Transposon
Name: Tn5393.4       (Synonyms: Tn5393d)
Family: Tn3        Group: Tn163
Evidence of Transposition: no
 Host     

Host Organism:Alcaligenes faecalis Molecular Source:plasmid pFL424
Place of Origin:Italy Date of Isolation:2005
Other Geographic Information:clinical isolate from Varese University Hospital (northern Italy) isolated in 1998

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 81 bp)GGGGTCGTTTGCGGGAGAGGGCGAAATCCTACGCTAAGGCTTTGGCCAACGATATTCTCCGGTAAGATTGATGTGTTCCCA
IRR (Length: 40 bp)GGGGTCGTTTGCGGGAGGGGGCGGAATCCTACGCTAAGGC

 Sequence     
DNA SequenceLength  14184 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCGTTT GCGGGAGAGG GCGAAATCCT ACGCTAAGGC TTTGGCCAAC GATATTCTCC GGTAAGATTG ATGTGTTCCC AGGGGATAGG AGAAGTCGCT 100
TGATATCTAG TATGACGTCT GTCGCACCTG CTTGATCGCG GCCGCGATAG CTAGATCGCG TTGCTCCTCT TCTCCATCCG CGTTCCAAGC TGCGGAAAGG 200
CACCCATAAG CGTACGCCTG GTCGAGCAGG CGACGCGGAT CGACGTCCAG CGCACGAGAG AATGCGTCCG CCATCTGTGC AATGCGTCTA GGATCGAGAC 300
AAAGGTCGTC TCTGTCAGCC GGATCGTAGA ACATATTGGC GGCGCCAAAG CCCACTTCAC CGACCAGACC GACGGGATCT ATCACCAGCC AGCCGCGACT 400
GGAGAACATG ATGTTTTCAT GATGCAGATC GCCATGTAGC CCACGCAGTT CCGAGGCATT GCTCATCATT TGATCGGCTA TAATCGCCGC GTGGACGTAG 500
TCAGTTTGAC AACCTGCGTT TTGATCATCG CGCGCCCGCT GAAACAAAGC TGCAAAGCGA TCCCGGATCG GGAGAAGGGC AGAAGGCAGG GGTTCCTCAG 600
ATGCGGCATA CAGCTTCGCC ATTAGTTCCG CTGCAATTTC GGTCGCCTGG TAGTCGCCGT GCTCGGCAAC GATGTGAGAG AGCATTCGCT CCCCGGCATA 700
TTCGAGCAAC ATCAGATTGT TCTCACGACC GAGCAACCGG ACTGCTCCCC TCCCATTGCG CCATACCAGA TAGTCGGCCC CGCGCAGTTC ATCAGCAATG 800
TCTTCTATAG GTTTCAATCC CTTGACGATT GCAGGAGTCC CGTCTGGCAA TGAAACTTTC CAAACGAGGC TGGAAAAGGT GTCCGCAATG AGAACAGGTT 900
GCGAAACGTG CCAATGAGCA GGAAAAACAG GCGGCATGAA CATCAACCCC AAGTCAGAGG GTCCAATCGC AGATAGAAGG CAAGGCGTTC GCGGTCGGGG 1000
GCTTCGATCC CCAATACATT GAATAGGACA GCGAAGGCGC GCTCTGCTTC ATCTGGCGCT GCCCAGTTCT CTTCGGCGTT AGCAATCATG AGTGCCAAAT 1100
CGGCATAGCG ATCTGCTGTT CCGAGCCGCC CAAGGTCGAT CAGACCCGTG CATTGAAGAG TTTTAGGGTC CACCATGAAG TTCGGCATGC AGGGATCACC 1200
ATGGCAAACA ACCATATCGG TGCGCTCTTG GTCGAGCCGC ACCGGTAGCT CTCGTTCGAC ACGAGCCAAA AGATCGAGCT GCGGCGTACT CTTGTCCTCG 1300
TCCGGTAAGA AGTCGGGATT GACGGCATTG CGGGACACCA CATCAACGGC GCGTCCGAAC ATTCGCGACA GCCTGCGCTC AAACGGACAT TGATCAACCG 1400
ATAGGCTGTG AACAGCGCCA AGTTGCTGCC CCATTGACGG CCACGCTTTG AGCAAATCCG CTCCAGACAG ATCAGCCGCC GGTACTCCCG GAATTGCCGT 1500
TATCACCAAG CATGCACCCT CCTGTTCCTC CTGCCAGTTG ATCACCTCGG GGCAAGCCAC ACCTCGACCT TTGAGCCAAA TGAGGCGGTC ACGCTCTCCA 1600
GCGAGCTCAC CGCGGCGGGA AGCAGGTGCG ATTTTCGCGA AGGCATGCCC GTCACCACGT CGAAAAACAA AATCACCAGA TTCTCCGCCT CTGACAGGCA 1700
ACCAGTCAGA ATGCGATTCA CCAAAAAAAA TATTAGTTCG ATTCAATGGA GGTTCCTTCA GTTTTCTGAT GAAGCGCGGA GGTGGCTCAA CCTGCGAAAA 1800
GAGGTGGTGT TTCAAAAAGT ATGCTGAAAC AAAGCAGGTT GAATTTTGAT AAAATAGAGA AATGCGAATA ACTCTAGAAA TCAAATGTCC AACCTGCCTC 1900
AGTGACAGTA TAAAGAAAAA TGGCATCAAA GTAGATGGGA AACAAAACTA TCAGTGCAAA GACTGTAAAC GTCAGTTTAT TGGTGACCAT GCTCTGAGCT 2000
ATCTAGGATG TCATTCAGGC ATTACTCGAA AAATATTACA GTTGATGGTC AGAGGTAGTG GTATACGAGA TATCGCTGAA GTTGAGCGAA TCAGTATCGG 2100
TAAAGTTTTA CGTACTTTAA CCGAATCGAC CTACCAAATT CAGCCTAAAC AAAGTCATTA TGAGTCTCTT GAAGTTGATG AGTTTTGGAC TTTTGTGGGA 2200
AATAAAAATA ATAAACAATG GCTTATTTAC GCCTCATAGG TATGATCTTT AGGAGTTGAA GAGGTGCTTC ATTCGTGATC TAATTGATTT ACCAGAAAAA 2300
AAAGATCACC TTTGCAGGAA AAACGAATGA AGCAACAACA AGATACCCGA TTTTCGAGCG CTTTTGAACG ATTTTTTTCA GCAGCAGAGC TTGATGCGCT 2400
TGGCAAGCAA TCAGGCTTTA TGAAGCGGCG GCGGCAGGTG ACGCCACAGA AGTTTTGCAT GGCGCTGGTC AGTGCGCTGG GTGCAGGAAC AACGAATTCG 2500
ATTGCCGATG TGCACCGGCA ATTTAACCAT ATGCACTCAA CGGACATAAA GCTTAAACCC TTTCATAAAC AGTTGGTTAA AATGGCTGCT CCTGAATTTA 2600
TGCGTGAAGT GTTTGAAAAG GCGCTGGCTC TGCATCTCCC TGATATGTTT GCTATCAGGA ATAAATATCA GGACATGTTC AAGCGCATTA TTTTACAAGA 2700
TGGCACCAGT TTCGCTGTAC ATGACGACTT AATGTTCTAT TTTCCAGGAC GTTTTAATGA AAATAGTCCG GCAGCGGTTG AGTTACATGT CACTTATGAC 2800
GTGTTTAAGG GGCAACCTGA CGGTGTTAGT CTGACTGAGG ACACGGCACC CGAGCGGGAC TATTTGCCTT CACCCGCCTC TTTATCAGGC TGCTTATTTA 2900
TGGCAGATGC AGGTTATTTT TCAAAAGCTT ATATACAACA GCTTCAAGAA GCCTGCGCGT ATTTTATTAT GCGGATGTGT AACCGTGTTA ATCCAATGGC 3000
GGTTTGTACT AAGACTCAGC AGATGAAGCC GCTGAAAACA TGGTTAAAAG AATTACCCAA TGCAGGTGTA TTGGATTTAG ATGTGCAGTG GCCGAATGGC 3100
CCGGTTTATC GTTGCGTTGC ATTTGCAGCA TTAGATCACA AAAAACGTCA TGTATTGGTC TGCACTAACC TTGACCGTGA GCAGTTTCCT CCAGCTGTTG 3200
TGGGTGATTT TTATCGTGTT CGCTGGCAAA TAGAATTATT ATTCAAAGAG TGGAAGTCGA TGAATAATTT AAATAAATTC GATACAGGTC ATGCCACAAT 3300
CGTTGAGACA TTAATTTGGG GTAGCTTGCT GGCAGCAACC TTAAAACGCT GGCTAATCAA CGCGGCACAA AAGAAGTATA ACCGGGTGTT GTCGCTTTTT 3400
ACCGGAGCAA AAACTGCCCA TATGTGGTGG ATACCATTTT GCTTTGATAT AGCCATGAGT CGTGGTACGG ATTTAGCAAA AGCCATGAAT AACGCGCTGG 3500
CATTTTTAGC GCAACATTGC CAACGGCAAA ATGTTAAACG AGACCAAATA AGTGGCGTAT ATAAGCTGCT TAATAACACA AATAAATCAT TGGGTTAGGT 3600
CGTTAAGGTC ATACGTATGA AGTGCCTCTA GCGTCGCCTG AATTCGCTCA TGCTGAAGAT TAAAAAACAA TTTATCTTCA GTCACGTCAA AACCTGAGCG 3700
CTTACAAAGC AGTAATTCAA CCAAGGAGTC TGTGCAGGCA TTGATGGTCG TCAGACCGTT TTCCTGATCC CAGCTCAATG GTTTGAATTT CAGTTTCGAA 3800
GCCAAATAAC GATAAATTAC GCCTGAATCA AAAATAACCT GCTCTCCATC CACTAACACA GGCACTTTGC GTGCCGGATT ATGTTGTACC AACACTGAAC 3900
GGCCTTCAGA CTCAAAAATA TTAAGCGCTA CAAACTGATA AGGTTGCCCT GCCAGTACTA AACGTAAACG ACGAACAAAA GGGGAAGCCA CTGAACCTAA 4000
TAACTGCATA ACCTACTCCA ATTTCAAACC ATAGCTTTAG TGTACAACCA GAGTCAGCGG CTTAGATAGT GCTGATAGTC TGTTAATTTG GGCTTAGGGC 4100
AGAAAGCTTT TTCAATTCAA ATTGATACGC AGTCTGAGCA ACCTGCGCAA TGATAGCTTC ATTGGTTCGG CTTGACTCGG CTGAGTCTTT CACAAAAACA 4200
GCAACCAGCA AGGGCCGTCC ATCAGGCAAC AGAATGATAC CTAAATCATT AGTGGCCGCA GTTTTTCCGG CTTTGATACC CGAAGTACCA GTTTTATGTG 4300
CGACCACAGT ACCAGCTGGT AACAAACCTT TTAACCGCTC TGGTCCTGTG GTGGTTTCGA CCATCCACTT CCATAACAAA GCCTGCGAGG TTTCAGACAG 4400
CTGTGTTTTT TGCTCAAACT TTTTCAGGAT CTCTGCAGCA CCTTTCATCG AGGTCCAGTT TTGATACTGC ACCTGATCAT CGGCGTGCAT CTGCGCTTCA 4500
