Transposon
Name: Tn5045
Family: Tn3        Group: Tn21
Evidence of Transposition: yes
 Host     

Host Organism:Pseudomonas sp. Tik3 Molecular Source:plasmid
Place of Origin:Siberia, Russia Date of Isolation:2011
Other Geographic Information:15,000-40,000-year-old permafrost

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 37 bp)GGGGAGCCCGCAGAATTCGGAAAAAATCGTACGCTAA
IRR (Length: 37 bp)GGGGAGCCCGCAGAATTCGGAAAAAATCGTACGCTAA

 Sequence     
DNA SequenceLength  21894 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGAGCCCG CAGAATTCGG AAAAAATCGT ACGCTAACAG CTCAAGTGTC CCGACCACGC CCGACAGTAG CTTGTTGGCT GGTCAATCTG GTTCACGGGT 100
AAAGCGATAG AACAGGTTTG GCTCACTGAC CACGTACAAA TACCCTTCAT CATCGATGGT TACGCCTTCG GCCTGGGGTA TGCCTTTCAG CAAACCAGCA 200
AAACCCCTCG CCAAGGAACG GAAACTCACC ACCTTGCCCT CATCGGTCAT TTCAATCAGC AGTTTCGACT CGTCGCTGAG CAGTATGAGA TGGCCACTCT 300
GTTGGTCGAA GACGACCGAA GACAAGTCAG TGGCAAATAC CTTGTCCTTT ACCAAGTTGG ACAGGTCGCG CACGTGCAGG GAAAAACCTC CTGCCAGGCT 400
GGCACGAAGG CCGCCCACTT CCAGCAATTG GCGAGGGTCA CGCTCCTTGG TCACAAACAA GCGATCACCT TTCAGGTCGT AGGCGAGCCC TTCAAGGCCT 500
TTGTTGTCCT CCTTGCCAAG CGCCAGGGTC AGAGCTGGAT ACTGGTCCCG GCTCAATGAA CGATCGGGAG AAAGCTTACC GTCTTCGGCG ATGGGGACAT 600
CCACAATAAC CAGGCTCTGC CGGCGCTCCT CGGCGATTAC CAGCTGGCCG TTGCCGGCAT AGGAGACCGC CTCCACATCG TGGAAGCCAT CCAGGTTGTA 700
ACGCCTTTCC ACATCACCGT CACGACTAAG GGCCAATAGT TCGTTTGGGC CGTTGGTGAC TGCCCACAGC AGGTTTAGGT CAGGGTCAAA GGTCAGACCC 800
GAAAGATTGT TGTCCACACC GGGGACCGCC TTAGCATCCA GTTCAACCCG ATAGCCAGGC AGCCACACAG AGCGCTCCTG CCAATCGTCG GTGTGCCAGC 900
TGGTCTTTAT CCAGAAGTAC AAACGATCAT CAAGGTGATG GGTGCGGACT TGGAATACGG TGAGCAACAC AAGGCACAGC AGTGCCCACA TCCAAGCGCT 1000
TGCTTTCCGT GTTCGGCTCA GCCAGTTTTT AGCCATCAAA TACATTAGGA GCCTCGTTAT TTGGGCTGAC GCCACGAGTC GTGACGATTT CAATCCGACT 1100
CGGTGCGACT CGCACAGGTG ATGCACAATG GCGTGGCCGG ATCGAACTCC AGACGGCCCG AGGCGATCAA CTCGCCGCAT TGGTTACACC AGCCATCATT 1200
GCTTGCTGCT GGAGTGCATC AATTCTCGAC AGACGCCCTA CCTTGCTTTG ATCCAGCTCT ACCGATTGCG AGCGAGACTC AGCGTCTTCC AGCAATTGAT 1300
CCAGCTCGGC AGCCCGCTGT TCCAGCAGGG TCTTGAAATG GGCAAGATCC AGGGCGTCGT CCATGGACAT TAACGCAGCA GTAACAACGG ACTGGTGGTG 1400
