Transposon
Name: Tn5046
Family: Tn3        Group: Tn3
Evidence of Transposition: no
 Host     

Date of Isolation:2001

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 46 bp)GGGGTTTGGGGAGCAATGGAACAGAAAGTGCACTTAAGCCCTACCA
IRR (Length: 46 bp)GGGGTTTGGGGAGCAACGGAACAGAAAGTGCACTTAAGCCCTGCCA

 Sequence     
DNA SequenceLength  10118 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTTTGGG GAGCAATGGA ACAGAAAGTG CACTTAAGCC CTACCAGCGC CGTTCAGAGC CTTCTTCCCA GGCATCGGCT TCGATAAAGC AGTTGCGCAT 100
GTCGGCTTCC TGGCTGATCT CGGTCAGCAA GTCATGCACG GTCTTGTCCA GCTCATCGTC GCTCCGATAC GGAATGGCCA GTTCGTAGTT GCCCGACTCC 200
AGCCGTTTCA TACTGTAGGG CTCCAAGCAG TAGCGCTCGA AGTTTTCCTT GGCCCGTTTC CGGCCGCGAA CGAACTTGCT GTTGTTCACC ACCGCCAGGC 300
GCAGCGTGAC GGTGGCCACC TGCTCGGCGG CGGGCTCTGC CGGCGACGCG ACATTGCGTT GCTGACCTCG CGGCTGGGCA CTCTTCTGGT GTGCGCCGAT 400
CTCAACACCA CGATGGCGCA GGTAGCTGTA CAGCGTGCTC TTGGAGATGT GTAACTTCTC GCCGATGGCG CTGACGCTCA GGCGGCCCTC GCGGTACAGC 500
GTCTCGGCCG CCATGGAGGT GGCCTCGGCC TTGGCTGGGA AGCCCTTGGG ACGGCCACCG ATCCGGCCCC GCGCCCGCGC GGCCGACAAA CCCGCCTGAG 600
TCCGCTCGCG GATCAGCTCG CGCTCGAACT CGGCCAGCAA GGCAAACAGG TTGAACACCA AGCGACCTTG GGCGTGGGTG GTGTCGATTG GGTCATTCAG 700
GCTCTGCAAG CCGACCTTGC GCTCTGCCAG CTCGCCGACC AGCTCGACCA GGTGTTTGAG GGAGCGCCCG AGGCGATCCA GCTTCCAGAT CACCACGGTG 800
TCGCCCGCTC GAACATGGGC TAGCAACTTG TCCAACTCCG GCCGGGCGCT TTTCGCGCCG CTGGCGATGT CTTGATAGAT GCGTTCGCAC CCGGCCTGTT 900
TCAGGGCATC GACCTGGAGG TCGGCGTTCT GATCCCGAGT GCTCACCCGC GCATAACCGA TCTTCATCAA AAGTACCGTT TACTCGACTA CGTTAGTAAT 1000
AGTTGAACTT TGATTAAGCG TACCAGTTAT TTGAACCGTA GCGCAGGTAG GTTAACCAGC CGATTCCTGT CCACTTAAAG TTCGGCAAAA CGAAGGTTTT 1100
TTTGAACCAT TGCATAGCCC TTTGTGATTG GCGTATAAAC ACACAAACAC CTACTAGCGG GGAACGCCAT GAATACGATT CGCTGGAATG TCGCCGTCTC 1200
GGCCGACACC GACCAGTCGC TTCGGATGTT TCTGGCCAGC CAGGGCGGTG GCCGGAAAGG CGACCTGTCG CGCTTCATTG AAGAGGCGGT GCGGGCCCAC 1300
ATCCTGGAAC TGACGGCCGA ACAGGCCAAG GCCGCTAATG CCCATCTGAG CGAGGCAGAG CTGACCGAAG CGGTTGACGA AGCGCTCGAC TGGGCACGTA 1400
AGCGCTGATG CGGGTCGTGT TGGATACCAA CATCCTGTTC AGCGCACTGA TCTCGCCGCA TGGCGCGCCC GATGCGATCT ACCGTGCCTG GCGGGCGGCG 1500
CGTTTCGAGG TAGTGACCTC GCGGATGCAG CTCGATGAAA CTCGCCGAGC CAGCCGCTAC CCCAAGCTCC AGGCCATCCT TCAGCCCGCC AAAGTGGGAG 1600
CCATGATCAA TAACCTGCAA CGGGCTGTGG TACTGGAGCG TCTGACCATC GAGGTCGAAG CCGATGATCC GGATGACTCG TTTCTGCTGG CCATGGCCCT 1700
GGCAGGCGAT GCGGACTACC TGGTGACCGG TGATCGCCGC GCCGGCCTGC TGCAACGCGG GCACATCGAA CGCACGCGGA TTGTCACGCC CGCCGTGTTC 1800