TTTGCGACCA CAGCGGTCTC CTTTATACCC ATAGACTGGA TATAGTCATG CAAAGCAGCT GGTCCACCAA CCAGTTCAAA TAACAAATCA CAGGCCACGT 4600
TATCGCTGTG CGAGACCGAG TATTGCAGCA GTTGCTGCAC TGGAACACTA AACTCGTCTC CCTGATACGC TTTCATTATC GGAGCCCAGG TATTCTGTAA 4700
AACCTTAGCC CTGTTTACGA TAACGGTCTG ATTTAAATCC AACTTTCCCT GATCAACCTG ATGCAGTACC AACATAGCTA AATGCAATTT AAATACACTT 4800
TGCATTGGGA ATTTTTCAAA AGGATTAATC AGTAAAGGTT CCAGATCGTC AGGCCCCCAC ACTGCAACGC CTACAGTGGC TTTTTTTCCA ATGACTATGG 4900
ATTCAATTTG CTCTTTTAAC AGTGGGGATT GCGCTGAGGT TTCGAATGAA CTAAAAGATA CCATCAGTAG CGTCGAGGCA GTAACTACAG CTTTTATAAT 5000
GACATTCATC GGATTGTCCT TTTCATACGT ATGATCTTTA GGATTTGAAT AGGTGCTTCA TTCGTGATCT AATTGATTTT GCGAATAAAA TAGAACGCCC 5100
AGAGGGCTAA AACGAATGAA GCAAAATCAG ATTACCGCAT TTTCAACCAT TTTTGAAGCC CTGTTTTCAG AGCAACCCTG AATTCATAGA ATAAGCGCAA 5200
CGCTTGAAAC GAGAGGCAGA GAGCCAGCCA CCGGTAGAAT CCAGGCTCTC ACACCGAAGG ATTCAAGCGC AGATGACTAC GCATTACCGG CAGCTGACTC 5300
AGGGACAACG TTACCAGATT GAGGCTGGCT TGAGCGCCGC AGAGAGCCAG GCGAGCATTG CAAAGCGGGT CGGCGTGCAT CCCTCGACGA TCAGTCGCGA 5400
GGTTCGCCGC AACAGCACCC AGAATATCTA CAAGGCTGTT TCTGCGGCCC ATGAAAGTGA TGCTCGTCGA GCGGGTGCGC GCAAGTTTTG CAAGCCGGCG 5500
ACATGGCTCA GCCATCATCT CCCGGTGTGG CTCAAGCATG GCATGAGTCC GGAGCAGATC GCCCAGCGGT TGAAGCAGGA GCAGCCAAGC CGGGCGGTCA 5600
GCCATGAGTG GATTTATCGG TTCATTGCCG CCGAACAGCG CGCCGGTGGT GAGCTTTATA CCTATCTGCG ACATCGCCGA AAGCGCTACC GGAAACGCTA 5700
TGGAAGCCAC GATCGGCGCG GGCAGCTGCG TAATCGCGTG TCAATCAGTG AACGCCCAGC CGAGGTCGAA AGCCGCGAGC GCCTGGGGGA CTGGGAGGGC 5800
GATACGGTAC ATGGACTGGG CGGTAACCTG GTGACCCTGG TTGATCGCAA AAGCGGCTAT CTGAGCGCCT ATCCGGTCAA GCGCAGAACG CGCCGGCAGG 5900
TAACGCGGGC GATCAATCTG ATGCTTCAGG GCCATGCCGC TCACACGCTG ACGCTGGATA ACGGAAGGGA GTTTGCCGGG CATGAACGCA TCGCGCTACG 6000
GAGCCAGTGC CAGGTCTTTT TTGCAGACCC CTATTCATCC TGGCAACGTG GCACCAATGA AAACACCAAC GGTCTGCTCC GCCAGTATTT CCCCAAGGGC 6100
AGCGACTTCA GCAAGCTGAC CGTCGAAGCC GTCAATCGGA CAGTAGCGAG GATCAATCTA CGCCCGCGCA AGCGCTTGGG CTGGAAGACG CCGTACGAAG 6200
TGCATACAGG GGTGAGCGTT GCACTTATGT GTTGAATTCA GGCAACAATT AAATTCACTT GGTGTTCAAA CTCACATGAT TGAACGCTTT CGCCTGATCA 6300
CTCCCGCAAA ACTTTGCCTG GCATTTGTGT GTGCCCTGGG AAGTGGAAAT GCCCGCACAA TCGCTGATAT ACATCGTTAC TTTAACCACT TGCATTCGAT 6400
GTCAGTACGC CTTAAACCAT TCCATAATCA GTTAGTTAAG CTCGGAACTC CTGAATTTAT GCGTCAAGTG TTTGAGCAGG CGCTGGCACT TCATTTGCCA 6500
GCCATGCACA CCTTTTCGGA CGCCTATCGG GGGCATTTCA AGCAGGTACT GTTGCAGGAT GGCACCAGTT TCGCTGTTCA TGACGGCCTC AGCCTGCATT 6600
TCCCCGGGCG ATTCAGTACA CACTCTCCTG CGGCAGTGGA GCTTCACGTG ACCTATGACC TTGAAAAAGC CCAGCCTGTC CGCGTTTCTC TGAGCGAAGA 6700
TACTGCATCT GAACGCGACT ATCTCCCCGT AGCTCAAAGT CTACGTGGTT GTTTGCTCAT GGCCGATGCA GGTTATTTTT CAAAAGCTTA CATTGAATCG 6800
CTCCAAAACG AAGCGGCCAG CTTTGTGCTT CGGATGCCCG CTTCGGTGAA TCCAATGGCG ACTTGCAACC AAACAGGACT CTGTCAGCCG CTACGCAGCT 6900
GGCTGGCCGT ATTGCCTAAG CATGGCGAAT TGGATTTGGA TGTGCAGTGG CCAGATGGTC CGGTGTACCG TTGTGTTTTG TTTGCTTCCA CTGACCATAA 7000
AGACAAACCG GTTTGTCTGT GTACAAATTT GGACCGGCAC ACATTCCCAG CCGCAACAGT GGGCGAATGG TATCGTCTGC GCTGGCAGAT AGAACTCTTG 7100
TTCAAAGAAT GGAAATCGTT GAATAGTTTG AATAAATTTA ATACGGAATA CTCAACGATA GCCGAAACGT TGATTTGGGG AAGTCTGCTG GCGGCAACGC 7200
TCAAGCGTTG GTTAATCAAC GGAGCACAGC AAAAATATCG GCGAGTGTTG TCCATGTTCA GCGGGGCCAA AACAGCCAAT CAGTGGTGGC TTCCCTTTTG 7300
TATAAAATGG GCTTGTTCAG GGATAACTGA AATTGCTGCG GAATTGGGTA AGGTTTTTGC GTTTCTCGCG GAACATTGCC AGAGGGTAAA TGTAAAGCGA 7400
GATCAAAAAT CAGGGGCTTT TAAAGTATTG GAAATCACAT ATGAATCATG ATGTTAGCTC GCTAAAGACA TACGTATGAT TTACGCCTAC CATCGAGAAA 7500
CAGGTGAGAT TGTTGCTTAT GTTTGGGGTA AAAGAGACTT AGCTACAGTT CAACGATTGA AGGCAAAGCT TAAACAATTA GGTATTCACT ACACCCGAAT 7600
TGCAAGTGAT CATTGGGACA GTTTCATAAC TGCTTTTAAA AACTGCAAGC AAAGTATTGG TAAATTTTTT ACTGTAGGTA TTGAAGGTAA TAATTGCAAA 7700
ATAAGGCATC GAATTAGGCG CGGTTTTAGA AGGAGTTGTA ATTTTTCAAA AAAGATTGAA AACCATTTTA AAGCTTTCGA CTTAACCTTT TTTTACATCA 7800
ATAATGGCTT CATTTAATGT CAGCATACTT TTTGAAACAC CACCCAAAAA TTATGTTTAA ACCTATATAA GAAAACACGT TAGGCTTCTT TTATAAGACA 7900
TTTTTAAAAT GATAAATCAA CATAAAAGCC CCTCATCCTC GCCTTCTTTC AAAGTGAGAA GTCGATTTCA ATAGTAATAT GAATCACTCA TTATAAACAT 8000
TCATTCAGTT TAGAAATAAT CTAGAGATAT TATGATTAAC AGCAGAATTA TCGATAAAAC CAAATAAGTA TTGATATTAT TAAAGCTCTT AAGATAATTT 8100
AACATGCGTC ATTTTCCATA AGAATTTAAT AAAATACTAT ATGGCTGACG GATAGATAAA AGACTAGGAA AAGAAAAGCA GACAAAAAAA TACCATCGAT 8200
AATAAAATTG GTTAAAAATG TTGCACGATG AAATTTAAAT AAACTTGTAA AGCTAATAAA TTAACAATTT TATATTCAAA AAAACTTAAA TCACAAGTTA 8300
AGCTAATAAA CAGCTTTAGC TATTTTAAAT AAGTTTATTT TAAAAACCAA AACTTGGATT CATTGGTGAT ATAAAACTTT AAATCAGTAG CTCCACTAAC 8400
TTCTTTCACT TATTTATTTA AAACTTAGCG ACTTAAAAAG ATAACTAAGT ATTTTTAGAT ATTGCTTGGA ATCAATTCAA TTCATCAAGT TTTAAAAAAT 8500
AATTCCTTTT GTCAGGCATA TCGTTTTTTA AATGCTTTAA AAATATTTTA GCAGTTTCCT CAGATACATC CTCTCTTAGG CAACGTTCAA CAAAAGATAT 8600
ATCTACAAAT TCATCTGCTA ATCCAGCACG ACCAAGATCT AAAAAGTAAA TTTCACCAGA TTTATCTATA AAAATATTAC TATCCGTGAT ATCGCCATGA 8700
GAAAAAACCA ATCTTTCTTC AACACGAGTC TCATTTAACT CATTCCAAAG ACTTATGTAA GTTTTATGGT CTCCCCATAA TTCAGCCTCA AAATCATCTT 8800
GATCTATCTC GTCAAGGAGT TGGTTATCAA TAAAAAATTT TGACTCTTTT AACCGATGAT CAATGCTTGA AATAAATGGG CAATCAATAA TAGCAACTGC 8900
ATTTAACTGA TTGAGTGTTT CCTTATAGAT AGCAAGCAAT TCTTGCTCTG TTAAAAAAAG CGCTGAAATT GATTTTGCAT TGATCGCTTT AGTGATCATG 9000
AATTCAAACT GCTCATCCTG AAAAGTCATG ATGAGTTCAG GCACCTTTAA TTTATCAGAG AGCCAACTCA ACATTTTCGC TTCACGAGAG ACACTGTATG 9100
TGGTCTCTGT ATATAAAGTG CTAGATCGCT TAAGAAAAAA AGTTTCATTA TTTCGATTAA AAGAATAAAC ATCCGATGGC GACTGACCAA TTTTATTTGG 9200
CTCTAAAACG CTGTTTCCAA TAAATTGTTG AATAATATTG GGCAATTCCA TCAAGTTTTC CTTTTATTCA GCATTAAAAA CCTCGCAAAT GCGAGGCCTA 9300
GTAAATAGAT GATCTTAATT AGGTTCACTG TAGCAAAAAT ATGGCTTATT CCCTATAGAG GGTCAATACT TCAAACTTTG GTGGTGTTTC AAAAAGTATG 9400
CTGAAACAAA GCAGGTTGAA TTTTGATAAA ATAGAGAAAT GCGAATAACT CTAGAAATCA AATGTCCAAC CTGCCTCAGT GACAGTATAA AGAAAAATGG 9500