GTGCGGAGCA TGCTGGTCGT GGTGCTACCG ACCAGGAACT GCCGGATACG TGAATGGCCA TAGGCCCCCA TCACCAGCAG ATCAATGCCA TGCTCTTTCT 1500
GATAGGCGTG GAGGGTAGGC TCTATCTCGC CGTTCAGGGC CTCGGCGCGA ACAGTGAATC CGGCGTTGAG CAGCACTTTC TGCGCCCAGT CCAGCTGCGC 1600
CGACGATTCG TCGCTCACGG GCCCAACCAT GACCAGGTGG ATCGGCAGCC CCTTCAGCAG GGGGCTGGCC GCCAGCATCT CCACACCCTT GCGGGTAGTA 1700
GCGCCGCCAT CGAAGGCGAG CATCGCGCTC TCAGGCTTTT GGAAGTTGGC CGGGGTGACC AGAATCGGTC GGTGCATGAT ACGGATCACG CTCTCCAGCT 1800
GGCTTCCGAC ATGCTGACTC AGACCACCGC TAGATTCGCC CTGGCGACCG ATGACCAGCA GGCGCGTTTC GGTTTGCAGC TCTTGCAGGC TTTCCAGCAG 1900
ATCGCCATGA CGTTGCTTGG ACTCCGGCGC GGCCACGCCA TCCTTAATGG CCCGCTCTTT TGCGGCCGCA AGCATGATCC GCCCTTGTTC AAGGGCCAAC 2000
TTGCCACGCT GTTCATCCAG GGAAGCAAGC TCATCGAGCA GATGCTCGCG GCTGCCAAGG CCGATATTGC CACTCAGATC GGCCGTAACC GGGTACTGGC 2100
GCTGATCCAG CACATGCAGG AAGGTCAGCG GGGCTTCCAG GCTCAGACTG GCCCAGGCCG CGTAGTCGCA CACGGCTGGA GCCGAGGCGG AAGCGTCTAT 2200
ACAGGCAATT ACTTGGGTCA TTGTTGTTCT CCTTCTTAGT GGCCCATGAG TTGATCAATG GCGTCGGGTT TATCGTGAAC ACCGAAGCGA TCCACGATAG 2300
TGGCGCTCGC TTCGTTGAGG CCCAGCACTT CAACTTCGGT GCCTTCGCGG CGGAATTTGA TGACCACTTT GTCCAAAGCG GCAACGGCGG TGATATCCCA 2400
GAAGTGAGCA CGGTTCAGGT CGATGGTTAC CTTGTTTAGG GCTTCTTTGA AGTCGAAGGC CGCGACGAAC TTGTCTGCCG AGCTGAAGAA CACCTGGCCG 2500
GTGACGTTAT AGCTACGATG CTCGCCGGCT TCGTCCAGCA AAGAGCTGAT CGCCATGTAA TGGCCAACCT TGTTGGCGAA GAACATCGCG GCCAGCAGTA 2600
CGCCGGCCAA CACGCCGAAG GCAAGGTTGT GGGTGGCGAC CACGACCACC ACGGTGACGA CCATGACAAT GTTGGTCGAC AACGGGTGCT TCTTCAGGTT 2700
GCGCAGCGAA TCCCAACTGA AGGTGCCGAT GGACACCATG ATCATCACTG CCACCAGCGC AGCCATCGGG ATCTGCTTCA GCCAGTCGCC GAGGAATACC 2800
ACCATCAGTA GCAGGAATAC GCCTGCGGCC AGGGAGGACA GACGAGAACG ACCGCCGGAT TTAACGTTGA TGATCGACTG ACCAATCATC GCGCAACCTG 2900
CCATACCGCC GATTAGGCCC GAAGCAATGT TGGCCACGCC TTGACCCTTG CACTCGCGGT TCTTGTCACT GGAGGTGTCG GTCAGGTCGT CGACAATGGT 3000
CGCGGTCATC ATCGATTCCA ACAGACCGAC CACAGCCAGT GCTGCCGAAT AAGGGAAGAT GATGGCCAGC GTCTCGAATG TCAGCGGCAC GTCAGGCCAG 3100
AGGAAGATCG GTAGCGTATC CGGCAGTTCA CCCATATCAC CGACCGTGCG GATATCCAGC CCAACCGACA TGGCGACGGC GGTCAGCACG ATGATGCACA 3200