TGCGCCGAGG TGCTGTGATC GATGCCGGTC GGTTTTCTGA CCCAGGAGCA ACGCGACGGT TTTGGCCGCT ATGTCGATGC CCCCAGTCGT GAGGAGCTGG 1900
AACGCTACTT CCACCTGAGC GACGACGACC ACAAAATCCT CCTACCGCTG CGCGGCGAGC ACAACCGCCT TGGCTACGCC ACCCAACTGA CCAGCATCCG 2000
CTACCTGGGC ACTTTTCCCG ACGACTTTTC AGCCGTCCCC CAAGAGGTGC TGCAAGCGCT CAGTCGCCAG TTAGGCATTA CCGATCCAAC TTGTATCCAG 2100
GCCTATGCCG AAACCCGCCA ACGTCAACGT CATGCCGCCG AGATTCAGGA GCGTTACGGC TATCGGGTGT TTGCTGATTC CAGCGTCGGC TTTCGACTTG 2200
CCCGCTGGCT GTATGCGCTC TGTTGGACAG GGACAGATCG TCCTGGCGAG TTGTTCAATC GGGCGACGAC CTGGTTGCTG ACGCACAAGG TTTTACTGCC 2300
CGGCGTCACC GTTCTGGAAC GGTTCATCGC CCAACTGCGC AGCCGGGTCG AAGAACGCCT CTGGCTAACC CTTGGCCGCA GTGTGAGCGA GGCGCAACGG 2400
CAGCAGCTAC AGGACTTGCT GCTGGTCGCC GAAGGCAACC GCAGTTCCCG GCTGGATCAA CTGCGCTCCG GCCCGGTGAT GGTCAGTGGC CCCGCACTGA 2500
TTCGGGCGCT GCGCCGGCTT GATGACGTGC GCGGCATCGG CATCGCCTTG CCAGCGGCGG CGCACATCCC GCCCAGCCGT ATCGCGGCCC TGGCTCGCTT 2600
CGCCAACACC GCCAAGGTCA CGGCGATCAA CCGGCTGCCG GCGTCGCGGC GGATGGCGAC ACTGGTGGCG TTCGCCCTGT GCCTGGAGGC CACCGCGCAC 2700
GACGACGCCC TGGAGGTCCT GGAAGCGCTG TTACGCGACC TGTTCAGCAA CGCGGAGAAG GCCGACAAGA AAGCCCGCAT GCGCAGCCTG AAAGACCTGG 2800
ATCGCTCGGC GGCGACGCTC GCCGCCGCGT GCAAGGTCGT GCTGGACAGC TCAATCAGCG ATGACAAGGT GCGCGCCCGG CTGTTCAACG ACCTGCCGAG 2900
GGCCTCGCTG GAGAAAGCCC TGGAAGATGT CAATGCGCTG ATCCGCCCGG TTGACGATGT GTATTTTCTC GCCCTGGAGG CGCGCTACCG CAGTGTGCGC 3000
CGTTTCCTGC CCGACCTGCT CAAGCACATC CGCTTCGGCT TCAGCCCGGC CGGCAAAGGC GTGGTCGCCG GCCTGGATTG GTTGCAGCTG AACCTGCCCC 3100
GCCGGAAACC GGAGGATGAC GCGCCGCAGG AGATCGTGGC CAAGGCTTGG CAGAAGCACA TTACCCGCGA GGATGGCTCC CTCGACATGG GCGCCTATGT 3200
GTTCTGCACG CTCGATGCGC TGCGCACGGC CCTGCGCCGG CGCGACGTGT TCGTCTCGCC CAGTTGGCGC TATGCCGACC CGCGTCTCGG CCTGCTCGAC 3300
GGTGCCGAAT GGCTGGCGGC GCGGCCGATC ATCTGCCGCT CGCTGGGCCT GACCATTGAC GCCGGCACCA CCTTGGATGC GCTGAGCGCC GAGTTGGATG 3400
CGACCTGGCA GGCGGTCGCG GCCCGCCTAC CCGACAACCC CGCGATCCAG CTGAGCGAGA ACCGCGAGGG CAAGACCGAG CTCTCGCTCG GCACACTGTC 3500
CAAGCTGGAG GAGCCGAACT CGCTGCTGCA ACTGCGAGCA GCCGTGGCTG ATCTGATGCC GCGTGTCGAT CTGCCGGAAA TCCTCTTGGA AATCGCCGCT 3600
CGCACCGGCT TCGCCGAGGC CTTCACCCAT GTGTCCGAGC GCAATGCGCG CGCCGACAAC CTGGTCACCA GCCTCTGCGC GGTGCTGCTG GGTGGGGCTT 3700
GCAACACCGG CCTGGAGCCG CTGATCCGCA CCGACAATCA GGCGCTACGC CGCGACCGGC TGTCCTGGGT CAGCCAGAAC TATATCCGTG ACGACACGCT 3800
GTCAGTGGCA AACGCCATTC TGGTGGGGGC GCAGAGCCAA CTGGAGCTGG CCCAGGTCTG CGGTGGTGGT GAGGTCCCTC CCGCCGATGG CATGCGCTTC 3900