CATCAAAAGC AATGTCTTCT ATAGGTTTCA ATCCCTTGAC GATTGCAGGA GTCCCGTCTG GCAATGAAAC TTTCCAAACG AGGCTGGAAA AGGTGTCCGC 9600
AATGAGAACA GGTTGCGAAA CGTGCCAATG AGCAGGAAAA ACAGGCGGCA TGAACATCAA CCCCAAGTCA GAGGGTCCAA TCGCAGATAG AAGGCAAGGC 9700
GTTCGCGGTC GGGGGCTTCG ATCCCCAATA CATTGAATAG GACAGCGAAG GCGCGCTCTG CTTCATCTGG CGCTGCCCAG TTCTCTTCGG CGTTAGCAAT 9800
CATGAGTGCC AAATCGGCAT AGCGATCTGC TGTTCCGAGC CGCCCAAGGT CGATCAGACC CGTGCATTGA AGAGTTTTAG GGTCCACCAT GAAGTTCGGC 9900
ATGCAGGGAT CACCATGGCA AACAACCATA TCGGTGCGCT CTTGGTCGAG CCGCACCGGT AGCTCTCGTT CGACACGAGC CAAAAGATCG AGCTGCGGCG 10000
TACTCTTGTC CTCGTCCGGT AAGAAGTCGG GATTGACGGC ATTGCGGGAC ACCACATCAA CGGCGCGTCC GAACATTCGC GACAGCCTGC GCTCAAACGG 10100
ACATTGATCA ACCGATAGGC TGTGAACAGC GCCAAGTTGC TGCCCCATTG ACGGCCACGC TTTGAGCAAA TCCGCTCCAG ACAGATCAGC CGCCGGTACT 10200
CCCGGAATTG CCGTTATCAC CAAGCATGCA CCCTCCTGTT CCTCCTGCCA GTTGATCACC TCGGGGCAAG CCACACCTCG ACCTTTGAGC CAAATGAGGC 10300
GGTCACGCTC TCCAGCGAGC TCACCGCGGC GGGAAGCAGG TGCGATTTTC GCGAAGGCAT GCCCGTCACC ACGTCGAAAA ACAAAATCAC CAGATTCTCC 10400
GCCTCTGACA GGCAACCAGT CAGAATGCGA TTCACCAAAA AAAATATTAG TTCGATTCAA TGGAGGTTCC TTCAGTTTTC TGATGAAGCG CGGAGGTGGC 10500
TCAACCTGCG AAAAGAAACG AGTTGCTACG TAAGTCCGAG AACATGCTTT CCATGGTCTC TGAGCTCGCC TTTGGGACCG ACATATCGGT AGAGAGTGAC 10600
GCGCTCGATG CCGAGTTCCT TGCAGAGATC GGAAACTGAA GTATCGCGCT GGGCCATGGC GGCTTGCGCG AGACGCACCT GAGCTTTGGT GAGCGCGAAT 10700
TTTCGTCCGC CCTTGCGACC GCGCGCTCTC GCGGAGGCGA GACCCGCCAT GGTGCGCTCT CGGATCAGAT CCCGCTCGAA CTCGGCCAAG GTGGCGAAGA 10800
TTCCGAACAC CATGCGACCG GACGCAGTCG TGGTGTCGAT CTGAGCGCCC TTTCCAGTCA GAACCCGCAG GCCGATCTTG CGGTCTGACA GCTCCTTCAC 10900
CGTGTTGACC AGATGGGCAA GCGATCGTCC GAGGCGATCG AGCTTCCAGA CCACCAGCAC ATCGCCGTCA CGCAATGACT TGAGGCAGGC AGTCAAGCCA 11000
GGGCGATCAT CACGACCGCC GGAAGCAAGA TCATCATAGA TATTGTCCCG TTCGACACCT GCGGCGCGCA AGGCGTCGTG CTGCAGGTCG AGAGACTGCG 11100
AGCCATCGGC TTTGGAGACG CGGGCATATC CGATCAGCAT GTATCACAAA CGTTGGTTTG AGGCGGCGCT TCGGCCACGA TTGCATTGAC CTCTGGAAAT 11200
GTATCTCAAC CAGCTTCATA AACAAAGCGT CTTGAACGCT ATCAGATTTT GAAAAAGGAA CATGTATGCC GCGTCGCGTC ACTCTAACCG ATCGGCAGAA 11300
AGACGCGCTG TTGCGCTTGC CGACTTCACA GACGGATTTG CTCAAGCACT ATACGCTGAG TGATGAAGAC CTTGGGCATA TCAGGCTGCG TCGGCGCGCT 11400
CACAACAGGT TCGGCTTCGC CCTGCAATTG TGTGTCCTGC GCTATCCCGG CCGGGTGCTG GCTCCAGGCG AACTGATCCC TGCAGAGGTC ATCGAATTTA 11500
TCGGAGCGCA GCTTGGCCTG GGTGCCGACG ATCTCGTAGA CTATGCTGCC CGCGAGGAAA CACGGCACGA GCATCTTGCC GAGTTACGGG GGCTCTACGG 11600
CTTCCGCACC TTCTCCGGAC GTGGTGCGAG CGAGCTGAAG GAATGGTTGT TCCGAGAAGC CGAGATGGCG GTGTCGAACG AGGATATCGC CCGTCGCTTC 11700
GTAGCCGAGT GCCGACGCAC CCGCACTGTC CTTCCCGCGA CATCCACGAT CGAGCGGCTT TGTGCCGCGG CTCTCGTCGA TGCCGAGCGA CGCATCGAGA 11800
CGAGGATCGC CAGTCGGCTG CCTATGTCGA TCCGAGAACA GTTGCTGGCA TTGCTCGAGG AGACGGCTGA TGATCGGGTG ACCCGTTTTG TGTGGCTGCG 11900
CCAGTTCGAG CCTGGCTCGA ACTCTTCGTC GGCCAACCGG CTGCTCGACC GGCTCGAATA TCTGCAACGC ATCGATCTCC CCGAGGATCT GCTTGCCGGC 12000
GTTCCTGCCC ATCGGGTGAC TCGTCTGCGC AGGCAGGGTG AACGGTATTA TGCCGACGGC ATGCGCGATC TCCCGGAGGA CAGGCGGCTT GCGATCTTGG 12100
CTGTTTGCGT CTCGGAATGG CAGGCGATGT TGGCCGACGC AGTGGTCGAA ACCCACGACC GGATCGTCGG CCGTCTCTAC CGTGCTTCGG AGCGTATTTG 12200
CCATGCAAAG GTCGCAGACG AAGCGGGGGT GGTGCGTGAC ACCCTGAAAT CCTTCGCCGA GATCGGGGGC GCCCTGGTCG ATGCACAGGA TGATGGCCAG 12300
CCGCTGGGCG ATGTCATCGC GAGTGGGTCA GGGTGGGACG GCTTAAAAAC CCTTGTTGCA ATGGCAACCA GGCTGACCGC CACCATGGCC GACGATCCGC 12400
TCAATCATGT GCTCGACGGT TATCACCGCT TCCGCCGATA CGCTCCACGC ATGTTGCGCC TGCTCGATCT GCGAGCTGCG CCCGTTGCAC TGCCGCTTCT 12500
GGAAGCGGTG ACGGCCCTTC GTACCGGTTT GAACGATGCC GCGATGACCA GCTTCTTGCG GCCCAGCTCG AAATGGCATC GCCACCTTCG GGCCCAGAGG 12600
GCTGGCGACG CTCGCCTATG GGAGATCGCG GTGCTGTTCC ATCTGCGCGA TGCGTTCCGC TCCGGAGATG TCTGGCTTAC TAGGTCCCGG CGCTATGGCG 12700
ATCTGAAACA CGCACTCGTT CCGGCACAAT CCATCGCGGA AGGCGGTCGT CTCGCTGTGC CATTGCGGCC GGAGGAATGG CTGGCAGACC GGCAAGCTCG 12800
CCTCGACATG CGGTTGCGCG AGCTTGGCCG TGCCGCTCGC GCAGGCACGA TCCCGGGCGG GTCGATTGAA AACGGCGTTC TGCATATCGA GAAACTCGAA 12900
GCCGCCGCGC CGACAGGCGC CGAAGATCTG GTGCTCGATC TCTACAAGCA GATCCCGCCC ACGCGCATCA CCGATCTCCT GCTGGAGGTG GATGCGGCGA 13000
CCGGCTTCAC CGAAGCGTTC ACCCATCTGC GCACAGGAGC ACCCTGCGCT GACCGGATCG GGCTAATGAA CGTTATCTTG GCGGAAGGGA TCAACCTCGG 13100
CTTGCGCAAA ATGGCGGATG CGACAAACAC CCACACCTTC TGGGAATTGA TCCGCATTGG ACGGTGGCAT GTCGAGGGCG AAGCCTATGA CCGGGCGCTG 13200
GCCATGGTGG TCGAGGCACA GGCAGCGTTA CCCATGGCCC GGTTCTGGGG CATGGGCACG TCGGCTTCGA GCGACGGACA GTTCTTCGTC GCTACAGAGC 13300
AAGGTGAGGC CATGAACCTG GTCAACGCGA AATATGGCAA TACCCCGGGC CTGAAAGCCT ATAGCCACGT CTCCGACCAA TATGCGCCGT TCGCAACCCA 13400
GGTGATTCCT GCAACGGCAA GCGAAGCGCC TTACATCCTC GATGGCCTGC TGATGAACGA TGCTGGACGC CATATCCGCG AGCAGTTCAC CGACACGGGC 13500
GGCTTCACCG ATCACGTCTT TGCCGCATGT GCCATTCTCG GCTACCGGTT CGCTCCGCGC ATCCGCGACC TGCCATCCAA ACGGCTCTAC GCGTTCAATC 13600
CGTCGGCCGC CCCGGCGCAC CTGCGAGCGT TGATCGGCGG AAAGGTCAAC CAAGCCATGA TCGAGCGCAA TTGGCCCGAC ATCCTGCGCA TCGCCGCCAC 13700
CATTGCTGCC GGGACCGTCG CGCCAAGCCA GATTCTGCGG AAACTCGCCT CCTATCCGCG GCAGAACGAG CTCGCGACAG CCCTGCGGGA AGTCGGTCGC 13800
GTCGAGCGCA CCCTGTTCAT GATCGACTGG ATTCTGGATG CCGAACTCCA ACGGCGTGCC CAGATCGGGC TCAACAAAGG CGAAGCTCAT CATGCGCTGA 13900
AGCGGGCAAT CAGCTTCCAC CGCCGCGGTG AAATCCGCGA CCGTTCCGCC GAAGGCCAGC ATTACCGCAT CGCCGGCATG AATCTGCTCG CCGCCATCAT 14000
CATCTTCTGG AACACCATGA AGCTCGGCGA GGTCGTTGCA AACCAGAAAC GCGATGGAAA GCTGCTATCG CCCGATCTCT TGGCCCATGT TTCGCCGCTC 14100
GGATGGGAAC ACATCAATCT CACCGGAGAA TATCGCTGGC CAAAGCCTTA GCGTAGGATT CCGCCCCCTC CCGCAAACGA CCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 11044-11265 222 TGTCCCGTTC GACACCTGCG GCGCGCAAGG CGTCGTGCTG CAGGTCGAGA GACTGCGAGC
CATCGGCTTT GGAGACGCGG GCATATCCGA TCAGCATGTA TCACAAACGT TGGTTTGAGG
CGGCGCTTCG GCCACGATTG CATTGACCTC TGGAAATGTA TCTCAACCAG CTTCATAAAC
AAAGCGTCTT GAACGCTATC AGATTTTGAA AAAGGAACAT GT