CCAGCGGCGA TGGGATGAGC TTGCCGATCT TGGGGACATA GGGGAACAGA TAGATGATGC CGAGGCCTGC GGCTGTCATG GCGTAGACGT GCCAGGTGAC 3300
ATTGGTCAGC TCGGGCAGCT GAGCCATGAA AATCAGGATC GCCAGTGCAT TGACGAAACC GGTCACCACC GAGCGCGAGA CGAAGCGCAT CAGCGATCCG 3400
AGCTTCAGGT AGCCAGCAGC GATTTGTAGC ACGCCACATA GCAGCGTGGC GGCCAGCAGA TATTCAAGAC CATGGTTCTT GACCAGGGTC ACCATCAGCA 3500
GTGCCATTGC ACCGGTTGCG GCCGAGATCA TTCCGGGGCG ACCACCGACA AAGGCGATAA CCACGGCGAT ACAGAAAGAG GCGTACAGGC CGACCTTGGG 3600
GTCGACGCCG GCAATGATCG AGAAGGCGAT GGCTTCAGGG ATTAGGGCCA GTGCGACCAC AATACCGGCG AGGATGTCGC CACGGATGTT GGATAACCAG 3700
GTTTGTTTTA ACGAGTGGAG CATCAGAATT CCCAAGGCAA TGGATCGCGC AGAACAGCAT GGCGCAGGCC ATGTGCAGCT GGTCGATACG AGGTCAAATT 3800
GTCGGATGTA GAGGAGCTGT GGCGGGTGTT AAAACCTAAA GCACAGCAGA ACGCGACCGC TGGCAGAGCA AGCAGTCACA GATGATGCGG GGGGCGAAGC 3900
GCTATGGCGG CGTAGGCAGC CAGATCATGT TTTGCAGGGT AAGCATGAGG TCTTATCGAG TGTCTTTAGT AACTCAATGG CCGCAACAGT CTACAGGAAG 4000
AGGGCAATTT CTGCGAGTCA CCCCCGGACT AGGGCGTCCT GTTTGGATGT CAGCCTGAGC TATACCCTAA CTGGATGTCA GGCAAGGCCG CACCGCGCCT 4100
GTCATTTTCA GAAGACGACT GCACCAGTTG ATTGGGCGTA ATGGCTGTTG TGCAGCCAGC TCCTGACAGT TCAATATCAG AAGTGATCTG CACCAATCTC 4200
GACTATGCTC AATACTCGTG TGCACCAAAG CGAGGTGAGC ATGGCGACGG ACACCCCACG GATTCCAGAA CAAGGCGTGG CCACTCTGCC TGATGAGGCT 4300
TGGGAGCGTG CGCGCCGTCG TGCGGAGATC ATCAGTCCGT TGGCGCAGTC GGAGACGGTC GGGCACGAAG CGGCCGATAT GGCGGCTCAG GCGCTGGGCT 4400
TGTCTCGGCG CCAGGTATAC GTTCTGATCC GGCGTGCCCG GCAAGGCAGC GGCCTCGTGA CGGATCTGGT GCCCGGCCAG TCCGGTGGAG GTAAAGGTAA 4500
GGGGCGCTTG CCGGAACCGG TCGAGCGCGT CATCCACGAG CTACTGCAAA AGCGGTTCCT GACCAAGCAG AAGCGCAGCC TAGCGGCCTT TCACCGCGAA 4600
GTCACTCAGG TGTGCAAGGC TCAAAAACTG CGAGTGCCGG CGCGCAATAC CGTGGCCTTA CGGATCGCTA GCCTTGACCC GCGCAAGGTC ATCCGCCGGC 4700
GGGAAGGCCA GGATGCCGCT CGTGACCTAC AAGGTGTGGG CGGCGAGCCT CCTGCCGTGA CCGCGCCGCT GGAGCAGGTG CAGATAGACC ATACGGTCAT 4800
CGACCTGATC GTGGTCGATG ACCGCGACCG GCAACCTATT GGCCGCCCGT ACCTGACCCT CGCCATCGAC GTGTTCACCC GCTGCGTGCT CGGCATGGTC 4900
GTCACGCTGG AAGCGCCGTC TGCCGTTTCG GTTGGCCTGT GCCTCGTGCA TGTCGCCTGC GACAAGCGCC CTTGGCTGGA AGGACTGAAC GTGGAAATGG 5000
