Transposon
Name: Tn5045.1       (Synonyms: Tn1013)
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Pseudomonas aeruginosa Molecular Source:plasmid pBS228
Date of Isolation:2007

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 37 bp)GGGGAGCCCGCAGAATTCGGAAAAAATCGTACGCTAA
IRR (Length: 37 bp)GGGGAGCCCGCAGAATTCGGAAAAAATCGTACGCTAA

 Sequence     
DNA SequenceLength  7796 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGAGCCCG CAGAATTCGG AAAAAATCGT ACGCTAACAG CTCAAGTGTC CCGACCACGC CCGACAGTAG CTTGTTGGCT GGTCAATCTG GTTCACGGGT 100
AAAGCGATAG AACAGGTTTG GCTCACTGAC CACGTACAAA TACCCTTCAT CATCGATGGT TACGCCTTCG GCCTGGGGTA TGCCTTTCAG CAAACCAGCA 200
AAACCCCTCG CCAAGGAACG GAAACTCACC ACCTTGCCCT CATCGGTCAT TTCAATCAGC AGTTTCGACT CGTCGCTGAG CAGTATGAGA TGGCCACTCT 300
GTTGGTCGAA GACGACCGAA GACAAGTCAG TGGCAAATAC CTTGTCCTTT ACCAAGTTGG ACAGGTCGCG CACGTGCAGG GAAAAACCTC CTGCCAGGCT 400
GGCACGAAGG CCGCCCACTT CCAGCAATTG GCGAGGGTCA CGCTCCTTGG TCACAAACAA GCGATCACCT TTCAGGTCGT AGGCGAGCCC TTCAAGGCCT 500
TTGTTGTCCT CCTTGCCAAG CGCCAGGGTC AGAGCTGGAT ACTGGTCCCG GCTCAATGAA CGATCGGGAG AAAGCTTACC GTCTTCGGCG ATGGGGACAT 600
CCACAATAAC CAGGCTCTGC CGGCGCTCCT CGGCGATTAC CAGCTGGCCG TTGCCGGCAT AGGAGACCGC CTCCACATCG TGGAAGCCAT CCAGGTTGTA 700
ACGCCTTTCC ACATCACCGT CACGACTAAG GGCCAATAGT TCGTTTGGGC CGTTGGTGAC TGCCCACAGC AGGTTTAGGT CAGGGTCAAA GGTCAGACCC 800
GAAAGATTGT TGTCCACACC GGGGACCGCC TTAGCATCCA GTTCAACCCG ATAGCCAGGC AGCCACACAG AGCGCTCCTG CCAATCGTCG GTGTGCCAGC 900
TGGTCTTTAT CCAGAAGTAC AAACGATCAT CAAGGTGATG GGTGCGGACT TGGAATACGG TGAGCAACAC AAGGCACAGC AGTGCCCACA TCCAAGCGCT 1000
TGCTTTCCGT GTTCGGCTCA GCCAGTTTTT AGCCATCAAA TACATTAGGA GCCTCGTTAT TTGGGCTGAC GCCACGAGTC GTGACGATTT CAATCCGACT 1100
CGGTGCGACT CGCACAGGTG ATGCACAATG GCGTGGCCGG ATCGAACTCC AGACGGCCCG AGGCGATCAA CTCGCCGCAT TGGTTACACC AGCCATCATT 1200
GCTTGCTGCT GGAGTGCATC AATTCTCGAC AGACGCCCTA CCTTGCTTTG ATCCAGCTCT ACCGATTGCG AGCGAGACTC AGCGTCTTCC AGCAATTGAT 1300
CCAGCTCGGC AGCCCGCTGT TCCAGCAGGG TCTTGAAATG GGCAAGATCC AGGGCGTCGT CCATGGACAT TAACGCAGCA GTAACAACGG ACTGGTGGTG 1400
GTGCGGAGCA TGCTGGTCGT GGTGCTACCG ACCAGGAACT GCCGGATACG TGAATGGCCA TAGGCCCCCA TCACCAGCAG ATCAATGCCA TGCTCTTTCT 1500
GATAGGCGTG GAGGGTAGGC TCTATCTCGC CGTTCAGGGC CTCGGCGCGA ACAGTGAATC CGGCGTTGAG CAGCACTTTC TGCGCCCAGT CCAGCTGCGC 1600
CGACGATTCG TCGCTCACGG GCCCAACCAT GACCAGGTGG ATCGGCAGCC CCTTCAGCAG GGGGCTGGCC GCCAGCATCT CCACACCCTT GCGGGTAGTA 1700