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
APH(6)-Id (ARO:3002660) Tn5393.4 107-952 Passenger Gene Antibiotic Resistance -
APH(3'')-Ib (ARO:3002639) Tn5393.4 943-1746 Passenger Gene Antibiotic Resistance -
tnp 5'-end ISPa14 1856-2224 Transposase   +
tnp ISPa13 2321-3580 Transposase   +
gst-like TnpFL424_ISPa 3621-4009 Passenger Gene Other -
bla PER-1 (ARO:3002363) TnpFL424_ISPa 4083-5009 Passenger Gene Antibiotic Resistance -
tnpA ISPpu17 5273-6235 Transposase   +
tnp_p ISPa12_ISPpu17 6219-7451 Transposase   +
tnp 3'-end ISPa14 7480-7817 Transposase   +
APH(3')-VIa (ARO:3002652) Tn5393.4 8472-9251 Passenger Gene Antibiotic Resistance -
aPH(6)-Id (ARO:3002660); APH(3'')-Ib (ARO:3002639) Tn5393.4 9508-9657 Passenger Gene; Passenger Gene Antibiotic resistance; Antibiotic Resistance -
tnpR Tn5393.4 10529-11140 Accessory Gene Resolvase -
tnpA Tn5393.4 11266-14151 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
APH(6)-Id (ARO:3002660) APH(6)-Id Tn5393.4 846 107-952 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  APH(6) (ARO:3000151)
Comment:   strB, orfI || strict match to reference sequence for ARO:3002660 (bitscore: 568)
Protein Sequence:  
MGLMFMPPVF PAHWHVSQPV LIADTFSSLV WKVSLPDGTP AIVKGLKPIE DIADELRGAD YLVWRNGRGA VRLLGRENNL MLLEYAGERM LSHIVAEHGD
YQATEIAAEL MAKLYAASEE PLPSALLPIR DRFAALFQRA RDDQNAGCQT DYVHAAIIAD QMMSNASELR GLHGDLHHEN IMFSSRGWLV IDPVGLVGEV
GFGAANMFYD PADRDDLCLD PRRIAQMADA FSRALDVDPR RLLDQAYAYG CLSAAWNADG EEEQRDLAIA AAIKQVRQTS Y