ATTGGCAGAT GAGCGGCAAG CCCTTGCTGC TCTACCTAGA CAACGCGGCC GAGTTCAAGA GCGAGGCCCT GCGCCGGGGT TGCGAGCAGC ATGGCATCCG 5100
GCTGGACTAT CGCCCGCTGG GACAGCCGCA CTATGGCGGC ATCGTGGAAC GGATCATCGG CACGGCGATG CAGATGATTC ACGACGAACT GCCGGGAACG 5200
ACCTTCTCCA ACCCTGACCA GCGCGGCGAC TACGATTCCG AAAACAAGGC CGCCCTGACG CTGCGCGAGC TAGAGCGCTG GCTCACATTG GCGGTCGGCA 5300
CCTACCACGG TTCGGTGCAC AACGGCCTGC TCCAACCGCC GGCCGCGCGC TGGGCCGAGG CCGTGGCGCG TGTCGGCGTA CCGGCCGTCG TCACACGCGC 5400
TACTTCGTTC CTGGTCGATT TTCTGCCGAT CCTCCGGCGC ACGCTGACCC GCACCGGCTT TGTCATCGAC CACATCCACT ACTACGCCGA TGCGCTCAAG 5500
CCGTGGATTG CGCGGCGTGA ACGCTGGCCG TCCTTTCTGA TCCGGCGCGA TCCGCGCGAC ATCAGCCGTA TCTGGGTCCT GGAACCGGAG GGACAGCATT 5600
ACCTGGAAAT TCCCTACCGT ACCTTGTCGC ATCCGGCTGT CACCCTCTGG GAACAACGGC AGGCGCTGGC GAAACTGCGG CAGCAAGGGC GCGAACAGGT 5700
GGATGAGTCG GCGCTGTTCC GCATGATCGG CCAGATGCGT GAGATTGTGA CCAGCGCGCA GAAGGCCACA CGCAAGGCGC GGCGTGACGC GGATCGCCGC 5800
CAGCACCTCA AGACATCAGC TCGGCCGGAC AAGCCCGTTC CGCCGGATAC GGATATTGCC GACCCGCAGG CAGACAACTT GCCACCCGCC AAACCGTTCG 5900
ACCAGATTGA GGAGTGGTAG CCGTGGACGA ATATCCCATC ATCGACCTGT CCCACCTGCT GCCGGCGGCC CAGGGCTTGG CCCGTCTTCC GGGGGTCGTC 6000
TCAGAAAACG GACCGCAAAG TACGCTAAGG CGGCTGCAGC GGTCGTAGGG GCCTGAATTT GCCAGCTCCG ATCTTGGCGC TGCTGCGCCA GAGGTAATCG 6100
CCGGTCAGGT TGATGTGCTC CCAGCCCAGC GGCGACAGGT ACTGCAACAG CGCATCATCG ATGCCGAGAC CGTTTCCACG CAGCGCATGC GCTGCGCGCT 6200
CCAGGTAGAC CGTGTTCCAT AACACGACAG CCGCCGTCAC CAAGTTTAGG CCGCTGGCCC GGTAGCGCTG CTGCTCGAAA CTGCGGTCGC GAATTTCACC 6300
CAGCCGGTTG AAGAACACGG CGCGGGCCAA CGCGTTCCGC GCTTCCCCCT TGTTGAGTCC GGCGTGGACA CGGCGGCGCA GCTCCACGCT TTGCAGCCAG 6400
TCGAGGATGA ACAGCGTGCG CTCGATGCGT CCCAGCTCAC GCAGGGCGAC GGCCAGGCCG TTCTGGCGTG GATAGCTGCC GAGCTTGCGC AGCATTAGTG 6500
AGGCCGTCAC CGTGCCATGT TTGATCGAGG TAGCCAGCCG CAGGATTTCA TCCCAATGGG CACGGACATG CTTGATGTTG AGCGTGCCGC CGACCATCGG 6600
CTTGAGCGCC TCATAGGCGG TATCGCCCTT AGGGAGGTAG AGCTTAGTGT CGCCCAGGTC GCGGATGCGC GGCGCGAAGC GGAAGCCCAG CAGGTGCATG 6700
AGCGCGAAGA CGTGATCGGT AAAGCCCGCC GTGTCGGTGT AGTGCTCCTC GATCCGCAGG TCGGATTCGT GGTAAAGGAG GCCGTCGAGC ACGTAGGTCG 6800