GCGCCGCCAT CGAAGGCGAG CATCGCGCTC TCAGGCTTTT GGAAGTTGGC CGGGGTGACC AGAATCGGTC GGTGCATGAT ACGGATCACG CTCTCCAGCT 1800
GGCTTCCGAC ATGCTGACTC AGACCACCGC TAGATTCGCC CTGGCGACCG ATGACCAGCA GGCGCGTTTC GGTTTGCAGC TCTTGCAGGC TTTCCAGCAG 1900
ATCGCCATGA CGTTGCTTGG ACTCCGGCGC GGCCACGCCA TCCTTAATGG CCCGCTCTTT TGCGGCCGCA AGCATGATCC GCCCTTGTTC AAGGGCCAAC 2000
TTGCCACGCT GTTCATCCAG GGAAGCAAGC TCATCGAGCA GATGCTCGCG GCTGCCAAGG CCGATATTGC CACTCAGATC GGCCGTAACC GGGTACTGGC 2100
GCTGATCCAG CACATGCAGG AAGGTCAGCG GGGCTTCCAG GCTCAGACTG GCCCAGGCCG CGTAGTCGCA CACGGCTGGA GCCGAGGCGG AAGCGTCTAT 2200
ACAGGCAATT ACTTGGGTCA TTGTTGTTCT CCTTCTTAGT GGCCCATGAG TTGATCAATG GCGTCGGGTT TATCGTGAAC ACCGAAGCGA TCCACGATAG 2300
TGGCGCTCGC TTCGTTGAGG CCCAGCACTT CAACTTCGGT GCCTTCGCGG CGGAATTTGA TGACCACTTT GTCCAAAGCG GCAACGGCGG TGATATCCCA 2400
GAAGTGAGCA CGGTTCAGGT CGATGGTTAC CTTGTTTAGG GCTTCTTTGA AGTCGAAGGC CGCGACGAAC TTGTCTGCCG AGCTGAAGAA CACCTGGCCG 2500
GTGACGTTAT AGCTACGATG CTCGCCGGCT TCGTCCAGCA AAGAGCTGAT CGCCATGTAA TGGCCAACCT TGTTGGCGAA GAACATCGCG GCCAGCAGTA 2600
CGCCGGCCAA CACGCCGAAG GCAAGGTTGT GGGTGGCGAC CACGACCACC ACGGTGACGA CCATGACAAT GTTGGTCGAC AACGGGTGCT TCTTCAGGTT 2700
GCGCAGCGAA TCCCAACTGA AGGTGCCGAT GGACACCATG ATCATCACTG CCACCAGCGC AGCCATCGGG ATCTGCTTCA GCCAGTCGCC GAGGAATACC 2800
ACCATCAGTA GCAGGAATAC GCCTGCGGCC AGGGAGGACA GACGAGAACG ACCGCCGGAT TTAACGTTGA TGATCGACTG ACCAATCATC GCGCAACCTG 2900
CCATACCGCC GATTAGGCCC GAAGCAATGT TGGCCACGCC TTGACCCTTG CACTCGCGGT TCTTGTCACT GGAGGTGTCG GTCAGGTCGT CGACAATGGT 3000
CGCGGTCATC ATCGATTCCA ACAGACCGAC CACAGCCAGT GCTGCCGAAT AAGGGAAGAT GATGGCCAGC GTCTCGAATG TCAGCGGCAC GTCAGGCCAG 3100
AGGAAGATCG GTAGCGTATC CGGCAGTTCA CCCATATCAC CGACCGTGCG GATATCCAGC CCAACCGACA TGGCGACGGC GGTCAGCACG ATGATGCACA 3200
CCAGCGGCGA TGGGATGAGC TTGCCGATCT TGGGGACATA GGGGAACAGA TAGATGATGC CGAGGCCTGC GGCTGTCATG GCGTAGACGT GCCAGGTGAC 3300
ATTGGTCAGC TCGGGCAGCT GAGCCATGAA AATCAGGATC GCCAGTGCAT TGACGAAACC GGTCACCACC GAGCGCGAGA CGAAGCGCAT CAGCGATCCG 3400
AGCTTCAGGT AGCCAGCAGC GATTTGTAGC ACGCCACATA GCAGCGTGGC GGCCAGCAGA TATTCAAGAC CATGGTTCTT GACCAGGGTC ACCATCAGCA 3500
GTGCCATTGC ACCGGTTGCG GCCGAGATCA TTCCGGGGCG ACCACCGACA AAGGCGATAA CCACGGCGAT ACAGAAAGAG GCGTACAGGC CGACCTTGGG 3600
GTCGACGCCG GCAATGATCG AGAAGGCGAT GGCTTCAGGG ATTAGGGCCA GTGCGACCAC AATACCGGCG AGGATGTCGC CACGGATGTT GGATAACCAG 3700