GTGGTACCGG TGCGCACCGT GCATGCTGGC CCCAACCCGA AGTATTTCGG CACCGGCCGG GGCGTCACCT GGTACAACTT GATTTCCGAT CAGTTCTCCG 4000
GCCTCAACGC CATCACCGTG CCCGGCACCC TGCGCGACAG CCTGGTGCTG CTGGCCGTGG TGCTGGAACA CGAGACCGAG TTGCAGCCGA CGCAGATCAT 4100
GACCGACACC GGGGTCTACA GCAATGTGGT GTTTGGGCTG TTCCGCCTGC TCGGCTACCA CTTCAGCCCG CGCCTGGCCG ACGTTGGCGG TACCCGTTTC 4200
TGGCGCACGC GCCCGGAGGC GGATTACGGC AAACTCAACG GCCTGGCCCG GCAGTCGGTC AAGCTCGATC TGATCGCCGA GCACTGGGAC GACCTGCTAC 4300
GCCTGGCCGG CTCGCTCAAG CTCGGCCGAG TGCCGGCCAC CGGCATCATG CGCACCCTGC AAACAGGGGA TCGTCCCACC CGCCTGGCCC AGGCGCTGGC 4400
TGAGTTCGGT CGCATCGAGA AGACCTTGCA CACCCTGACC TACATCGACG ACGAGTCCAA GCGCCGCGCC ACCCTGACCC AGCTGAACCG GGGCGAAGGC 4500
CGCCACAGCC TGGCCCGCCC GGTGTTCCAC GGCAAACGCG GCGAGCTGCG CCAGCGCTAC CGCGAAGGCC AGGAGGACCA GCTCGGCCCC CTCGGCCTGG 4600
TGGTGAACAT CATCGTGCTG TGGAACACCC TCTACATGAC GGCGGCCGTA GAACGGCTCA GGCAGCACGG CTACCCGGTG CTGGAGGAGG ATGTCGCGCG 4700
GCTCTCGCCA CTGATCCACG AGCACATCAA CATGCTGGGC CGTTACTCCT TCGCGGTGCC GGAAGAGGTT ACCCGCGGCG AACTGCGGCC CGTGCGCAAT 4800
CCGGACGACG ACCAGTAGGT GTAACGGCCT GGGTTCGAAA TCGGCCGGGC ACCGCACTCG TAGCCACTTC CAGCTCAGAC GGATTGCGAC TGACGGAGTC 4900
CTCGGGCTCA CGCTTTCTGC GACCAGCAAG AGCCACTTTT CCGGTGCAGC GCGAATTAGC CGTCCTGACG GGTACTGACC TTTTGTGTGC AGGGGTGATC 5000
AGGCTCGGAT GCCGCCCTCT TATCTGCTCG CGACATGAAA CGCTGATAGC ACTCCAGGCC ACAGAAGTGC ACGACATACT CGGAACCTTC CGGCGTCAGT 5100
GCGGCGTCAA GGGGAATGTC CTTGCAGCAT TCGCAGCAGC TGATGGTGGA GGTGTTGTTT GTGTTCATGA TGGGGGTTCC TCCATGTCCA AGAAAAGGTA 5200
GCAACGCTTT CCCCCCGTGA CTGAGCGCCG ATCGACCTGC AGCCTCCCAG CCCAACTCGG CAGTGGTGGT CGCGCCGTGC TCCGAGCGGG TCACGGTCGC 5300
TTCCGAAAGG CCTGCAATGC CGCTCGCAGG AAGAGGATGA AGAAAACCGC CAGCACGAGC GTCGCGAGGC TCCACTGCTC GCTGACGAAC GCGCCGGCCG 5400
CTGTCCCCGA AAGCAGCAAT GCCAGCACCG GCAGATGGCA AGGGCAGGTG AGCGCGGCGA GCACGCCCCA GGTGTAAGCA CGCCAGCGGA AGACCTTGCT 5500
TGACTCAACG TGTACGGCGT TACGCATAGG CAGAACCTTC GCCGGCGCAA TGAGTCAGCC CGGCCAGCTG GGTTGCCACT GCGGCTAAGG CCGCCTGCCG 5600
TGCCGTGACT AGCCGGAGCA GGCACTCGAC GCAGCCGATC AAGTCGGCGC CATCGTCCGC ATCGAGCGCC CGGCAGAGCC GTGCCAATTC GTCGAGCCCG 5700
ATACCAGACT CGAAGGCGGC GCGCACGAAG CGCAGACGCG CCAGGGACCG CTCATCGAAA ATGCCGTAAC CGCTCTCCGT GCGCCGCGCG GGGTGCAGCA 5800
AGCCACGCAG CACATAGTCG CGGCCAACAT GCACGCTGAC GCCCGCGTCC TCGGCCAGTC TGGATATGGT GTAGGCATTC ATCACCGACA CTCCCGGTCT 5900