AGTCGCGCAC GCCGACGTTG ACCACCTTGG CGTGGAACGG CGCGTACTGG TCAGAGATGT GGGTGTAGAA AGTCCGTCCT GGGCTGCTGC CATACTTCGG 6900
GTTGATATGG CCGGTGCTTT TGGCCTTGCT GCCTGTTCGG AAGTTCTGAC CGTCCGACGA TGACGTGGTG CCGTCGCCCC AGTGACAGGC GAAGGGATGC 7000
CGGAACTGGG TGTTGACCAG TTCTGCCAGC GCCGTTGAAT AGGTCTCGTC GCGGATGTGC CAGGCTTGCA GCCAGGCCAG CTTGGCGTAG GTCGTGCCGG 7100
GGCAGGACTC GGCCATCTTG CTCAAGCCCA GGTTGATCGC ATCGGCCAGG ATCGTGGTCA GCAGCAGGTT CTTGTCCTTG GCCAGGTCGC CGGATTTCAA 7200
GTGCGTGAAG TACCGGGTGA AGCCCGTCCA CTCATCGACT TCGAGCAGTA GTTCGGTGAT CTTGACGTGC GGCAGGATCA TTGCTGTCTG GTCGATCAGC 7300
GCCTGCGCGG TGTCGGGCAC CGCCGCGTCC AGCGGCGTGA TCTTCAGGCC CGACTCGGTG ATGATGGCAT CCGGCAAGTC GTTGGCCGCC GCCATGCGGT 7400
TGACGGTGGC AAGCTGCGCT TCTAGCAGTG TCAGCCGCTC GTACAGGTAC TGGTCGCAGT CGGTGGCCAC GTCCAGCGGC AATTCGCTGC CCTGCTTGAG 7500
GCTGGCGAAC TTCTCGTGCG GCACCAGGTA ATCCTCGAAA TCCTTGAACT GACGCGAGCC CTGCACCCAG ATGTCGCCCG AGCGCAGCGA GTTCTTGAGT 7600
TCCGACAGCG CGCACAGTTC ATAGTAGCGC CGGTCGATGC CGGCGTCGGT CATCACCAGC TTCTGCCAAC GAGGCTTGAT GAAGTCGGTC GGGGCATCAG 7700
TGGGCACCTT GCGGACGTTG TCAGTGTTCA TGCCGCGCAG TACGTCGACG GCGTCGAGCA CGCCCTTGGC GGCGGGCGCG GCCCGCAGCT TGAGCACGGC 7800
CAGGAATTCC GGCGCGTAGC GGCGCAAGGT AGCGTAGCTC TCGCCGATGC GGTGCAGGAA ATCGAAGTCA TCGGGCTGCG CGAGCTTCTG CGCCTCGGTG 7900
ACGCTCTGGG CGAAGGCATC CCAGGACATG ACGGCCTCGA TGGCGGCGAA CGGGTTGCCG CCCGACTGCT TGGCGTCGAT CAGCGCCTGG CCGATGCGTC 8000
CGTACAGTCG CACCTTGGCG TTGATCGCTT TGCCGGACGC CTGGAACTGT TGCTGATGCT TGTGTTTGGC GGCGTTGAAC AGCTTGCCCA GAATGCGGTC 8100
GTGCAGGTCG ATGATTTCGT CGATGACGGT GGCCATACCC TCGATGGCCA GCGCGACGAG GGTGGCGTAG CGCCGTTGCG GCTCGAACTT GGCCAGATCA 8200
GCGGGCGTCA TCTGGCCACC CTCGCGGGCG ATCTTGAGCA GCCGGTTCTG GTGAAGCAGC CGTTCGATGC CAGTAGGCAG GTCGAGCGCT TGCCAGGCTT 8300
TCAGGCGCTC GATGTGTTCG AGCATGTGGC GCGAGTTCGG CTTGACGGGC GACTGGCGCA GCCAGGCCAG CCAGGTCGTC TTGCCGAACT CGCGGCGCTT 8400
GAGCAGATCA TCGAGGCGAT GCCGGTGGGG GTCTGTCAGC GGCTCGGACA GCGCTTCGTA GATGCGCCGG TTGGCGCGAG TAATGGCCTC GGCGCAGATG 8500
CGTTCAATGA CGCCCGGTGA CGGGAGCAGC ACGCTCTTTT GTCGCAGCCC TTCGATCAAC TCCGTCGCCA ACACGATGCC TTTGTCGGTC TGCCAAGCCA 8600