GTTTGTTTTA ACGAGTGGAG CATCAGAATT CCCAAGGCAA TGGATCGCGC AGAACAGCAT GGCGCAGGCC ATGTGCAGCT GGTCGATACG AGGTCAAATT 3800
GTCGGATGTA GAGGAGCTGT GGCGGGTGTT AAAACCTAAA GCACAGCAGA ACGCGACCGC TGGCAGAGCA AGCAGTCACA GATGATGCGG GGGGCGAAGC 3900
GCTATGGCGG CGTAGGCAGC CAGATCATGT TTTGCAGGGT AAGCATGAGG TCTTATCGAG TGTCTTTAGT AACTCAATGG CCGCAACAGT CTACAGGAAG 4000
AGGGCAATTT CTGCGAGTCA CCCCCGGACT AGGGCGTCCT GTTTGGATGT CAGCCTGAGC TATACCCTAA CTGGATGTCA GGCAAGGCCG CACCGCGCCG 4100
TCAGAATAGA ATCCGCTTTC ACATTCTTTG ACACATGCTT GCCAAGGTCA TAGATTTCAG CCTGACAAAT TCAAGGCTTC GGGCGCAATG GAACCAAAAA 4200
CCAACGTAAG CCCTACAGCC CATGGAGGCA TCTTGCAGGG ACAACGCATC GGTTATGTCC GGGTCAGCAG TTACGATCAG AATCCGGAAC GACAACTTGA 4300
GCAAGTTGAG GTCGGCAAGC TGTTCACCGA CAAAGCCTCG GGCAGGGACA CCCAGCGTCC CCAGCTGGAG GCCATGCTCG GCTTCGTCCG CGAGGGCGAC 4400
ACCGTTGTGG TGCACAGCAT GGATCGCCTG GCCCGTAACC TCGATGACTT GCGACGCCTG GTGCAGAAGC TGACCCAGCG CGGCGTGCGT ATCGAGTTCC 4500
TGAAAGAGGG CCTGGTGTTC ACCGGCGATG ACTCGCCGAT GGCCAACCTG ATGCTGTCGG TGATGGGGGC CTTCGCCGAG TTCGAGCGCG CCCTGATCCG 4600
TGAGCGGCAA CGGGAGGGCA TCGCCCTGGC CAAGCAGCGC GGCGCGTACC GGGGCCGCAA GAAGGCCCTG TCCGACGAGC AGGCTGCTAC CCTGCGACAG 4700
CGGGCGTCGG CCGGCGAGCC CAAAGCGCAG CTTGCCCGCG AGTTCAACAT CAGCCGGGAA ACTCTCTACC AGTACCTACG CACGGACGAT TGATACATGC 4800
CGCGTCGCTT GATCCTCTCG GCTACGGAGC GGGATACCCT GCTCGCGTTG CCGGAAAGCC AGGATGACCT GATCCGCTAC TACACCTTCA ACGACTCCGA 4900
CCTGTCGCTG ATCCGCCAGC GGCGCGGCGA CGCCAACCGC CTGGGCTTCG CGGTGCAGCT CAGCCTGCTG CGATATCCAG GCTATGCGCT GGGCAGCGAC 5000
AGCGAGTTGC CCGAGCCGGT CATCCAGTGG GTGGCCAAGC AAGTTCAGGC CGACCCAACG AGTTGGGCGA AATACGGCGA ACGCGACGTG ACTCGCCGCG 5100
AGCACGCCCA GGAACTGCGC AACTACCTAC AACTGGCCCC GTTCGGCCTG TCCGACTTCC GCGCCCTGGT GCGCGAGCTG ACCGAGTTGG CCCAGCAGAC 5200
CGACAAGGGT TTGCTGCTGG CCGGCCAGGC GCTGGAGAGT CTGCGGCAGA AGCGGCGCAT CCTGCCGGCG CTGAGCGTGA TTGACCGGGC CTGCTCGGAA 5300
GCCATTGCGC GGGCCAATCG CCGGGTCTAC CGCGCCCTGG TCGAACCACT CACGGACTCG CATCGGGCCA AACTGGACGA GCTGTTGAAG CTCAAGGCCG 5400
GCAGCAGCAT CACCTGGTTG ACCTGGTTGC GGCAGGCCCC ACTAAAACCG AACTCCCGGC ACATGCTCGA ACACATCGAG CGGCTGAAGA CATTTCAGCT 5500
GGTGGATTTG CCCGAAGCTC TGGGCCGGCA CATCCACCAG AACCGCCTGC TCAAGCTGGC CCGCGAGGGT GGGCAGATGA CGCCCAAAGA CCTCTGTAAG 5600
TTCGAGCCGC AGCGGCGCTA CGCGACCCTG GCCGCCGTGG TGCTGGAGAG TACGGCGACC GTGATTGATG AGCTGGTCGA TCTGCACGAC CGCATCCTGG 5700