TCCCCGCAAA CTAGGGCGCT CAGATATTTC CTTCCGGCTA GGCGTTCAGG TAGCCAGATG AGCAATGGCG TAACCCCTAG TGCCAGGAGC AACCACAGCC 6000
GGGAGTGATA CTCGCCGTTT GGGGCAAACC CATAAGCCAG CAGCGCACCC AGCGCGAGCA TCAGGAAATA CGGCCCGGTG ATGTAGCAGT GAAGGCGGCG 6100
ACAGCGCGCG GCGTTGACCA GGCAGGCGCC GCCCATCACG AGTAGCGCGG CGCTCGCTGC CAGGAACAAC GCAGGGCGTC GATCCGCCAG AACAAGCGCT 6200
ATGGTCGCCA CGACGGCAGG CAGCCCCCAT AAGCTGATTA CCTGCCAGGT CTTGCGCAGG CTGTCGCGAC TGCCGAGATC GCTTGCCGTG TCGTTCATGC 6300
TTCAACCTCG CGCGCTCATT ACCCGGCGCA GCAGGACAGC TGCTTGACGT CCTTGGCGAA GGTTTGCGCC GCGAGCTTCA GCCCCTCGAC CATCGTCAGG 6400
TAGGGGAACA ACTGGTCGGC CAGTTCCTGC ACCGTCATCC GCGCCCGGAT GGCGATGGCG GCGGTCTGGA TCAGTTCGCC CGCCTCCGGG GCCACCGCCT 6500
GCACGCCGAT GAGCCGTCCG CTACCTTCCT CCGATGACCA GCTTGATGAA ACCCGCGTGT CGAAGTTGGC CAGTGCGCGA GGCACGTTAT CCAGGGTCAA 6600
GGTGCGGCTG TCGGTCTCGA TGCCGGCGTG GTGCGCCTCC GCTTCGCTGT AGCCCACGGT GGCCACCTGC GGATCGGTGA ACACCACGGC CGGCATGGCG 6700
TCGAGATTGA GCTTCGCCTC GCCGCCGGTC ATGTTGAGCG CCGCACGGGT GCCTGCGGCC GCCGCCACGT AGACGAACTG CGGCTGGTCG GTACAGTCGC 6800
CGGCCGCATA GATATCCGGG GCACTGGTGC GCATGCCCGA GTCGATCTGG ATGGCACCGC GTTCGTCCAG CTTCACGCCG GCGCCTTGCA GATTCATGCC 6900
TTGGGTGTTG GGCGTGCGGC CGGTGGCGAC GAGTAGTCGG TCGGCATGCA GCTCGCCATG ATTGGTGCTC AGGATGAACT CGCCGTCGAC GTGGGACACC 7000
TGGCTGGCTT GCGTGTGTTC CAGCACTTCG ATGCCCTCCA TACGGAAGGC TGCCGTCAGC GCTTCACCGA TGGCCGGATC TTCGCGGAAG AACAACGTGC 7100
TGCGTGCCAG GACCGTGACC TTGCTGCCCA GCCGGGCAAA GGCCTGCGCC AGTTCCACCG CCACCACCGA GGAGCCGATC ACGGCGAGCC GCTTAGGAAT 7200
GGTGTCGCTC GCCAGCGCCT CGTCCGAGGT CCAGTACGGG GTGTCCTTGA GTCCGGGAAT CGGTAGAACG GCCGGGCTCG CGCCGGTGGC GATCAGGCAG 7300
CGGTCGAAGG CGACGATGCG CTCGCCGCCC TCGGCCAGTT CCACGCTGAG CGTGCGGCCG TCCTGGAAAC GGGCGGTGCC GCGTACCAGG GTGATCGCCG 7400
GCGTGCTCTC CAGAATGCCT TCGATCTTGG CGTGGCGCAG TTCGTCGACA CGACCCTGTT GCTGGGCGAG CAACCGCTCG CGCAGGACGG TCAGGCTCGT 7500
GGTGGACAGT CCGGCGTCGA ACGGGCTCTC GCGCCGCAGA TGGGCCACAT GCGCGGCGCG AATCATGATC TTGGAGGGCA CGCAGCCAAC GTTGACGCAG 7600
GTGCCGCCGA TGATGCCGCG CTCGATCAGG GTGACGCGCG CACCGCCTTC CACCGCCTTG AGCGCGGCCG CCATGGCGGC GCCACCGCTG CCGATGACCG 7700
CCACGTGGAG CCTGTCGCCA TCTTTCCCGG CGCCAATGCT GCCGCTCAAC CAGCCCCGCG CCTTGTCGAG CAGGCCTGAG CGGGTAGGTG CCGTGGCGTC 7800
TTCGAACGCC GCTCGATACC CCAGGGCCTC GACGGCGGCC TGCATCTGTT CACGGCTTAC GCCCTCGTCG ACCTTCAGTT CGGCCTTCCC GCTGGCGTAG 7900
GAAACATCCG CCCGATGCAC GCCGGGGATC TTCTCCAAGG CCTCTTTCAC ATGCTCGACA CAGGAGGCGC AGGTCATGCC GACGATTTGT AGTTTGGTCA 8000