GTTCATCCAG GCTGTGCACG CTGGGGCGAT AGTGCCGCGT TGCGAAGGCC TGGAAACCAA AGATCGATTG CAGTTCCAGC AGGTGCTCGC GGCGCGTCTC 8700
GGCGCGCTGG CCGTAGTCCG CCCAGGCTTC GGGTGGCACC TTCAGTTGCG TGGCTACCAG ACGCAGCAAC GGCGGAAACG GCTCCGTATC TACCGCGAGC 8800
ATCATGCCGG GATAGCGCAT GTAGCAGAGC TGCACGGCGA AGCCCAGGAG GTTGGCTGGA CCGCGCCGTT GCCGGATGAT CGAGAGGTCG GATTCGCTGA 8900
ACGTGTAGTA GCGGATCAAG TCCTCCATGG TGTCCGGCAA CGCCAGCAGG CTCTCGCGCT CGGCGGCGGA CAGGATCGAA CGGCGCGGCA TGTCCGGCGA 9000
CTCCCTCTCG AATTCGCTTG GTTACATCTT CGGCGGCCAG TTATGCGTCT CACTCTGGCA GTGCTTGCAC CATGCATAGA ACGCGTCGTA CATCACCATG 9100
CCGTGCTTGA GCATTTCATG GTCGTCGCTG AAGTTCTGCG ACAAGCCAAG AGATAGCGCG TACAACCCTG TCGACTGCGG CGTCAGGTCA AGTCGGGATG 9200
TATCGGCACC GCGAACAATC ACGGCGAGCT GTTTGAGGGC AGGGTCATCC ATCGCGTACT TGGCCAGGAA GGCATCGAAG CTGCAAAGCT CACCGTCATG 9300
GGAAAGTTCC ACTCCAGGAA TGTCATACGG GACCGCGCCG GTCTCCTGAG CGATGCGCAG CACGTCGCCT GCCGGGACGT AGAGGAACTC GGCATGCGTG 9400
TCGATGAACC GCGTCACCAT CCACGGGCAG GCAATGCGAT CGATCTTCGG GCGTTCGCGG GTAATCCATT TCATGAGAGT CCTCCTGAGG GTTGGTGACT 9500
AGCCCAGCGA ATAGCCGCTC GTTGCCAGTC GATGTTGGCC ATGAATGCAT CTACATAGGC ACCGGCCTTG GCGCCATAGT CGATGTGATA CGCGTGTTCA 9600
TACATATCAA GCGCCAGGAT TGGCAAAGCG CCAGCCAAGG TGTGGCAGTG ATCGGCGGCC CACTGGTTGC TCAACTTGCC GTCGCGCGCT GATTGGACCA 9700
GCAGCACCCA GCCGGAACCG CCGCCGAGCG CCTTGCCCAT CGCCGAGAAT TCGGCCTGCC AGCGCTCGAC GCTGCCAAAG TCGCGCTCGA TCGCCTCGCA 9800
CAGCGGGCCT ACGGGCAACA CGCCGTTGCC GCCCAGCGAG TCGAAGTAGA TCTCATGCAG CAGCATCGAG TTGTAGGCGA TCAGTTCTTC GCGTTTGAGA 9900
CCGTTCAGCA GGAAGCCGGC TTCCTGCGTG AAGTCAAGGG TGCCGAGCTT GGTGTGGATG GCGTTCAGGC GTTTGACGGC CCCGGAATAG TTGTTTTCGT 10000
GATGGCTGGC GATCAGCTTT TCGGACAGAC CATTTAGGGT ACTTGCGGGG AAAGGCAGCG GTTTAATGTC GAAGGACATG GTGTCACCTC ACAAGATCAA 10100
GGTCTTCAAT ATCAGGCCCA GCACCGCACA TGCCGCGATG ACGTGAATCA CGTTTCGCTT GAAGCGGAAC AAGGCCACTG CCGCACCGAT GGTGATCAGT 10200
GCCGACACCC AGTCGAAGAG CCCGGCGAGG CCTTTGGGCC AGAGCACGTG ATAGGCGAAA AACACGGCCA GGTTCAGGAT CACACCGACC ACCGCTGCCG 10300
TTATCGCAGT CAGCGGCGCG GTAAACCGGA GATCTCCGCG CGTCGACTCT ACGAACGGCC CTCCGGCGAG GATGAAAATG AAGGACGGCA GGAAAGTGAA 10400
