Transposon
Name: Tn5086
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Escherichia coli SCU-164 Molecular Source:chromosome
Place of Origin:USA Date of Isolation:2020

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  15341 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGCACCT CAGAAAACGG AAAATAAAGC ACGCTAAGGC ATAGCTGACC TTGCCAGGCC TGCTTCGCCC TGTAGTGACG CGATCAACGG GCAGGAAACA 100
TTCCCCTTTC GTGCATGGCA GGCGCACACG AGTTCAGACA GCACGGTTTC CATGCGCGCC AAGTCGGCCA TCTTCTCGCG CACGTCCTTG AGCTTGTGTT 200
CGGCCAGGCT GCTGGCCTCC TCGCAGTGGG TGCCATCGTC GAGCCGCAAC AGCTCGGCAA TCTCGTCCAG ACTGAACCCC AGCCGCTGTG CCGATTTCAC 300
GAATTTCACC CGAACCACGT CCGCCTCCCC ATAGCGGCGG ATGCTGCCGT AAGGCTTGTC CGGTTCCCGC AACAGGCCCT TGCGCTGATA GAAGCGGATT 400
GTCTCCACGT TGACCCCGGC CGCCTTGGCA AAAACGCCAA TGGTCAGGTT TTCCAAATTA TTTTCCATAT CGCTTGACTC CGTACATGAG TACGGAAGTA 500
AGGTTACGCT ATCCAATCCA AATTCAAAAG GGCCAACGTA TGTCTGAACC ACAAAACGGG CGCGGTGCGC TCTTCGCCGG CGGGCTGGCC GCCATTCTTG 600
CATCGACCTG CTGCCTGGGG CCGCTAGTAC TGGTCGCCCT GGGCTTCTCC GGTGCTTGGA TCGGCAACCT GACGGTGCTG GAACCCTATC GACCGTTGTT 700
CATCGGCGCG GCGCTAGTGG CGCTGTTCTT CGCCTGGAAG CGGATTTACC GGCCCGTGCA GGCATGCAAG CCAGGTGAGG TCTGCGCGAT TCCGCAGGTG 800
CGCGCCACCT ACAAGCTGAT TTTCTGGATC GTGGCCGTGC TGGTCCTGGT CGCGCTTGGA TTTCCCTATG TCGTTCCATT TTTCTATTAA CCAGGAGTTC 900
ATCATGAAGA AACTGTTTGC CTCCCTTGCC CTCGCCGCCG CTGTTGCCCC GGTGTGGGCC GCTACCCAGA CCGTCACGCT AGCGGTTCCC GGCATGACTT 1000
GCGCCGCCTG CCCGATCACA GTCAAGAAAG CGCTCTCCAA GGTCGAAGGC GTGAGCAAGG TCGATGTGGG CTTCGAGAAG CGCGAGGCCG TCGTCACTTT 1100
TGACGACACC AAGGCCAGCG TACAGAAGCT GACCAAGGCC ACCGCAGACG CCGGCTATCC GTCCAGCGTC AAGCAGTGAG CCAGCAAGCC AACGACAACA 1200
GCGAGAGCCG CTTCATGGGA CTGATGACAC GCATTGCCGA TAAAACCGGC GCGCTCGGCA GCGTCGTTTC CGCGATGGGC TGCGCCGCCT GCTTTCCAGC 1300
CCTCGCCAGC TTCGGCGCGG CCATCGGGCT GGGCTTCTTG AGCCAGTACG AGGGACTGTT CATCAGCCGC CTGCTGCCGC TGTTTGCCGC GCTGGCCTTC 1400
CTGGCGAACG CGCTGGGTTG GTTCAGTCAT CGGCAATGGC TGCGCAGTCT GCTCGGCATG ATCGGCCCGG CCATCGTGTT TGCGGCCACG GTCTGGCTGC 1500
TCGGCAACTG GTGGACGGCG AACCTGATGT ACGTCGGCCT GGCCTTGATG ATTGGGGTGT CGATCTGGGA CTTCGTGTCG CCGGCGCATC GCCGTTGCGG 1600
ACCGGACGGC TGCGAACTCC CCGCCAAGCG CTTGTGAAAG ACGGCTGACC GTGCGACACG GCGGCCCACA CGAATAAGGA ACGATGGTAT GAGCACTCTC 1700
AAAATCACCG GCATGACTTG CGACTCGTGC GCAGTGCATG TCAAGGACGC CCTGGAGAAA GTGCCCGGCG TGCAATCAGC GGATGTCTCC TACGCCAAGG 1800
GCAGCGCCAA GCTCGCCATT GAGGTCGGCA CGTCACCCGA CGCGCTGACG GCCGCTGTAG CTGGACTCGG TTATCGGGCC ACGCTGGCCG ATGCCCCCTC 1900
AGTTTCGACG CCGGGCGGAT TGCTCGACAA GATGCGCGAT CTGCTGGGCA GAAACGACAA GACGGGTAGC AGCGGCGCAT TGCATATCGC CGTCATCGGC 2000
AGCGGCGGGG CCGCGATGGC AGCGGCGCTG AAGGCCGTCG AGCAAGGCGC ACGTGTCACG CTGATCGAGC GCGGCACCAT CGGCGGCACC TGCGTCAATG 2100
TCGGTTGTGT GCCGTCCAAG ATCATGATCC GCGCCGCCCA TATCGCCCAT CTGCGCCGGG AAAGCCCGTT CGATGGCGGC ATCGCCGCTA CCACGCCGAC 2200
CATCCAGCGC ACGGCGCTGC TGGCCCAGCA GCAGGCCCGC GTCGATGAAC TGCGCCACGC CAAGTACGAA GGCATCTTGG AGGGCAATCC GGCGATCACT 2300
GTGCTGCACG GCTCCGCCCG CTTTAAGGAC AATCGCAACC TGATCGTGCA ACTCAACGAC GGCGGCGAGC GCGTGGTGGC ATTCGACCGC TGCCTGATCG 2400
CCACCGGCGC GAGCCCGGCC GTGCCGCCGA TTCCCGGCCT GAAAGACACT CCGTACTGGA CTTCCACTGA AGCGCTGGTC AGCGAGACGA TTCCTAAGCG 2500
CCTGGCCGTG ATTGGCTCAT CAGTGGTGGC GCTGGAGCTG GCGCAGGCGT TCGCCCGACT CGGAGCGAAG GTGACGATCC TGGCTCGCAG CACGCTGTTC 2600
TTCCGCGAAG ACCCAGCTAT AGGCGAAGCC GTCACGGCCG CATTCCGCAT GGAGGGCATC GAGGTGAGGG AACACACCCA GGCCAGCCAG GTCGCGTATA 2700
TCAATGGTGA AGGGGACGGC GAATTCGTGC TCACCACGGC GCACGGCGAA CTGCGCGCCG ACAAGCTGCT GGTCGCCACC GGCCGCGCGC CCAACACACG 2800