TCAAGCTGTT CAGCGGCGCG AAGCACAAGC ATCAGCAGCA GTTCCAGAAG CAAGGCAAGG CGATCAACGA CAAGGTGCGC CTGTACTCCA AGATCGGCCA 5800
GGCCCTGCTG GAGGCCAAGG AAAGCGGCAG CGATCCCTAC GCCGCCATCG AGGCGGTGAT TCCCTGGGAC GAGTTCACCG AGAGCGTCAG CGAGGCCGAG 5900
CTGCTGGCCC GGCCGGAGGG CTTCGACCAT CTGCACCTGG TTGGAGAGAA CTTCGCCACC CTGCGCCGCT ATACGCCAGC CTTGTTGGAG GTGCTGGAAC 6000
TGCGCGCCGC CCCGGCTGCG CAAGGCGTGC TGGCGGCCGT GCAGACCCTG CGCGAGATGA ACGCCGACAA CCTGCGCAAG GTGCCGGCCG ATGCGCCCAC 6100
CGCCTTCATC AAGCAGCGCT GGAGGCCGCT AGTGATAACC CCGGAAGGCC TCGACCGGCG CTTCTACGAA ATCTGCGCCC TGTCAGAGCT GAAGAACGCG 6200
CTGCGCTCCG GCGACATCTG GGTCAAGGGC TCGCGGCAGT TCCGCGACTT CGACGACTAC CTGCTGCCGG CAGAGAGGTT CGCCGCGCTC AAGCATGCGC 6300
AGGCTCTGCC CCTGGCGATC AACCCGAACA GGAACCAGTA CCTGGAAGAG CGCTTGCAGC TGCTGGACGA GCAGCTGGCC ACCGTCACCC GCCTGGCCAA 6400
GGACAACGAG CTGCCCGATG CCATCCTCAC CGAGTCGGGG CTGAAGATCA CCCCACTGGA TTCCGCGGTG CCCAATACCG CGCAGGCGCT GATCGACCAG 6500
ACCAGCCAGT TGCTGCCGCG CATCAAGATC ACCGAACTGC TGATGGACGT GGACGACTGG ACGGGCTTCA GCCGCCACTT CACCCACCTG AAGGACGGTG 6600
CCGAGGCCAA AGACCGGACA TTGCTGCTGG CAGCGATCCT GGGCGATGCG ATCAACCTCG GGCTGACCAA GATGGCCGAG TCGAGCCCCG GCCTGACCTA 6700
CGCCAAGCTG TCCTGGCTGC AAGCCTGGCA CATCCGAGAC GAAACCTACT CGGCGGCCCT AGCCGAGCTG GTCAACCACC AGTACCGTCA TACCTTCGCC 6800
GCTCACTGGG GCGACGGCAC GACCTCTTCT TCCGATGGCC AGCGCTTCCG GGCGGGCGGT CGGGGCGAAA GCACCGGGCA CGTCAACCCG AAGTACGGCA 6900
GCGAGCCGGG GCGGCTGTTC TACACCCATA TCTCCGACCA GTACGCACCG TTCAGCACCC GCGTGGTGAA TGTCGGCGTG CGCGATTCCA CCTATGTGCT 7000
CGACGGCTTG CTGTACCACG AGTCCGACCT ACGGATTGAG GAGCACTACA CCGACACGGC TGGCTTCACC GATCACGTCT TCGCCCTGAT GCACCTGCTG 7100
GGCTTCCGCT TCGCACCGCG CATCCGCGAC CTCGGCGAAA CCAAGCTGTA TGTTCCGAAT AGCGTCCAGG ACTACCCGAC ATTGCGCCCA ATGGTTGGCG 7200
GCACCCTGAA CATCAAGCAT GTCCGCGCCC ACTGGGACGA CATCCTGCGC CTGGCCAGCT CGATCAAGCA GGGCACCGTC ACTGCCTCGC TGATGCTGCG 7300
CAAGCTCGGC AGCTACCCGC GCCAGAACGG TCTGGCCGTG GCCTTGCGCG AACTGGGCCG GATTGAGCGC ACACTGTTCA TCCTCGACTG GCTGCAAAGC 7400
GTAGAGCTAC GTCGCCGCGT GCATGCCGGA CTGAACAAGG GCGAGGCGCG CAACTCCCTG GCCAGGGCGG TGTTCTTCAA CCGCCTCGGC GAAATCAGGG 7500
ATCGGAGCTT CGAGCAGCAG CGCTACCGGG CCAGCGGTCT CAACCTGGTG ACGGCCGCCA TCGTGCTGTG GAACACGGTG TACTTGGAAC GCGCCACCCA 7600
GGCGATGGGC GAAGCGGGGA AGTCGGTGGA TGGCGAGCTG CTGCAGTACC TGTCGCCGCT GGGGTGGGAG CACATCAACC TGACCGGCGA TTATGTCTGG 7700