TAGTGTTATT CCTTCATTTT GGCGGAGTCG GACAGGACGT CGGGGAGCAA CGGCGGTGGG CGGGCGACAC GAGATCCCAG ATGGACACCC CAAACATGAG 8100
GGCCAGGCCG ATATAGAGCA GCCAGCCGCT CCGCCAGCCG TGAGCCAGCA TCAAATACAC CGCTATCAGC ACCAGGGCCG GGCCGATCAG GCCAGGCGCA 8200
GCGCGTCGCC ACTGCCGGTG ACTGAACCCG CCGAGGGCAT TGACGAGCAG GGCCAGCCCG GCAAATAACG GCAGCAGCGT GGTGATGAAC AGGCCTTCCC 8300
ACTGGCTCAG AAAGCCCAGA CCGATCGCGG CCCCCAGACC GGCAAGGGCG GGGAAACACG AGGCACAGCC TATGGCAGAA ATCAGCACGC CAACGGACCC 8400
GGCTTTGTCA CCGATCCGCG TGAACAAATT GAAAGGGTTT GCCATCGGAA TGCCCGCCTA CTGCTTGACG CTGGACGGGT AGCCGGCGTC CTCGGTCGCC 8500
TTAGTCAGCG CCTGGACATT GGTCTTGGCA TCATCGAAGG TGACGATGGC CTCGCGGTTC TCATAGCTCA CCTCGGCCTT GGTCACGCCC TCGACCTTGG 8600
TCAGCGCCTT CTTCACCGTG ATCGGGCAAG CGGCGCAGGT CATGCCCGGC ACCGCCAGAG TGACGGTCTG CGTGGCCGCC CAGGCAGGTG CGGCGACTAG 8700
GGTGGCGAGG GCGAAGGATG CAAGCAGTTT TTTCATGGCG GACTCCTGAT CAGTAGAACA AGGGAAGGAT GTAGGGGAAG CCGAGCGCGA CCAGCACCAA 8800
GGCCGTTACC AGCCCGAACA GCAGCTTGTA GGTGGTGCGT ACCTGGGGCA CGGCGCAGAC CTCACCCGGA AAGCAGACTT GAGCCGGGCG GAAAATGCGT 8900
CGCCAGGCGA AGAACAGCGC GACTAACGCC GCACCGATGA AGAGCGGGCG GTAAGGTTCC AGCACGGTCA GGTTGCCGAT CCAGGCCCCG CTGAATCCCA 9000
GTGCGATCAG AACCAGCGGC CCAAGACAGC AAGTCGAGGC GAGAATCGCC GCAAGCCCCC CGGCGACAAG AGGGGCGCGC CCGTTTGATG GTTCAGACAT 9100
GCATTTCTCC TTTCGAGCAT GTGAGCGATG GTTTAAGGTT ACTTCCGTAG TCAACTACGG AGTCAAGCAG TATGGAAAAC ACTGTGGAAA GCCTGACCAT 9200
CGGCGCCTTC GCCAAGGCGG CCGGGGTCAA CGTGGAAACC ATCCGGTTCT ATCAACGCAA GGGGCTGTTG CCCGAACCGG ACAAGCCCTA CGGCAGCATT 9300
CGCCGCTACG GCGAGGCGGA CGTGGCCCGG GTGAAATTCG TCAAATCCGC GCAACGACTG GGCTTCAGCC TCGATGAGGT GGCCGGGCTG TTGCGATTGG 9400
ATGACGGCGC TCACTGCGAC GAAGCGCGCG TGCTCGCCGA GCAGAAGCTC GAGGATGTGC GGGGGAAACT CGCGGATCTG CGGCGGATCG TGTCGGTGTT 9500
GGCGCGGCTG GTTCACGATT GTTGTGCGAG CCACGGGTCG GTTTCCTGTC CGCTGATCGT TTCGCTGCAG GGGGAAAAGG AACTGCGCTG ACTCCGCGCG 9600
TTAACCGAGG ATTTCCCGAT GCGTGAGGCA CCTCCGGGGT CGGCTTGCGC TTGGCAAAAC AGCGGCGCTC ATTGAGCGCC GCTGAATGGC CAAAGGAGCA 9700
CTTGCATAGG CCACAGGTTA GTACTGCATC AGCAGCTCAT GTTCTACTTT GCAGGCGGAC AGCCGGGCTG CGCCTCGACC CGGCCAGCCG CCGGTGGCCC 9800
CAGTTGCTCA ATCTTCTTGG CGGTTTCCGC CACCAAGGCC GCCTCAGCCT TGTCGCGCAT AGCGCGATTC GCTCGATTGA ACGGTCGCTC CCGCTCTCGG 9900
CCCATACGGT GGATGACAGC AGAGTCGCAC CAACTATCAG CAGTAGTCTT AGGTATTTCA TAACAGCCTC CTCTCGGGTT TTCTACCCAC GAGCCGACTC 10000
TATCTCCGTA GTTAAGTACG GAATCAAGGA GAGATGGAGA TGAAGGTCCT GGATTATGGC GCTGAGAGGA AATGGCAGGG CTTAAGTGCA CTTTCTGTTC 10100