CAAGCTGGCA CTGGATGCGA CGGGCGTCAC GCTCACCCCG CAAGGCGCTA TCGTCATCGA CCCCGGCATG CGTACAAGCG TGGAACACAT CTACGCCGCA 2900
GGCGACTGCA CCGACCAGCC GCAGTTCGTC TATGTGGCGG CAGCGGCCGG CACTCGCGCC GCGATCAACA TGACCGGCGG TGACGCGGCC CTGAACCTGA 3000
CCGCGATGCC GGCCGTGGTG TTCACCGACC CGCAAGTGGC GACCGTAGGC TACAGCGAGG CGGAAGCGCA CCATGACGGC ATCAAAACTG ATAGTCGCAC 3100
GCTAACGCTG GACAACGTGC CGCGCGCGCT CGCCAACTTC GACACGCGCG GCTTCATCAA ACTGGTGGTT GAAGAAGGCA GCGGACGACT GATCGGCGTG 3200
CAGGCAGTGG CCCCGGAAGC GGGCGAACTG ATCCAGACGG CCGCACTGGC GATTCGCAAC CGGATGACGG TGCAGGAACT GGCCGACCAG TTGTTCCCCT 3300
ACCTGACGAT GGTCGAAGGG TTGAAGCTCG CGGCGCAGAC CTTCAACAAG GATGTGAAGC AGCTTTCCTG CTGCGCCGGG TGAGGACAAG GAGGTGTGCG 3400
ATGAGCGCCT ACACGGTATC GCAACTGGCC CATAACGCTG GGGTGAGCGT ACATATCGTG CGCGACTACC TGGTGCGCGG CTTGTTACGG CCGGTGGCCT 3500
GCACCACGGG CGGCTACGGC GTGTTCGACG ATGCGGCCTT GCAACGGCTG TGCTTCGTGC GCGCGGCCTT CGAGGCGGGT ATCGGCCTGG ATGCCCTGGC 3600
GCGGCTGTGC CGTGCGCTCG ACGCAGCGGA CGGCGCACAA GCCGCAGCGC AGCTTGCCGT GCTGCGCCAG TTGGTCGAGC GGCGGCGCGC GGCGTTGGCC 3700
CATCTGGACG CGCAACTGGC CTCCATGCCA GCCGAGCGGG CGCACGAGGA GGCATTGCCG TGAACGCCCC TGACAAACTG CCGCCCGAGA CGCGCCAACC 3800
CGTTTCCGGC TACCTGTGGG GTGCGCTGGC CGTGTTGACC TGCCCCTGCC ATCTGCCGAT TCTCGCCGCC GTGCTGGCCG GGACGACCGC CGGTGCCTTC 3900
CTTGGCGAGC ATTGGGGTGT TGCCGCGCTC GCGCTGACCG GCTTGTTCGT TCTGGCCGTA ACGCGGCTGC TGCGCGCCTT CCGGGGCGGA TCATGACGAG 4000
TTCGCAGCCC GCCGGATGGA CGGCGGCCGA GTTGGCGCAG GCGGCGGCGC GCGGACAGCT TGACCTGCAT TACCAGCCGC TGGTCGATCT GCGCGATCAC 4100
CGGATCGCTG GCGCGGAAGC GTTGATGCGC TGGCGGCATC CGAGGCTTGG CCTGTTGCCG CCCGGCCAGT TCCTGCCGCT GGCCGAGTCG TTCGGCCTGA 4200
TGCCGGAAAT AGGCGCGTGG GTGCTGGGCG AGGCCTGTCG CCAGATGCAC AAGTGGCAAG GACCGGCATG GCAACCGTTC CGTCTTGCCA TCAATGTGTC 4300
CGCCAGCCAG GTTGGGCCAA CGTTCGACGA CGAGGTAAAG CGGGTGCTGG CCGATATGGC CCTGCCCGCC GAGCTTCTGG AGATCGAACT GACCGAATCG 4400
GTCGCATTCG GCAATCCAGC CCTGTTCGCC AGTTTCGACG CCTTGCGCGC CATCGGCGTG CGCTTCGCCG CCGACGACTT CGGCACCGGC TATTCCTGCC 4500
TGCAACATCT GAAATGCTGC CCCATCACCA CATTGAAAAT CGACCAATCC TTTGTCGCCA GGCTCCCGGA TGATGCCCGT GACCAAACTA TCGTGCGGGC 4600
GGTGATCCAG CTCGCGCACG GGCTGGGCAT GGATGTCATT TTCAGAAGAC GACTGCACCA GTTGATTGGG CGTAATGGCT GTTGTGCAGC CAGCTCCTGA 4700
CAGTTCAATA TCAGAAGTGA TCTGCACCAA TCTCGACTAT GCTCAATACT CGTGTGCACC AAAGCGAGGT GAGCATGGCG ACGGACACCC CACGGATTCC 4800
AGAACAAGGC GTGGCCACTC TGCCTGATGA GGCTTGGGAG CGTGCGCGCC GTCGTGCGGA GATCATCAGT CCGTTGGCGC AGTCGGAGAC GGTCGGGCAC 4900
GAAGCGGCCG ATATGGCGGC TCAGGCGCTG GGCTTGTCTC GGCGCCAGGT ATACGTTCTG ATCCGGCGTG CCCGGCAAGG CAGCGGCCTC GTGACGGATC 5000
TGGTGCCCGG CCAGTCCGGT GGAGGTAAAG GTAAGGGGCG CTTGCCGGAA CCGGTCGAGC GCGTCATCCA CGAGCTACTG CAAAAGCGGT TCCTGACCAA 5100
GCAGAAGCGC AGCCTAGCGG CCTTTCACCG CGAAGTCACT CAGGTGTGCA AGGCTCAAAA ACTGCGAGTG CCGGCGCGCA ATACCGTGGC CTTACGGATC 5200
GCTAGCCTTG ACCCGCGCAA GGTCATCCGC CGGCGGGAAG GCCAGGATGC CGCTCGTGAC CTACAAGGTG TGGGCGGCGA GCCTCCTGCC GTGACCGCGC 5300
CGCTGGAGCA GGTGCAGATA GACCATACGG TCATCGACCT GATCGTGGTC GATGACCGCG ACCGGCAACC TATTGGCCGC CCGTACCTGA CCCTCGCCAT 5400
CGACGTGTTC ACCCGCTGCG TGCTCGGCAT GGTCGTCACG CTGGAAGCGC CGTCTGCCGT TTCGGTTGGC CTGTGCCTCG TGCATGTCGC CTGCGACAAG 5500
CGCCCTTGGC TGGAAGGACT GAACGTGGAA ATGGATTGGC AGATGAGCGG CAAGCCCTTG CTGCTCTACC TAGACAACGC GGCCGAGTTC AAGAGCGAGG 5600
CCCTGCGCCG GGGTTGCGAG CAGCATGGCA TCCGGCTGGA CTATCGCCCG CTGGGACAGC CGCACTATGG CGGCATCGTG GAACGGATCA TCGGCACGGC 5700
GATGCAGATG ATTCACGACG AACTGCCGGG AACGACCTTC TCCAACCCTG ACCAGCGCGG CGACTACGAT TCCGAAAACA AGGCCGCCCT GACGCTGCGC 5800