CGGCAGAGCC GCAGGCTGGA GGACGGGAAG TTTCGGCCGC TAAGGCTGCC CGGAAAACCT TAGCGTACGA TTTTTTCCGA ATTCTGCGGG CTCCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res_site_II 4107-4133 27 TAGAATCCGC TTTCACATTC TTTGACA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
taoD Tn5045.1 83-1045 Passenger Gene Other -
taoC' Tn5045.1 1167-1370 Passenger Gene Other -
taoB Tn5045.1 1370-2221 Passenger Gene Other -
taoA Tn5045.1 2236-3723 Passenger Gene Other -
tnpR Tn5045.1 4233-4793 Accessory Gene Resolvase +
tnpA Tn5045.1 4797-7763 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
taoD TaoD Tn5045.1 963 83-1045 -
Class:   Passenger Gene
Sub Class:   Other
Sequence Family:  SdiA-Regulated Motif Containing Protein (Pfam: PF06977)
Comment:   DNA binding protein
Protein Sequence:  
MYLMAKNWLS RTRKASAWMW ALLCLVLLTV FQVRTHHLDD RLYFWIKTSW HTDDWQERSV WLPGYRVELD AKAVPGVDNN LSGLTFDPDL NLLWAVTNGP
NELLALSRDG DVERRYNLDG FHDVEAVSYA GNGQLVIAEE RRQSLVIVDV PIAEDGKLSP DRSLSRDQYP ALTLALGKED NKGLEGLAYD LKGDRLFVTK
ERDPRQLLEV GGLRASLAGG FSLHVRDLSN LVKDKVFATD LSSVVFDQQS GHLILLSDES KLLIEMTDEG KVVSFRSLAR GFAGLLKGIP QAEGVTIDDE
GYLYVVSEPN LFYRFTREPD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
taoC' TaoC' Tn5045.1 204 1167-1370 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   truncated compared to Tn1404 due to frameshift-causing deletion
Protein Sequence:  
MSMDDALDLA HFKTLLEQRA AELDQLLEDA ESRSQSVELD QSKVGRLSRI DALQQQAMMA GVTNAAS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
taoB TaoB Tn5045.1 852 1370-2221 -
Class:   Passenger Gene
Sub Class:   Other
Sequence Family:  Universal Stess Protein (Pfam:PF00582)
Comment:   also known as uspA1
Protein Sequence:  
MTQVIACIDA SASAPAVCDY AAWASLSLEA PLTFLHVLDQ RQYPVTADLS GNIGLGSREH LLDELASLDE QRGKLALEQG RIMLAAAKER AIKDGVAAPE
SKQRHGDLLE SLQELQTETR LLVIGRQGES SGGLSQHVGS QLESVIRIMH RPILVTPANF QKPESAMLAF DGGATTRKGV EMLAASPLLK GLPIHLVMVG
PVSDESSAQL DWAQKVLLNA GFTVRAEALN GEIEPTLHAY QKEHGIDLLV MGAYGHSRIR QFLVGSTTTS MLRTTTSPLL LLR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
taoA TaoA Tn5045.1 1488 2236-3723 -
Class:   Passenger Gene
Sub Class:   Other
Sequence Family:  SulP Family Inorganic Anion Transporter (Pfam:PF00916)
Comment:   also known as sulP sulphate permease
Protein Sequence:  
MLHSLKQTWL SNIRGDILAG IVVALALIPE AIAFSIIAGV DPKVGLYASF CIAVVIAFVG GRPGMISAAT GAMALLMVTL VKNHGLEYLL AATLLCGVLQ