CGTTGCTCCC CAAACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 972-1107 136 AGTACCGTTT ACTCGACTAC GTTAGTAATA GTTGAACTTT GATTAAGCGT ACCAGTTATT
TGAACCGTAG CGCAGGTAGG TTAACCAGCC GATTCCTGTC CACTTAAAGT TCGGCAAAAC
GAAGGTTTTT TTGAAC
res_site_III 982-1023 42 ACTCGACTAC GTTAGTAATA GTTGAACTTT GATTAAGCGT AC
res_site_II 1026-1060 35 GTTATTTGAA CCGTAGCGCA GGTAGGTTAA CCAGC
res_site_I 1080-1107 28 GTTCGGCAAA ACGAAGGTTT TTTTGAAC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnpR Tn5046 41-967 Accessory Gene Resolvase -
RHH_6 Tn5046 1169-1408 Passenger Gene Antitoxin +
PIN_3 Tn5046 1408-1818 Passenger Gene Toxin +
tnpA Tn5046 1822-4818 Transposase   +
urf-2-CAC80083.1 Tn5046 4956-5294 Passenger Gene Hypothetical -
urf-1-CAC80082.1 Tn5046 5291-5527 Passenger Gene Hypothetical -
merD Tn5046.1 5520-5885 Passenger Gene Heavy Metal Resistance -
orfY-WP_004574523.1 Tn5046 5882-6298 Passenger Gene Hypothetical -
merA Tn5046.1 6319-8001 Passenger Gene Heavy Metal Resistance -
merC Tn5046.1 8014-8445 Passenger Gene Heavy Metal Resistance -
merP Tn5046.1 8458-8736 Passenger Gene Heavy Metal Resistance -
merT Tn5046.1 8750-9100 Passenger Gene Heavy Metal Resistance -
merR Tn5046.1 9172-9591 Passenger Gene Heavy Metal Resistance +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn5046 927 41-967 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MKIGYARVST RDQNADLQVD ALKQAGCERI YQDIASGAKS ARPELDKLLA HVRAGDTVVI WKLDRLGRSL KHLVELVGEL AERKVGLQSL NDPIDTTHAQ
GRLVFNLFAL LAEFERELIR ERTQAGLSAA RARGRIGGRP KGFPAKAEAT SMAAETLYRE GRLSVSAIGE KLHISKSTLY SYLRHRGVEI GAHQKSAQPR
GQQRNVASPA EPAAEQVATV TLRLAVVNNS KFVRGRKRAK ENFERYCLEP YSMKRLESGN YELAIPYRSD DELDKTVHDL LTEISQEADM RNCFIEADAW
EEGSERRW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
RHH_6 RHH_6 Tn5046 240 1169-1408 +
Class:   Passenger Gene
Sub Class:   Antitoxin
Function:   transposition protein, putative
Sequence Family:  RHH_6 (Pfam:PF16762)
Comment:   VapB
Protein Sequence:  
MNTIRWNVAV SADTDQSLRM FLASQGGGRK GDLSRFIEEA VRAHILELTA EQAKAANAHL SEAELTEAVD EALDWARKR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
PIN_3 PIN_3 Tn5046 411 1408-1818 +
Class:   Passenger Gene
Sub Class:   Toxin
Function:   transposition protein, putative
Target:   single stranded RNA
Sequence Family:  PIN_3 (Pfam:PF13470)
Protein Sequence:  
MRVVLDTNIL FSALISPHGA PDAIYRAWRA ARFEVVTSRM QLDETRRASR YPKLQAILQP AKVGAMINNL QRAVVLERLT IEVEADDPDD SFLLAMALAG