GAGCTAGAGC GCTGGCTCAC ATTGGCGGTC GGCACCTACC ACGGTTCGGT GCACAACGGC CTGCTCCAAC CGCCGGCCGC GCGCTGGGCC GAGGCCGTGG 5900
CGCGTGTCGG CGTACCGGCC GTCGTCACAC GCGCTACTTC GTTCCTGGTC GATTTTCTGC CGATCCTCCG GCGCACGCTG ACCCGCACCG GCTTTGTCAT 6000
CGACCACATC CACTACTACG CCGATGCGCT CAAGCCGTGG ATTGCGCGGC GTGAACGCTG GCCGTCCTTT CTGATCCGGC GCGATCCGCG CGACATCAGC 6100
CGTATCTGGG TCCTGGAACC GGAGGGACAG CATTACCTGG AAATTCCCTA CCGTACCTTG TCGCATCCGG CTGTCACCCT CTGGGAACAA CGGCAGGCGC 6200
TGGCGAAACT GCGGCAGCAA GGGCGCGAAC AGGTGGATGA GTCGGCGCTG TTCCGCATGA TCGGCCAGAT GCGTGAGATT GTGACCAGCG CGCAGAAGGC 6300
CACACGCAAG GCGCGGCGTG ACGCGGATCG CCGCCAGCAC CTCAAGACAT CAGCTCGGCC GGACAAGCCC GTTCCGCCGG ATACGGATAT TGCCGACCCG 6400
CAGGCAGACA ACTTGCCACC CGCCAAACCG TTCGACCAGA TTGAGGAGTG GTAGCCGTGG ACGAATATCC CATCATCGAC CTGTCCCACC TGCTGCCGGC 6500
GGCCCAGGGC TTGGCCCGTC TTCCGGCGGA CGAGCGCATC CAGCGCCTTC GCGCCGACCG CTGGATCGGC TATCCGCGCG CAGTCGAGGC GCTGAACCGG 6600
CTGGAAGCCC TTTATGCGTG GCCAAACAAG CAACGCATGC CCAACCTGCT GCTGGTTGGC CCGACCAACA ATGGCAAGTC GATGATCGTC GAGAAGTTCC 6700
GCCGCACCCA CCCGGCCAGC TCCGACGCCG ACCAGGAGCA CATCCCGGTG TTGGTCGTGC AGATGCCGTC CGAGCCGTCC GTGATCCGCT TCTACGTCGC 6800
GCTGCTCGCC GCGATGGGCG CGCCGCTGCG CCCACGCCCA CGGTTGCCGG AAATGGAGCA ACTGGCTCTG GCACTGCTGC GCAAGGTCGG CGTGCGCATG 6900
CTGGTGATCG ACGAGCTGCA CAACGTGCTG GCCGGCAACA GCGTCAACCG CCGGGAATTC CTCAACCTGC TGCGCTTCCT CGGCAACGAA CTGCGCATCC 7000
CGTTGGTTGG GGTAGGCACG CGCGACGCCT ACCTAGCCAT CCGCTCCGAT GACCAGTTGG AAAATCGCTT CGAGCCGATG ATGCTGCCGG TATGGGAGGC 7100
CAACGACGAT TGCTGCTCAC TGCTGGCCAG CTTCGCCGCT TCGCTCCCGC TGCGCCGGCC TTCCCCAATT GCCACGCTGG ACATGGCTCG CTACCTGCTC 7200
ACACGCAGCG AGGGCACCAT AGGGGAACTG GCGCACTTGC TGATGGCGGC GGCCATCGTC GCCGTGGAGA GCGGCGAGGA AGCGATCAAC CATCGCACAC 7300
TCAGCATGGC CTGTCGACAA CCTCTCGCGC AACCAAGACA TCGCGGTCGG ACTGCAAGTG ATCTTGAAGC CACGGGCCCG TCCCACCCCG ACATGGACCT 7400
CGATGCCCGA ACGGACGTTA GATTTCGAGT TCTAGGCGTT CTGCGATGAA GGTTGGATCC CAGCCGGGAT TGAAAGTGTC GACGTGGGTG AATCCGAGCC 7500
GCTCGTATAG GCCACGCAGG TTCGGGTGGC AGTCGAGCCG CAGCTTGGCG CACCCCTGCG TTCGCGCGGC ATGGCGGCAA GCCTCGATCA GCGCGGAGCT 7600
GACACCCCGG CCCGCATGTG TCCGTCGCAC CGCGAGCTTG TGCAGATATG CGGCCTCCCC CTTGAGGGCG TCGGGCCAGA ACTCGGGATC CTCGGCCGAC 7700
AAGGTGCAAC AGCCGACGAT GCCGTCGCTG CAACTCGCGA CTAGGAGCTC GGATCTCAGG ACGAAGGTCT CCGCGAATGT CCGGTCGATC CGCGCGACGT 7800
CCCAGGCGGG CGTTCCCTTG GCGGACATCC ACGCCGCAGC GTCGTGCATC AGCCGCACAA CCTCGTCGAT ATCACCCGAG CAGGCGACCC GAACGTTCGG 7900
AGGCTCCTCG CTGTCCATTC GCTCCCCTGG CGCGGTATGA ACCGCCGCCT CATAGTGCAG TTTGATCCTG ACGAGCCCAG CATGTCTGCG CCCACCTTCG 8000
CGGAACCTGA CCAGGGTCCG CTAGCGGGCG GCCGGAAGGT GAATGCTAGG CATGATCTAA CCCTCGGTCT CTGGCGTCGC GACTGCGAAA TTTCGCGAGG 8100
GTTTCCGAGA AGGTGATTGC GCTTCGCAGA TCTCCAGGCG CGTGGGTGCG GACGTAGTCA GCGCCATTGC CGATCGCGTG AAGTTCCGCC GCAAGGCTCG 8200
CTGGACCCAG ATCCTTTACA GGAAGGCCAA CGGTGGCGCC CAAGAAGGAT TTCCGCGACA CCGAGACCAA TAGCGGAAGC CCCAACGCCG ACTTCAGCTT 8300
TTGAAGGTTC GACAGCACGT GCAGCGATGT TTCCGGTGCG GGGCTCAAGA AAAATCCCAT CCCCGGATCG AGGATGAGCC GGTCGGCAGC GACCCCGCTC 8400
CGTCGCAAGG CGGAAACCCG CGCCTCGAAG AACCGCACAA TCTCGTCGAG CGCGTCTTCG GGTCGAAGGT GACCGGTGCG GGTGGCGATG CCATCCCGCT 8500
GCGCTGAGTG CATAACCACC AGCCTGCAGT CCGCCTCAGC AATATCGGGA TAGAGCGCAG GGTCAGGAAA TCCTTGGATA TCGTTCAGGT AGCCCACGCC 8600
GCGCTTGAGC GCATAGCGCT GGGTTTCCGG TTGGAAGCTG TCGATTGAAA CACGGTGCAT CTGATCGGAC AGGGCGTCTA AGAGCGGCGC AATACGTCTG 8700
ATCTCATCGG CCGGCGATAC AGGCCTCGCG TCCGGATGGC TGGCGGCCGG TCCGACATCC ACGACGTCTG ATCCGACTCG CAGCATTTCG ATCGCCGCGG 8800