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
APH(3'')-Ib (ARO:3002639) APH(3'')-Ib Tn5393.4 804 943-1746 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  APH(3'') (ARO:3000127)
Comment:   strA, orfH || perfect match to reference sequence for ARO: 3002639
Protein Sequence:  
MNRTNIFFGE SHSDWLPVRG GESGDFVFRR GDGHAFAKIA PASRRGELAG ERDRLIWLKG RGVACPEVIN WQEEQEGACL VITAIPGVPA ADLSGADLLK
AWPSMGQQLG AVHSLSVDQC PFERRLSRMF GRAVDVVSRN AVNPDFLPDE DKSTPQLDLL ARVERELPVR LDQERTDMVV CHGDPCMPNF MVDPKTLQCT
GLIDLGRLGT ADRYADLALM IANAEENWAA PDEAERAFAV LFNVLGIEAP DRERLAFYLR LDPLTWG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp 5'-end Tnp 5'-end ISPa14 369 1856-2224 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   disrupted by insertion of TnpFLA424_ISPa
Protein Sequence:  
REMRITLEIK CPTCLSDSIK KNGIKVDGKQ NYQCKDCKRQ FIGDHALSYL GCHSGITRKI LQLMVRGSGI RDIAEVERIS IGKVLRTLTE STYQIQPKQS
HYESLEVDEF WTFVGNKNNK QWL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp Tnp ISPa13 1260 2321-3580 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
KRMKQQQDTR FSSAFERFFS AAELDALGKQ SGFMKRRRQV TPQKFCMALV SALGAGTTNS IADVHRQFNH MHSTDIKLKP FHKQLVKMAA PEFMREVFEK
ALALHLPDMF AIRNKYQDMF KRIILQDGTS FAVHDDLMFY FPGRFNENSP AAVELHVTYD VFKGQPDGVS LTEDTAPERD YLPSPASLSG CLFMADAGYF
SKAYIQQLQE ACAYFIMRMC NRVNPMAVCT KTQQMKPLKT WLKELPNAGV LDLDVQWPNG PVYRCVAFAA LDHKKRHVLV CTNLDREQFP PAVVGDFYRV
RWQIELLFKE WKSMNNLNKF DTGHATIVET LIWGSLLAAT LKRWLINAAQ KKYNRVLSLF TGAKTAHMWW IPFCFDIAMS RGTDLAKAMN NALAFLAQHC
QRQNVKRDQI SGVYKLLNNT