DADYLVTGDR RAGLLQRGHI ERTRIVTPAV FCAEVL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn5046 2997 1822-4818 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPVGFLTQEQ RDGFGRYVDA PSREELERYF HLSDDDHKIL LPLRGEHNRL GYATQLTSIR YLGTFPDDFS AVPQEVLQAL SRQLGITDPT CIQAYAETRQ
RQRHAAEIQE RYGYRVFADS SVGFRLARWL YALCWTGTDR PGELFNRATT WLLTHKVLLP GVTVLERFIA QLRSRVEERL WLTLGRSVSE AQRQQLQDLL
LVAEGNRSSR LDQLRSGPVM VSGPALIRAL RRLDDVRGIG IALPAAAHIP PSRIAALARF ANTAKVTAIN RLPASRRMAT LVAFALCLEA TAHDDALEVL
EALLRDLFSN AEKADKKARM RSLKDLDRSA ATLAAACKVV LDSSISDDKV RARLFNDLPR ASLEKALEDV NALIRPVDDV YFLALEARYR SVRRFLPDLL
KHIRFGFSPA GKGVVAGLDW LQLNLPRRKP EDDAPQEIVA KAWQKHITRE DGSLDMGAYV FCTLDALRTA LRRRDVFVSP SWRYADPRLG LLDGAEWLAA
RPIICRSLGL TIDAGTTLDA LSAELDATWQ AVAARLPDNP AIQLSENREG KTELSLGTLS KLEEPNSLLQ LRAAVADLMP RVDLPEILLE IAARTGFAEA
FTHVSERNAR ADNLVTSLCA VLLGGACNTG LEPLIRTDNQ ALRRDRLSWV SQNYIRDDTL SVANAILVGA QSQLELAQVC GGGEVPPADG MRFVVPVRTV
HAGPNPKYFG TGRGVTWYNL ISDQFSGLNA ITVPGTLRDS LVLLAVVLEH ETELQPTQIM TDTGVYSNVV FGLFRLLGYH FSPRLADVGG TRFWRTRPEA
DYGKLNGLAR QSVKLDLIAE HWDDLLRLAG SLKLGRVPAT GIMRTLQTGD RPTRLAQALA EFGRIEKTLH TLTYIDDESK RRATLTQLNR GEGRHSLARP
VFHGKRGELR QRYREGQEDQ LGPLGLVVNI IVLWNTLYMT AAVERLRQHG YPVLEEDVAR LSPLIHEHIN MLGRYSFAVP EEVTRGELRP VRNPDDDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urf-2-CAC80083.1 Urf-2-CAC80083.1 Tn5046 339 4956-5294 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MTRSEHGATT TAELGWEAAG RSALSHGGKA LLPFLGHGGT PIMNTNNTST ISCCECCKDI PLDAALTPEG SEYVVHFCGL ECYQRFMSRA DKRAASEPDH
PCTQKVSTRQ DG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urf-1-CAC80082.1 Urf-1-CAC80082.1 Tn5046 237 5291-5527 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MRNAVHVESS KVFRWRAYTW GVLAALTCPC HLPVLALLLS GTAAGAFVSE QWSLATLVLA VFFILFLRAA LQAFRKRP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn5046.1 366 5520-5885 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Comment:   transcriptional repressor
Protein Sequence:  
MMNAYTISRL AEDAGVSVHV GRDYVLRGLL HPARRTESGY GIFDERSLAR LRFVRAAFES GIGLDELARL CRALDADDGA DLIGCVECLL RLVTARQAAL
AAVATQLAGL THCAGEGSAY A

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfY-WP_004574523.1 OrfY-WP_004574523.1 Tn5046 417 5882-6298 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MNDTASDLGS RDSLRKTWQV ISLWGLPAVV ATIALVLADR RPALFLAASA ALLVMGGACL VNAARCRRLH CYITGPYFLM LALGALLAYG FAPNGEYHSR