TGACAGCGCC GGCGGGGTCT AGCCGCCGGC TCTCATCGAA GAAGGAGTCC TCGGTGAGAT TCAGAATGCC GAACACCGTC ACCATGGCGT CGGCCTCCGC 8900
AGCGACTTCC ACGATGGGGA TCGGGCGAGC AAAAAGGCAG CAATTATGAG CCCCATACCT ACAAAGCCCC ACGCATCAAG CTTTTGCCCA TGAAGCAACC 9000
AGGCAATGGC TGTAATTATG ACGACGCCGA GTCCCGACCA GACTGCATAA GCAACACCGA CAGGGATGGA TTTCAGAACC AGAGAAAGAA AATAAAATGC 9100
GATGCCATAA CCGATTATGA CAACGGCGGA AGGGGCAAGC TTAGTAAAGC CCTCGCTAGA TTTTAATGCG GATGTTGCGA TTACTTCGCC AACTATTGCG 9200
ATAACAAGAA AAAGCCAGCC TTTCATGATA TATCTCCCAA TTTGTGTAGG GCTTATTATG CACGCTTAAA AATAATAAAA GCAGACTTGA CCTGATAGTT 9300
TGGCTGTGAG CAATTATGTG CTTAGTGCAT CTAACGCCGA GTTCAGCGGC AGTTTTTAAG TTGTGGTTTT ATGGAATACT TTTGCGCAGC AAAACCATAA 9400
AACCGCGACT TAAAAACTGT CCAAGGAGCG CAGCGACTGG TGCTGGAACG ACTTGTTAGC CTTTTTTCCA AATCTGATAT GTGTAATTTA TATTAGACAA 9500
AAAAAACTGC TCAAAAACCA AATTGAAATT CTCTGGAATT TTAGGAAAAT TGATATCACC TTCAACCTCA ACGTGAACAG TAGACAAATG AATTATATCT 9600
GCTTTTTCAA TAAGACTATT GTAGATTTGA CCGCCACCAG AGACATATAA ATGATCTGTA ATTTTCGATA GTTCTTGCAA AGCGATTTCT ATTGAAGGAA 9700
AGACTAATAC ATTTTCATTT GAGCTTGAAA TTCCTTTCCT CGACACTACT GCATATTTTC GATTTGGAAG AACACCCATA GAGTCAAATG TTTTCCTTCC 9800
AACAAGGAGC CACTGATTAT ATGTGAGCGC TTTAAAGAGT AACTGCTCAC CTTTTGCTGA CCATGGGATA TCAGGGCCAT TACCGATTAC GCCATTTTCT 9900
GACGTTGCAG AAATCAATGA AATTTTCAAT TCAACCCCCG TAATGGCTAA CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA 10000
ACATCAAACA TCGACCCACG GCGTAACGCG CTTGCTGCTT GGATGCCCGA GGCATAGACT GTACAAAAAA ACAGTCATAA CAAGCCATGA AAACCGCCAC 10100
TGCGCCGTTA CCACCGCTGC GTTCGGTCAA GGTTCTGGAC CAGTTGCGTG AGCGCATACG CTACTTGCAT TACAGCTTAC GAACCGAACA GGCTTATGTC 10200
CACTGGGTTC GTGCCTTCAT CCGTTTCCAC GGTGTGCGTC ACCCGGCAAC CTTGGGCAGC AGCGAAGTCG AGGCATTTCT GTCCTGGCTG GCGAACGAGC 10300
GCAAGGTTTC GGTCTCCACG CATCGTCAGG CATTGGCGGC CTTGCTGTTC TTCTACGGCA AGGTGCTGTG CACGGATCTG CCCTGGCTTC AGGAGATCGG 10400
AAGACCTCGG CCGTCGCGGC GCTTGCCGGT GGTGCTGACC CCGGATGAAG TGGTTCGCAT CCTCGGTTTT CTGGAAGGCG AGCATCGTTT GTTCGCCCAG 10500
CTTCTGTATG GAACGGGCAT GCGGATCAGT GAGGGTTTGC AACTGCGGGT CAAGGATCTG GATTTCGATC ACGGCACGAT CATCGTGCGG GAGGGCAAGG 10600
GCTCCAAGGA TCGGGCCTTG ATGTTACCCG AGAGCTTGGC ACCCAGCCTG CGCGAGCAGC TGTCGCGTGC ACGGGCATGG TGGCTGAAGG ACCAGGCCGA 10700
GGGCCGCAGC GGCGTTGCGC TTCCCGACGC CCTTGAGCGG AAGTATCCGC GCGCCGGGCA TTCCTGGCCG TGGTTCTGGG TTTTTGCGCA GCACACGCAT 10800
TCGACCGATC CACGGAGCGG TGTCGTGCGT CGCCATCACA TGTATGACCA GACCTTTCAG CGCGCCTTCA AACGTGCCGT AGAACAAGCA GGCATCACGA 10900
AGCCCGCCAC ACCGCACACC CTCCGCCACT CGTTCGCGAC GGCCTTGCTC CGCAGCGGTT ACGACATTCG AACCGTGCAG GATCTGCTCG GCCATTCCGA 11000
CGTCTCTACG ACGATGATTT ACACGCATGT GCTGAAAGTT GGCGGTGCCG GAGTGCGCTC ACCGCTTGAT GCGCTGCCGC CCCTCACTAG TGAGAGGTAG 11100
GGCAGCGCAA GTCAATCCTG GCGGATTCAC TACCCCTGCG CGAAGGCCAT CGGTGCCGCA TCGAACGGCC GGTTGCGGAA AGTCCTCCCT GCGTCCGCTG 11200
ATGGCCGGCA GCAGCCCGTC GTTGCCTGAT GGATCCAACC CCTCCGCTGC TATAGTGCAG TCGGCTTCTG ACGTTCAGTG CAGCCGTCTT CTGAAAACGA 11300
CAATGGAGGT GGTAGCCGAG GGTGTGGAAA CACCCGACTG CCTTGCGTGG TTGCGGCAGG CGGGTTGCGA CACGGTGCAG GGTTTCCTGT TCGCCAGGCC 11400
GATGCCGGCG GCGGCCTTCG TCGGCTTCGT CAACCAATGG AGGAACACCA CCATGAACGC CAATGAACCG AGCACCAGTT GCTGCGTGTG CTGCAAGGAA 11500
ATCCCGCTCG ATGCCGCCTT CACGCCGGAA GGGGCCGAGT ACGTGGAGCA TTTCTGCGGG CTGGAGTGCT ATCAGCGCTT CCAGGCGCGG GCCAGCACTG 11600
CGACCGAAAC CAGCGTCAAA CCGGACGCTT GTGATTCGCC GCCGTCAGGT TGAGGCATAC CCTAACCTGA TGTCAGATGC CATGTGTAAA TTGCGTCAGG 11700
ATAGGATTGA ATTTTGAATT TATTGACATA TCTCGTTGAA GGTCATAGAG TCTTCCCTGA CATTTTGCAG GGAATTCCAT GACTGGACAG CGCATTGGGT 11800