CCAGGTCACC AGCGCGGCTG CGACCGCACC GGCAACGAAC AACATGTCGG GGCCGAATAG TGCCTGTACA TAGGCCCCCA CAAAGCCGAC GAAGGCCACC 10500
ACCATAATGA GCGGCCCCGG ATTGGCCTCG CCGAGCGCCA ACCCATCGAC CATCTGCGTG GGGGTGAGCC AACTGTAATG GCCGACCGCA CCCTGATAGA 10600
TGTACGGCAA TACTGCATAG GCCCCCCCAA AGGTCAGTAA TGCGGCTTTC GTAAAGAACC AGCCCATCTG GGTCAGGGTG TGGTCCCAGC CATAGGTGCC 10700
GAGAAGGAAT GCCATGGGGA TCAGCCACAA CAGGCAACCC ATCGCGGCAA CCCGCAGCGA GCCAGACCAG CGGAACAGGG CGTGCGACGG TATGGGGGTG 10800
TTGTCATCGA TCAGCGCGGG GCCATAGGAT TTATCGGCCG CACGATGCGC GCCGCCGGCC CTGAATTTGT CCGGGGTAAC GCGACCGCCG ATATACCCTA 10900
TCAGCGCGGC CCCGGCGACG ATGGCCGGAA ACGGCACATT CATCGCGAAG ATGGCGACGA ATGCCCCAGC GGCAATCGCC CACATCAGGC CGTTCTTGAG 11000
AGCACGCGAG CCGATCCGAT GCACGGCCTG CACGACAACC GCGGTGATGG CAGGTTTGAT GCCGTAGAAC AGGCCGGAAA CCAGTGGCGT GTCACCGAAC 11100
GCAATGTAAA TCCACGACAG CGCGATCAGA AAGAAGAGCG AAGGCAGCAC AAACAGGACA CCTGCAACTA TGCCTCCCCA AGTTCGGTGC ATTAGCCAGC 11200
CCATGTATGT GGCGAGTTGC TGCCCCTCCG GGCCCGGAAG CAGCATGCAG AAGTTGAGCG CATGCAGAAA GCGACGCTCG CTGATCCAGC GCCGCTGTTC 11300
GACCAATTCG CGGTGCATGA TCGCGATCTG TCCGGCGGGG CCGCCGAAGC CTATGAACCC GATCTTTAAC CACAGGCGAA ACGCTTGCCA AAAGCTGACA 11400
ACTTGTGGGG AGGGAGGCAC TGCCACAGCC TCCTTGGTTA CGACGGTTTG AGTCATACGG TGAGGGTCCC TTTTTCAAAG CTGGCCAGTA AGCCATCGAA 11500
CACAGTGGAG GCGATGGCCA ATAGTTGATC GTCGTGGTCA ACCGTTTCCC GCAAACCGGC CAGTACGCTT TCGATACCAG TGGCCTCTGG CGGCTGGATG 11600
CCGCCCACGT CGAGGTAATG CACCACAAGG CCAATCCTTG TGATGGCGGG CTGTTCCAGC CCAAAGCTCG CCGCCAGGAC CTCGAACGTG ACACGGCTGC 11700
CGACATGGCT GAACGTCGCG CCATCGAAGT CGAAGCCCAA CGCATCCGGC GGGCAGTCCG CAGGGGTTGC CAACCAAAGG ATGCGCGCCT GCGGGTCGAT 11800
GAAGCGCCGG ATCAGCCATG CGCTGGCGAG CCGATCAACC CAAGGACGTG CGCGAGTGGC CCAGGTACGG GCCTGGTAAT CCAAACGATC CAAGCGGGTA 11900
ATAGTCCCCT CTACAGCGTG CGGCTCGTCC GGCGACAGCG TGCGGGCGCA AGCTTGTTCC AGTTCACACA ACGCACTGTC CGCTTGACGC TGAGCCTCGC 12000
CGGGGTAGAA GTCGATTTCA ACCAGCGTAG TAAAGGATTT GCGAAGCTTA CGCACCTGCC GCAGCACGTC TTGCACGGTA TCCAATGTCA GCGTCTGCCT 12100
GAGATGATGG ACATCGACTA GCAAGGCAGC AAAATCGTTG CTGCGGTCGA ATAATGCGAC GAAGTTGACC CCTTCAGGGT CTTCCATACG CAGCACATGA 12200