IAAGYLKLGS LMRFVSRSVV TGFVNALAIL IFMAQLPELT NVTWHVYAMT AAGLGIIYLF PYVPKIGKLI PSPLVCIIVL TAVAMSVGLD IRTVGDMGEL
PDTLPIFLWP DVPLTFETLA IIFPYSAALA VVGLLESMMT ATIVDDLTDT SSDKNRECKG QGVANIASGL IGGMAGCAMI GQSIINVKSG GRSRLSSLAA
GVFLLLMVVF LGDWLKQIPM AALVAVMIMV SIGTFSWDSL RNLKKHPLST NIVMVVTVVV VVATHNLAFG VLAGVLLAAM FFANKVGHYM AISSLLDEAG
EHRSYNVTGQ VFFSSADKFV AAFDFKEALN KVTIDLNRAH FWDITAVAAL DKVVIKFRRE GTEVEVLGLN EASATIVDRF GVHDKPDAID QLMGH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn5045.1 561 4233-4793 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MQGQRIGYVR VSSYDQNPER QLEQVEVGKL FTDKASGRDT QRPQLEAMLG FVREGDTVVV HSMDRLARNL DDLRRLVQKL TQRGVRIEFL KEGLVFTGDD
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKALSDEQ AATLRQRASA GEPKAQLARE FNISRETLYQ YLRTDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn5045.1 2967 4797-7763 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   putative transposase of Tn5045 identical to tnpR of Tn1013 in pBS228
Protein Sequence:  
MPRRLILSAT ERDTLLALPE SQDDLIRYYT FNDSDLSLIR QRRGDANRLG FAVQLSLLRY PGYALGSDSE LPEPVIQWVA KQVQADPTSW AKYGERDVTR
REHAQELRNY LQLAPFGLSD FRALVRELTE LAQQTDKGLL LAGQALESLR QKRRILPALS VIDRACSEAI ARANRRVYRA LVEPLTDSHR AKLDELLKLK
AGSSITWLTW LRQAPLKPNS RHMLEHIERL KTFQLVDLPE ALGRHIHQNR LLKLAREGGQ MTPKDLCKFE PQRRYATLAA VVLESTATVI DELVDLHDRI
LVKLFSGAKH KHQQQFQKQG KAINDKVRLY SKIGQALLEA KESGSDPYAA IEAVIPWDEF TESVSEAELL ARPEGFDHLH LVGENFATLR RYTPALLEVL
ELRAAPAAQG VLAAVQTLRE MNADNLRKVP ADAPTAFIKQ RWRPLVITPE GLDRRFYEIC ALSELKNALR SGDIWVKGSR QFRDFDDYLL PAERFAALKH
AQALPLAINP NRNQYLEERL QLLDEQLATV TRLAKDNELP DAILTESGLK ITPLDSAVPN TAQALIDQTS QLLPRIKITE LLMDVDDWTG FSRHFTHLKD
GAEAKDRTLL LAAILGDAIN LGLTKMAESS PGLTYAKLSW LQAWHIRDET YSAALAELVN HQYRHTFAAH WGDGTTSSSD GQRFRAGGRG ESTGHVNPKY
GSEPGRLFYT HISDQYAPFS TRVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG ETKLYVPNSV QDYPTLRPMV
GGTLNIKHVR AHWDDILRLA SSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNSLAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERATQAMGEA GKSVDGELLQ YLSPLGWEHI NLTGDYVWRQ SRRLEDGKFR PLRLPGKP

 References     

Haines AS, Jones K, Batt SM, Kosheleva IA, Thomas CM. Sequence of plasmid pBS228 and reconstruction of the IncP-1alpha phylogeny. Plasmid. 2007 Jul;58(1):76-83. doi: 10.1016/j.plasmid.2007.01.001. Epub 2007 Feb 23. PubMed ID: 17320955