ATATCAGGGT CAGCACCTTC GACCAGAACC CGGAACGGCA ACTGGAAGGC GTCAAGGTTG ATCGCGCTTT TAGCGACAAG GCATCCGGCA AGGATGTCAA 11900
GCGTCCGCAA CTGGAAGCGC TGATAAGCTT CGCCCGCACC GGCGACACCG TGGTGGTGCA TAGCATGGAT CGCCTGGCGC GCAATCTCGA TGATTTGCGC 12000
CGGATCGTGC AAACGCTGAC ACAACGCGGC GTGCATATCG AATTCGTCAA GGAACACCTC AGTTTTACTG GCGAAGACTC TCCGATGGCG AACCTGATGC 12100
TCTCGGTGAT GGGCGCGTTC GCCGAGTTCG AGCGCGCCCT GATCCGCGAG CGTCAGCGCG AGGGTATTGC GCTCGCCAAG CAACGCGGGG CTTACCGTGG 12200
CAGGAAGAAA TCCCTGTCGT CTGAGCGTAT TGCCGAACTG CGCCAACGTG TCGAGGCTGG CGAGCAAAAG ACCAAGCTTG CTCGTGAATT CGGAATCAGT 12300
CGCGAAACCC TGTATCAATA CTTGAGAACG GATCAGTAAA TATGCCACGT CGTTCCATCC TGTCCGCCGC CGAGCGGGAA AGCCTGCTGG CGTTGCCGGA 12400
CTCCAAGGAC GACCTGATCC GACATTACAC ATTCAACGAT ACCGACCTCT CGATCATCCG ACAGCGGCGC GGGCCAGCCA ATCGGCTGGG CTTCGCGGTG 12500
CAGCTCTGTT ACCTGCGCTT TCCCGGCGTC ATCCTGGGCG TCGATGAACT ACCGTTCCCG CCCTTGTTGA AGCTGGTCGC CGACCAGCTC AAGGTCGGCG 12600
TCGAAAGCTG GAACGAGTAC GGCCAGCGGG AGCAGACCCG GCGCGAGCAC CTGAGCGAGC TGCAAACCGT GTTCGGTTTC CGGCCCTTCA CCATGAGCCA 12700
TTACCGGCAG GCCGTCCAGA TGCTGACCGA GCTGGCGATG CAAACCGACA AAGGCATCGT GCTGGCCAGC GCCTTGATCG GGCACCTGCG GCGGCAGTCG 12800
GTCATTCTGC CCGCCCTCAA CGCCGTCGAG CGGGCGAGTG CCGAGGCGAT CACCCGTGCT AACCGGCGCA TCTACGACGC CTTGGCCGAA CCACTGGCGG 12900
ACGCGCATCG CCGCCGCCTC GACGATCTGC TCAAGCGCCG GGACAACGGC AAGACGACCT GGTTGGCTTG GTTGCGCCAG TCTCCGGCCA AGCCAAATTC 13000
GCGGCATATG CTGGAACACA TCGAACGCCT CAAGGCATGG CAGGCACTCG ATCTGCCTAC CGGCATCGAG CGGCTGGTTC ACCAGAACCG CCTGCTCAAG 13100
ATTGCCCGCG AGGGCGGCCA GATGACACCC GCCGACCTGG CCAAATTCGA GCCGCAACGG CGCTACGCCA CTCTCGTGGC GCTGGCCACC GAGGGCATGG 13200
CCACCGTCAC CGACGAAATC ATCGACCTGC ACGACCGCAT CCTGGGTAAG CTGTTTAACG CTGCCAAGAA TAAGCATCAG CAGCAGTTCC AGGCGTCAGG 13300
CAAGGCCATC AACGCCAAGG TACGTCTGTA CGGGCGCATC GGTCAGGCGC TGATCGACGC CAAGCAATCA GGCCGCGATG CGTTTGCCGC CATCGAGGCC 13400
GTCATGTCCT GGGATTCCTT TGCCGAGAGC GTCACCGAGG CGCAGAAGCT CGCGCAACCC GATGACTTCG ATTTCCTGCA TCGCATCGGC GAGAGCTACG 13500
CCACCCTGCG CCGCTATGCA CCGGAATTCC TTGCCGTGCT CAAGCTGCGG GCCGCGCCCG CCGCCAAAAA CGTGCTTGAT GCCATTGAGG TGCTGCGCGG 13600
CATGAACACC GACAACGCCC GCAAGCTGCC AGCCGATGCA CCGACCGGCT TCATCAAGCC GCGCTGGCAG AAACTGGTGA TGACCGACGC CGGCATCGAC 13700
CGGCGCTACT ACGAACTGTG CGCGCTGTCC GAGTTGAAGA ACTCCCTGCG CTCGGGCGAC ATCTGGGTGC AGGGTTCACG CCAGTTCAAG GACTTCGAGG 13800
ACTACCTGGT ACCGCCCGAG AAGTTCACCA GCCTCAAGCA GTCCAGCGAA TTGCCGCTGG CCGTGGCCAC CGACTGCGAA CAATATCTGC ATGAGCGGCT 13900
GACGCTGCTG GAAGCACAAC TTGCCACCGT CAACCGCATG GCGGCAGCCA ACGACCTGCC GGATGCCATC ATCACCGAGT CGGGCTTGAA GATCACGCCG 14000
CTGGATGCGG CGGTGCCCGA CACCGCGCAG GCGCTGATAG ACCAGACAGC CATGGTCCTG CCGCACGTCA AGATCACCGA ACTGCTGCTC GAAGTCGATG 14100
AGTGGACGGG CTTCACCCGG CACTTCACGC ACTTGAAATC GGGCGATCTG GCCAAGGACA AGAACCTGTT GTTGACCACG ATCCTGGCCG ACGCGATCAA 14200
CCTGGGCCTG ACCAAGATGG CCGAGTCCTG CCCCGGCACG ACCTACGCGA AGCTCGCTTG GCTGCAAGCC TGGCATACCC GCGACGAAAC GTACTCGACA 14300
GCGTTGGCTG AACTGGTCAA CGCTCAGTTT CGGCATCCCT TTGCCGGGCA CTGGGGCGAT GGCACCACAT CATCATCGGA CGGACAGAAT TTCCGAACCG 14400
CTAGCAAGGC AAAGAGCACG GGGCACATCA ACCCAAAATA TGGCAGCAGC CCAGGACGGA CTTTCTACAC CCACATCTCC GACCAATACG CGCCATTCCA 14500
CACCAAGGTG GTCAATGTCG GCCTGCGCGA CTCAACCTAC GTGCTCGACG GCCTGCTGTA CCACGAATCC GACCTGCGGA TCGAGGAGCA CTACACCGAC 14600
ACGGCGGGCT TCACCGATCA CGTCTTCGCC CTGATGCACC TCTTGGGCTT CCGCTTCGCG CCGCGCATCC GCGACCTGGG CGACACCAAG CTCTACATCC 14700
CGAAGGGCGA TGCCGCCTAT GACGCGCTCA AGCCGATGAT CGGCGGCACG CTCAACATCA AGCACGTCCG CGCCCATTGG GACGAAATCC TGCGGCTGGC 14800