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
gst-like Gst-like TnpFL424_ISPa 389 3621-4009 -
Class:   Passenger Gene
Sub Class:   Other
Protein Sequence:  
MQLLGSVASP FVRRLRLVLA GQPYQFVALN IFESEGRSVL VQHNPARKVP VLVDGEQVIF DSGVIYRYLA SKLKFKPLSW DQENGLTTIN ACTDSLVELL
LCKRSGFDVT EDKLFFNLQH ERIQATLEA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla PER-1 (ARO:3002363) Bla PER-1 TnpFL424_ISPa 927 4083-5009 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   cephalosporin (ARO:0000032)||penem (ARO:3003706)||monobactam (ARO:0000004)||penam (ARO:3000008)||carbapenem (ARO:0000020)
Sequence Family:  PER beta-lactamase (ARO:3000056)
Comment:   perfect match to reference sequence for ARO:3002363
Protein Sequence:  
MNVIIKAVVT ASTLLMVSFS SFETSAQSPL LKEQIESIVI GKKATVGVAV WGPDDLEPLL INPFEKFPMQ SVFKLHLAML VLHQVDQGKL DLNQTVIVNR
AKVLQNTWAP IMKAYQGDEF SVPVQQLLQY SVSHSDNVAC DLLFELVGGP AALHDYIQSM GIKETAVVAN EAQMHADDQV QYQNWTSMKG AAEILKKFEQ
KTQLSETSQA LLWKWMVETT TGPERLKGLL PAGTVVAHKT GTSGIKAGKT AATNDLGIIL LPDGRPLLVA VFVKDSAESS RTNEAIIAQV AQTAYQFELK
KLSALSPN