LWLLLALGVT PLLIWLPERL AGRKYLSALV CGEDRECR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn5046.1 1683 6319-8001 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Comment:   mercuric ion reductase
Protein Sequence:  
MTKLQIVGMT CASCVEHVKE ALEKIPGVHR ADVSYASGKA ELKVDEGVSR EQMQAAVEAL GYRAAFEDAT APTRSGLLDK ARGWLSGSIG AGKDGDRLHV
AVIGSGGAAM AAALKAVEGG ARVTLIERGI IGGTCVNVGC VPSKIMIRAA HVAHLRRESP FDAGLSTTSL TVLRERLLAQ QQGRVDELRH AKIEGILEST
PAITLVRGTA RFQDGRTLSV ELAEGGERIV AFDRCLIATG ASPAVLPIPG LKDTPYWTSD EALASDTIPK RLAVIGSSVV AVELAQAFAR LGSKVTVLAR
STLFFREDPA IGEALTAAFR MEGIEVLEHT QASQVSHVDG EFILSTNHGE LHADRLLVAT GRTPNTQGMN LQGAGVKLDE RGAIQIDSGM RTSAPDIYAA
GDCTDQPQFV YVAAAAGTRA ALNMTGGEAK LNLDAMPAVV FTDPQVATVG YSEAEAHHAG IETDSRTLTL DNVPRALANF DTRVSSSWSS EEGSGRLIGV
QAVAPEAGEL IQTAAIAIRA RMTVQELADQ LFPYLTMVEG LKLAAQTFAK DVKQLSCCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn5046.1 432 8014-8445 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Protein Sequence:  
MANPFNLFTR IGDKAGSVGV LISAIGCASC FPALAGLGAA IGLGFLSQWE GLFITTLLPL FAGLALLVNA LGGFSHRQWR RAAPGLIGPA LVLIAVYLML
AHGWRSGWLL YIGLALMFGV SIWDLVSPAH RRCSPTSCPT PPK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn5046.1 279 8458-8736 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Comment:   periplasmic mercuric ion binding protein
Protein Sequence:  
MKKLLASFAL ATLVAAPAWA ATQTVTLAVP GMTCAACPIT VKKALTKVEG VTKAEVSYEN REAIVTFDDA KTNVQALTKA TEDAGYPSSV KQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn5046.1 351 8750-9100 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Comment:   periplasmic mercuric ion binding protein
Protein Sequence:  
MSEPSNGRAP LVAGGLAAIL ASTCCLGPLV LIALGFSGAW IGNLTVLEPY RPLFIGAALV ALFFAWRRIF RPAQVCFPGE VCAVPQVRTT YKLLFGLVTA
LVLVALGFPY ILPLFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn5046.1 420 9172-9591 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   repressor
Target:   Mercury
Protein Sequence:  
MENTVESLTI GAFAKAAGVN VETIRFYQRK GLLPEPDKPY GSIRRYGEAD VARVKFVKSA QRLGFSLDEV AGLLRLDDGA HCDEARVLAE QKLEDVRGKL
ADLRRIVSVL ARLVHDCCAS HGSVSCPLIV SLQGEKELR

 References     

Mindlin S, Kholodii G, Gorlenko Z, Minakhina S, Minakhin L, Kalyaeva E, Kopteva A, Petrova M, Yurieva O, Nikiforov V. Mercury resistance transposons of gram-negative environmental bacteria and their classification. Res Microbiol. 2001 Nov;152(9):811-22. doi: 10.1016/s0923-2508(01)01265-7. PubMed ID: 11763242