CACCTCGATC AAGCAGGGCA CGGTGACGGC CTCGCTGATG CTCAGGAAAC TCGGCAGCTA CCCGCGCCAG AACGGCTTGG CCGTCGCGCT GCGCGAGTTG 14900
GGCCGCATCG AGCGCACGCT GTTCATCCTC GACTGGCTGC AAAGCGTCGA GCTACGCCGC CGCGTGCATG CCGGGCTGAA CAAGGGCGAG GCGCGCAATG 15000
CGCTGGCCCG TGCCGTGTTC TTCAACCGCC TTGGTGAAAT CCGTGACCGC AGTTTCGAGC AGCAGCGCTA CCGGGCCAGC GGCCTCAACC TGGTGACGGC 15100
GGCCATCGTG CTGTGGAACA CGGTCTACCT GGAGCGTGCG GCGCATGCGT TGCGCGGCAA TGGTCATGCC GTCGATGACT CGCTATTGCA GTACCTGTCG 15200
CCACTCGGCT GGGAGCACAT CAACCTGACC GGTGATTACC TATGGCGCAG CAGCGCCAAG ATCGGCGCGG GGAAGTTCAG GCCGCTACGG CCTCTGCAAC 15300
CGGCTTAGCG TGCTTTATTT TCCGTTTTCT GAGACGACCC C

 Recombination Sites     

Name Coordinates Gene Sequence
attC cmlA6 3'-end 4666-4671 6 TTGGGC
attC qacEdelta1_sul1 core 8018-8051 34 CCGCTAGCGG GCGGCCGGAA GGTGAATGCT AGGC
attC dfrA7 core 9353-9416 64 TTTTTAAGTT GTGGTTTTAT GGAATACTTT TGCGCAGCAA AACCATAAAA CCGCGACTTA
AAAA
attI 9951-10006 56 CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCA
res 11638-11768 131 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAGA TGCCATGTGT AAATTGCGTC
AGGATAGGAT TGAATTTTGA ATTTATTGAC ATATCTCGTT GAAGGTCATA GAGTCTTCCC
TGACATTTTG C
res_site_I 11638-11676 39 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAG
res_site_II 11690-11733 44 ATTGCGTCAG GATAGGATTG AATTTTGAAT TTATTGACAT ATCT
res_site_III 11737-11768 32 TGAAGGTCAT AGAGTCTTCC CTGACATTTT GC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn5086 34-468 Passenger Gene Heavy Metal Resistance -
merT Tn5086 540-890 Passenger Gene Heavy Metal Resistance +
merP Tn5086 904-1179 Passenger Gene Heavy Metal Resistance +
merC Tn5086 1215-1637 Passenger Gene Heavy Metal Resistance +
merA Tn5086 1689-3383 Passenger Gene Heavy Metal Resistance +
merD Tn5086 3401-3763 Passenger Gene Heavy Metal Resistance +
merE Tn5086 3760-3996 Passenger Gene Heavy Metal Resistance +
urfM 5'-end Tn21 3993-4663 Passenger Gene Other +
urfM 5'-end Tn5086 3993-4663 Passenger Gene Other +
tniA In22 4775-6454 Transposase   +
tniB delta1 In22 6457-7313 Accessory Gene   +
GNAT_fam In22 7418-7918 Passenger Gene Antibiotic Resistance -
sul1 (ARO:3000410) In22 8046-8885 Passenger Gene Antibiotic Resistance -
qacEdelta1 (ARO:3005010) In2 8879-9226 Passenger Gene Antibiotic Resistance -
dfrA7 (ARO:3002862) In22 9456-9929 Passenger Gene Antibiotic Resistance -
intI1 In22 10087-11100 Integron Integrase Class 1 +
tnpM Tn5086 11303-11653 Accessory Gene Inhibitor +
tnpR Tn5086 11779-12339 Accessory Gene Resolvase +
tnpA Tn5086 12342-15308 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn5086 435 34-468 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLREPDKPY GSIRRYGEAD VVRVKFVKSA QRLGFSLDEI AELLRLDDGT HCEEASSLAE HKLKDVREKM
ADLARMETVL SELVCACHAR KGNVSCPLIA SLQGEAGLAR SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn5086 351 540-890 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPQNGRGA LFAGGLAAIL ASTCCLGPLV LVALGFSGAW IGNLTVLEPY RPLFIGAALV ALFFAWKRIY RPVQACKPGE VCAIPQVRAT YKLIFWIVAV
LVLVALGFPY VVPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn5086 276 904-1179 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFASLAL AAAVAPVWAA TQTVTLAVPG MTCAACPITV KKALSKVEGV SKVDVGFEKR EAVVTFDDTK ASVQKLTKAT ADAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn5086 423 1215-1637 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   transmembrane protein mercury transport
Target:   Mercury
Protein Sequence:  
MGLMTRIADK TGALGSVVSA MGCAACFPAL ASFGAAIGLG FLSQYEGLFI SRLLPLFAAL AFLANALGWF SHRQWLRSLL GMIGPAIVFA ATVWLLGNWW