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA ISPpu17 963 5273-6235 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MTTHYRQLTQ GQRYQIEAGL SAAESQASIA KRVGVHPSTI SREVRRNSTQ NIYKAVSAAH ESDARRAGAR KFCKPATWLS HHLPVWLKHG MSPEQIAQRL
KQEQPSRAVS HEWIYRFIAA EQRAGGELYT YLRHRRKRYR KRYGSHDRRG QLRNRVSISE RPAEVESRER LGDWEGDTVH GLGGNLVTLV DRKSGYLSAY
PVKRRTRRQV TRAINLMLQG HAAHTLTLDN GREFAGHERI ALRSQCQVFF ADPYSSWQRG TNENTNGLLR QYFPKGSDFS KLTVEAVNRT VARINLRPRK
RLGWKTPYEV HTGVSVALMC

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp_p Tnp_p ISPa12_ISPpu17 1233 6219-7451 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
LHLCVEFRQQ LNSLGVQTHM IERFRLITPA KLCLAFVCAL GSGNARTIAD IHRYFNHLHS MSVRLKPFHN QLVKLGTPEF MRQVFEQALA LHLPAMHTFS
DAYRGHFKQV LLQDGTSFAV HDGLSLHFPG RFSTHSPAAV ELHVTYDLEK AQPVRVSLSE DTASERDYLP VAQSLRGCLL MADAGYFSKA YIESLQNEAA
SFVLRMPASV NPMATCNQTG LCQPLRSWLA VLPKHGELDL DVQWPDGPVY RCVLFASTDH KDKPVCLCTN LDRHTFPAAT VGEWYRLRWQ IELLFKEWKS
LNSLNKFNTE YSTIAETLIW GSLLAATLKR WLINGAQQKY RRVLSMFSGA KTANQWWLPF CIKWACSGIT EIAAELGKVF AFLAEHCQRV NVKRDQKSGA
FKVLEITYES

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp 3'-end N ISPa14 338 7480-7817 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   disrupted by insertion of TnpFLA424_ISPa
Protein Sequence:  
FTPTIEKQVR LLLMFGVKET *LQFND*RQS LNN*VFTTPE LQVIIGTVS* LLLKTASKVL VNFLL*VLKV IIAK*GIELG AVLEGVVIFQ KRLKTILKLS
T*PFFTSIMA SF

