129-3143 AACACGTTGT CTCGG

 References