TANLMYVGLA LMIGVSIWDF VSPAHRRCGP DGCELPAKRL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn5086 1695 1689-3383 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MSTLKITGMT CDSCAVHVKD ALEKVPGVQS ADVSYAKGSA KLAIEVGTSP DALTAAVAGL GYRATLADAP SVSTPGGLLD KMRDLLGRND KTGSSGALHI
AVIGSGGAAM AAALKAVEQG ARVTLIERGT IGGTCVNVGC VPSKIMIRAA HIAHLRRESP FDGGIAATTP TIQRTALLAQ QQARVDELRH AKYEGILEGN
PAITVLHGSA RFKDNRNLIV QLNDGGERVV AFDRCLIATG ASPAVPPIPG LKDTPYWTST EALVSETIPK RLAVIGSSVV ALELAQAFAR LGAKVTILAR
STLFFREDPA IGEAVTAAFR MEGIEVREHT QASQVAYING EGDGEFVLTT AHGELRADKL LVATGRAPNT RKLALDATGV TLTPQGAIVI DPGMRTSVEH
IYAAGDCTDQ PQFVYVAAAA GTRAAINMTG GDAALNLTAM PAVVFTDPQV ATVGYSEAEA HHDGIKTDSR TLTLDNVPRA LANFDTRGFI KLVVEEGSGR
LIGVQAVAPE AGELIQTAAL AIRNRMTVQE LADQLFPYLT MVEGLKLAAQ TFNKDVKQLS CCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn5086 363 3401-3763 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MSAYTVSQLA HNAGVSVHIV RDYLVRGLLR PVACTTGGYG VFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGAQ AAAQLAVLRQ LVERRRAALA
HLDAQLASMP AERAHEEALP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn5086 237 3760-3996 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Comment:   similar to urf-1 in pKLH2 (GenBank AF213017), pKLH272 (Genbank Y08992), pMER610 (GenBank Y08993), pKLH210 (GenBank Y10102), Tn5036 (Genbank Y09025), orf1 in Tn501 (GenBank Z00027), and urf-1 in Tn5041 (GenBank X98999)
Protein Sequence:  
MNAPDKLPPE TRQPVSGYLW GALAVLTCPC HLPILAAVLA GTTAGAFLGE HWGVAALALT GLFVLAVTRL LRAFRGGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM 5'-end N Tn21 671 3993-4663 +
Class:   Passenger Gene
Sub Class:   Other
Comment:   urfM ORF interrupted by insertion of In2
Protein Sequence:  
MTSSQPAGWT AAELAQAAAR GQLDLHYQPL VDLRDHRIAG AEALMRWRHP RLGLLPPGQF LPLAESFGLM PEIGAWVLGE ACRQMHKWQG PAWQPFRLAI
NVSASQVGPT FDDEVKRVLA DMALPAELLE IELTESVAFG NPALFASFDA LRAIGVRFAA DDFGTGYSCL QHLKCCPITT LKIDQSFVAR LPDDARDQTI
VRAVIQLAHG LGMDVIFRRR LHQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM 5'-end N Tn5086 671 3993-4663 +
Class:   Passenger Gene
Sub Class:   Other
Comment:   urfM ORF interrupted by insertion of In2
Protein Sequence:  
MTSSQPAGWT AAELAQAAAR GQLDLHYQPL VDLRDHRIAG AEALMRWRHP RLGLLPPGQF LPLAESFGLM PEIGAWVLGE ACRQMHKWQG PAWQPFRLAI
NVSASQVGPT FDDEVKRVLA DMALPAELLE IELTESVAFG NPALFASFDA LRAIGVRFAA DDFGTGYSCL QHLKCCPITT LKIDQSFVAR LPDDARDQTI
VRAVIQLAHG LGMDVIFRRR LHQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA In22 1680 4775-6454 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   can be extended upstream by 12 amino acids| identical to tniA (Tn1721 and In2)| 25% amino acid sequence identity to TnsB from Tn7
Protein Sequence:  
MATDTPRIPE QGVATLPDEA WERARRRAEI ISPLAQSETV GHEAADMAAQ ALGLSRRQVY VLIRRARQGS GLVTDLVPGQ SGGGKGKGRL PEPVERVIHE
LLQKRFLTKQ KRSLAAFHRE VTQVCKAQKL RVPARNTVAL RIASLDPRKV IRRREGQDAA RDLQGVGGEP PAVTAPLEQV QIDHTVIDLI VVDDRDRQPI
GRPYLTLAID VFTRCVLGMV VTLEAPSAVS VGLCLVHVAC DKRPWLEGLN VEMDWQMSGK PLLLYLDNAA EFKSEALRRG CEQHGIRLDY RPLGQPHYGG
IVERIIGTAM QMIHDELPGT TFSNPDQRGD YDSENKAALT LRELERWLTL AVGTYHGSVH NGLLQPPAAR WAEAVARVGV PAVVTRATSF LVDFLPILRR
TLTRTGFVID HIHYYADALK PWIARRERWP SFLIRRDPRD ISRIWVLEPE GQHYLEIPYR TLSHPAVTLW EQRQALAKLR QQGREQVDES ALFRMIGQMR
EIVTSAQKAT RKARRDADRR QHLKTSARPD KPVPPDTDIA DPQADNLPPA KPFDQIEEW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB delta1 TniB delta1 In22 857 6457-7313 +
Class:   Accessory Gene
Function:   probable ATP-binding protein.