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
APH(3')-VIa (ARO:3002652) APH(3')-VIa Tn5393.4 780 8472-9251 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  APH(3') (ARO:3000126)
Comment:   loose match to reference sequence for ARO:3002652 (93% identical, bitscore:470)||Synonyms: aphA-6
Protein Sequence:  
MELPNIIQQF IGNSVLEPNK IGQSPSDVYS FNRNNETFFL KRSSTLYTET TYSVSREAKM LSWLSDKLKV PELIMTFQDE QFEFMITKAI NAKSISALFL
TEQELLAIYK ETLNQLNAVA IIDCPFISSI DHRLKESKFF IDNQLLDEID QDDFEAELWG DHKTYISLWN ELNETRVEER LVFSHGDITD SNIFIDKSGE
IYFLDLGRAG LADEFVDISF VERCLREDVS EETAKIFLKH LKNDMPDKRN YFLKLDELN

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aPH(6)-Id (ARO:3002660); APH(3'')-Ib (ARO:3002639) APH(6)-Id (ARO:3002660); APH(3'')-Ib Tn5393.4 150 9508-9657 -
Class:   Passenger Gene; Passenger Gene
Sub Class:   Antibiotic resistance; Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016); aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  APH(3'') (ARO:3000127)
Comment:   strA, orfH || perfect match to reference sequence for ARO: 3002639
Protein Sequence:  
MNRTNIFFGE SHSDWLPVRG GESGDFVFRR GDGHAFAKIA PASRRGELAG ERDRLIWLKG RGVACPEVIN WQEEQEGACL VITAIPGVPA ADLSGADLLK
AWPSMGQQLG AVHSLSVDQC PFERRLSRMF GRAVDVVSRN AVNPDFLPDE DKSTPQLDLL ARVERELPVR LDQERTDMVV CHGDPCMPNF MVDPKTLQCT
GLIDLGRLGT ADRYADLALM IANAEENWAA PDEAERAFAV LFNVLGIEAP DRERLAFYLR LDPLTWG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn5393.4 612 10529-11140 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   recombinaseactivity (GO:0000150)
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MLIGYARVSK ADGSQSLDLQ HDALRAAGVE RDNIYDDLAS GGRDDRPGLT ACLKSLRDGD VLVVWKLDRL GRSLAHLVNT VKELSDRKIG LRVLTGKGAQ
IDTTTASGRM VFGIFATLAE FERDLIRERT MAGLASARAR GRKGGRKFAL TKAQVRLAQA AMAQRDTSVS DLCKELGIER VTLYRYVGPK GELRDHGKHV
LGLT

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn5393.4 2886 11266-14151 +
Class:   Transposase
Function:   transposase activity (GO:0004803)
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRVTLTDR QKDALLRLPT SQTDLLKHYT LSDEDLGHIR LRRRAHNRFG FALQLCVLRY PGRVLAPGEL IPAEVIEFIG AQLGLGADDL VDYAAREETR
HEHLAELRGL YGFRTFSGRG ASELKEWLFR EAEMAVSNED IARRFVAECR RTRTVLPATS TIERLCAAAL VDAERRIETR IASRLPMSIR EQLLALLEET
ADDRVTRFVW LRQFEPGSNS SSANRLLDRL EYLQRIDLPE DLLAGVPAHR VTRLRRQGER YYADGMRDLP EDRRLAILAV CVSEWQAMLA DAVVETHDRI
VGRLYRASER ICHAKVADEA GVVRDTLKSF AEIGGALVDA QDDGQPLGDV IASGSGWDGL KTLVAMATRL TATMADDPLN HVLDGYHRFR RYAPRMLRLL
DLRAAPVALP LLEAVTALRT GLNDAAMTSF LRPSSKWHRH LRAQRAGDAR LWEIAVLFHL RDAFRSGDVW LTRSRRYGDL KHALVPAQSI AEGGRLAVPL
RPEEWLADRQ ARLDMRLREL GRAARAGTIP GGSIENGVLH IEKLEAAAPT GAEDLVLDLY KQIPPTRITD LLLEVDAATG FTEAFTHLRT GAPCADRIGL
MNVILAEGIN LGLRKMADAT NTHTFWELIR IGRWHVEGEA YDRALAMVVE AQAALPMARF WGMGTSASSD GQFFVATEQG EAMNLVNAKY GNTPGLKAYS
HVSDQYAPFA TQVIPATASE APYILDGLLM NDAGRHIREQ FTDTGGFTDH VFAACAILGY RFAPRIRDLP SKRLYAFNPS AAPAHLRALI GGKVNQAMIE
RNWPDILRIA ATIAAGTVAP SQILRKLASY PRQNELATAL REVGRVERTL FMIDWILDAE LQRRAQIGLN KGEAHHALKR AISFHRRGEI RDRSAEGQHY
RIAGMNLLAA IIIFWNTMKL GEVVANQKRD GKLLSPDLLA HVSPLGWEHI NLTGEYRWPK P

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
TnpFL424_ISPa-AJ627643 TnpFL424 Transposon 1803-7844 6042
ISPa13-AJ627643 ISPa13 Insertion Sequence 2234-7479 5246
ISPa12_ISPpu17-AJ627643.4 ISPa12 Insertion Sequence 2234-3620 1387
ISPpu17-DQ174113.1 ISPpu17 Insertion Sequence 5023-7479 2457

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRL Tn5393.4 1-40 GGGGTCGTTT GCGGGAGAGG GCGAAATCCT ACGCTAAGGC
IRL ISPa14_TnpFLA424_ISPa 1803-1829 GGTGGTGTTT CAAAAAGTAT GCTGAAA
IRL ISPa13 2234-2254 TCATAGGTAT GATCTTTAGG A
IRR ISPa13 3600-3620 AGCAATTCCA GTATGCATAC T
IRL ISPa12_ISPpu17 5023-5043 TCATACGTAT GATCTTTAGG A
IRL ISPpu17 5177-5198 CCTGAATTCA TAGAATAAGC GC
IRR ISPpu17 6221-6242 CGTGAATACA CAACTTAAGT CC
IRR ISPa12_ISPpu17 7459-7479 AGCGATTTCT GTATGCATAC T
IRR ISPa14_TnpFLA424_ISPa 7818-7844 ACAGTCGTAT GAAAAACTTT GTGGTGG
IRL ISPa14 9380-9406 GGTGGTGTTT CAAAAAGTAT GCTGAAA
IRRl Tn5393.4 14104-14184 ACCCTTGTGT AGTTAGAGTG GCCTCTTATA GCGACCGGTT TCGGAATCGC
ATCCTAAGGC GGGGGAGGGC GTTTGCTGGG G

 References