Comment:   probably truncated by insertion of IS1326::IS1353
Protein Sequence:  
MDEYPIIDLS HLLPAAQGLA RLPADERIQR LRADRWIGYP RAVEALNRLE ALYAWPNKQR MPNLLLVGPT NNGKSMIVEK FRRTHPASSD ADQEHIPVLV
VQMPSEPSVI RFYVALLAAM GAPLRPRPRL PEMEQLALAL LRKVGVRMLV IDELHNVLAG NSVNRREFLN LLRFLGNELR IPLVGVGTRD AYLAIRSDDQ
LENRFEPMML PVWEANDDCC SLLASFAASL PLRRPSPIAT LDMARYLLTR SEGTIGELAH LLMAAAIVAV ESGEEAINHR TLSMA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
GNAT_fam GNAT_fam In22 501 7418-7918 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  GNAT
Protein Sequence:  
MDSEEPPNVR VACSGDIDEV VRLMHDAAAW MSAKGTPAWD VARIDRTFAE TFVLRSELLV ASCSDGIVGC CTLSAEDPEF WPDALKGEAA YLHKLAVRRT
HAGRGVSSAL IEACRHAART QGCAKLRLDC HPNLRGLYER LGFTHVDTFN PGWDPTFIAE RLELEI

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
sul1 (ARO:3000410) Sul1 In22 840 8046-8885 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Transpoase Chemistry:   dihydropteroate synthase
Target:   sulfonamide antibiotic (ARO:3000282)||sulfone antibiotic (ARO:3003401)
Sequence Family:  sulfonamide resistant sul (ARO:3004238)
Comment:   perfect match to reference sequence for ARO:3000410
Protein Sequence:  
MVTVFGILNL TEDSFFDESR RLDPAGAVTA AIEMLRVGSD VVDVGPAASH PDARPVSPAD EIRRIAPLLD ALSDQMHRVS IDSFQPETQR YALKRGVGYL
NDIQGFPDPA LYPDIAEADC RLVVMHSAQR DGIATRTGHL RPEDALDEIV RFFEARVSAL RRSGVAADRL ILDPGMGFFL SPAPETSLHV LSNLQKLKSA
LGLPLLVSVS RKSFLGATVG LPVKDLGPAS LAAELHAIGN GADYVRTHAP GDLRSAITFS ETLAKFRSRD ARDRGLDHA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacEdelta1 (ARO:3005010) QacEdelta1 In2 348 8879-9226 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   acridine dye (ARO:3000054)||quaternary ammonium salts
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Comment:   subunit of the qac multidrug efflux pump||perfect match to reference sequence for ARO:3005010 (bitscore:219)
Protein Sequence:  
MKGWLFLVIA IVGEVIATSA LKSSEGFTKL APSAVVIIGY GIAFYFLSLV LKSIPVGVAY AVWSGLGVVI ITAIAWLLHG QKLDAWGFVG MGLIIAAFLL
ARSPSWKSLR RPTPW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
dfrA7 (ARO:3002862) DfrA7 In22 474 9456-9929 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Target:   diaminopyrimidine antibiotic (ARO:3000171)
Sequence Family:  trimethoprim resistant dihydrofolate reductase dfr (ARO:3001218)
Comment:   100% identity to reference sequence ARO:3002862 in Acinetobacter baumannii (bitscore: 319)
Protein Sequence:  
MKISLISATS ENGVIGNGPD IPWSAKGEQL LFKALTYNQW LLVGRKTFDS MGVLPNRKYA VVSRKGISSS NENVLVFPSI EIALQELSKI TDHLYVSGGG
QIYNSLIEKA DIIHLSTVHV EVEGDINFPK IPENFNLVFE QFFLSNINYT YQIWKKG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 In22 1014 10087-11100 +
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LRTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpM TnpM Tn5086 351 11303-11653 +
Class:   Accessory Gene
Sub Class:   Inhibitor
Function:   transposition regulator; reported to enhance Tn21 transposition and suppress resolution of cointegrate replicons in vivo
Comment:   3'-end of urfM ORF, which is interrupted by insertion of In2||inhibits tranposition probably by inhibiting resolution
Protein Sequence:  
MEVVAEGVET PDCLAWLRQA GCDTVQGFLF ARPMPAAAFV GFVNQWRNTT MNANEPSTSC CVCCKEIPLD AAFTPEGAEY VEHFCGLECY QRFQARASTA
TETSVKPDAC DSPPSG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn5086 561 11779-12339 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   identical to tnpR (TnAs3 )
Protein Sequence:  
MTGQRIGYIR VSTFDQNPER QLEGVKVDRA FSDKASGKDV KRPQLEALIS FARTGDTVVV HSMDRLARNL DDLRRIVQTL TQRGVHIEFV KEHLSFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKSLSSER IAELRQRVEA GEQKTKLARE FGISRETLYQ YLRTDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn5086 2967 12342-15308 +
Class:   Transposase
Function:   transposition, DNA-mediated (GO:0006313)
Transpoase Chemistry:   DDE
Comment:   identical to TnAs3 tnpA
Protein Sequence:  
MPRRSILSAA ERESLLALPD SKDDLIRHYT FNDTDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEL PFPPLLKLVA DQLKVGVESW NEYGQREQTR
REHLSELQTV FGFRPFTMSH YRQAVQMLTE LAMQTDKGIV LASALIGHLR RQSVILPALN AVERASAEAI TRANRRIYDA LAEPLADAHR RRLDDLLKRR
DNGKTTWLAW LRQSPAKPNS RHMLEHIERL KAWQALDLPT GIERLVHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LATEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLY GRIGQALIDA KQSGRDAFAA IEAVMSWDSF AESVTEAQKL AQPDDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKN VLDAIEVLRG MNTDNARKLP ADAPTGFIKP RWQKLVMTDA GIDRRYYELC ALSELKNSLR SGDIWVQGSR QFKDFEDYLV PPEKFTSLKQ
SSELPLAVAT DCEQYLHERL TLLEAQLATV NRMAAANDLP DAIITESGLK ITPLDAAVPD TAQALIDQTA MVLPHVKITE LLLEVDEWTG FTRHFTHLKS
GDLAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHTRDET YSTALAELVN AQFRHPFAGH WGDGTTSSSD GQNFRTASKA KSTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGLRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERAAHALRGN GHAVDDSLLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
In22-CP054343 In22 Integron 4634-11302 6669

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
repeat i4 Tn5086 10-28 TCAGAAAACG GAAAATAAA
IRt In22 4634-4666 TGTCATTTTC AGAAGACGAC TGCACCAGTT GAT
repeat t1 In22 4642-4660 TCAGAAGACG ACTGCACCA
repeat t2 In22 4682-4700 AACACGTCGG TCGAGGACT
repeat t3 In22 4711-4730 TCAGAAGTGA TCTGCACCAA
repeat t4 In22 4743-4761 TCAATACTCG TGTGCACCA
IRL IS1326::IS1353 7312-7313 TG
repeat i4 In22 11183-11201 AGGAGGGACG CAGGCGACT
repeat i3 In22 11211-11229 CGTCGGGCAG CAACGGACT
repeat i2 In22 11253-11271 ATCACGTCAG CCGAAGACT
IRi In22 11270-11302 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 In22 11276-11294 GTCACGTCGG CAGAAGACT
IRR Tn5086 15304-15341 GAATCGCACG AAATAAAAGG CAAAAGACTC TGCTGGGG