GCGACCCCAC CGCCTTCACG CACATCGGAG GCCAAGTTAT CCAGCACCGC GCGGCATTCG TCGCGGTCGG GCATCAGGTA CACGCCGTCG CGCAGCACCG 12300
CAGCGCCGGA GGCTTTGAGG GCACGCCACG TCCGTTGCCG GACGGTCGCG TTTTCAGTAG GCAAGGAAAG GATAAGCGAA AGCAAATTCA TTTCGTAGAT 12400
GTTACTACAA TAATGAGATA AGATCTACAA AATAAAGTCT TGAGTAGATT GCAAAAACGG TCATTTGCGC AATCACAATG GAGGCAGCAC ACCCATAAGG 12500
TGTTGTGCGT TGCTAAAACG TATTGCAAAA TAAAAACAAA TGGCAATAGG AATAAGCAAT CATGCGCATC GGTTACGCCC GCGTTTCGAC CCAAGAGCAA 12600
GACAACCAAG CTCAAATCTC TGCCTTGCAA TCGGCAGGGT GTGAGTTGAT CTTCCAGGAG AAGGCCTCTG GTGGGCGCTG GGATCGTCCG GAGCTGCATC 12700
GGTTGCTTGG CCACCTGCGC AAGGCCGATG TGGTGGTGGT ATGGAAACTG GATCGCTTGT CCCGGTCCTT GAAAGACCTG CTGCTGACCT TGGAAAAGAT 12800
TGAAGAAGCG GGCGCGGGCT TTCAGAGTCT CACTGAATCT ATCGACACCA CGACACCGGC TGGACGAATG ATGATGCAGA TCGTCGGTTC ATTCGCGGAG 12900
TTCGAGCGGG CGATGCTACG CGAGCGCACG CGGCACGGTC TGGAAGCTGC GCGCAAGGAT GGGCGCGTCG GCGGCCGACG TCCGAAGCTG ACGCAGCAAC 13000
AGCAAAAAGA GATCGTCGCC CTGATCACGT CGGGGCAGAA GACGGGGGCT GATGCTGCCC GCTTGTTTCG AGTCCATCCT TCCACCGTTG TGCGGCTGCT 13100
GGCCAAGCAT CGGCAGGGGC CGGGGTAGTC CGGCTTAGCG TACTTTGCGG TCCGTTTTCT GAGACGACCC CTCCGGCGGA CGAGCGCATC CAGCGCCTTC 13200
GCGCCGACCG CTGGATCGGC TATCCGCGCG CAGTCGAGGC GCTGAACCGG CTGGAAGCCC TTTATGCGTG GCCAAACAAG CAACGCATGC CCAACCTGCT 13300
GCTGGTTGGC CCGACCAACA ATGGCAAGTC GATGATCGTC GAGAAGTTCC GCCGCACCCA CCCGGCCAGC TCCGACGCCG ACCAGGAGCA CATCCCGGTG 13400
TTGGTCGTGC AGATGCCGTC CGAGCCGTCC GTGATCCGCT TCTACGTCGC GCTGCTCGCC GCGATGGGCG CGCCGCTGCG CCCACGCCCA CGGTTGCCGG 13500
AAATGGAGCA ACTGGCTCTG GCACTGCTGC GCAAGGTCGG CGTGCGCATG CTGGTGATCG ACGAGCTGCA CAACGTGCTG GCCGGCAACA GCGTCAACCG 13600
CCGGGAATTC CTCAACCTGC TGCGCTTCCT CGGCAACGAA CTGCGCATCC CGTTGGTTGG GGTAGGCACG CGCGACGCCT ACCTAGCCAT CCGCTCCGAT 13700
GACCAGTTGG AAAATCGCTT CGAGCCGATG ATGCTGCCGG TATGGGAGGC CAACGACGAT TGCTGCTCAC TGCTGGCCAG CTTCGCCGCT TCGCTCCCGC 13800
TGCGCCGGCC TTCCCCAATT GCCACGCTGG ACATGGCTCG CTACCTGCTC ACACGCAGCG AGGGCACCAT AGGGGAACTG GCGCACTTGC TGATGGCGGC 13900
GGCCATCGTC GCCGTGGAGA GCGGCGAGGA AGCGATCAAC CATCGCACAC TCAGCATGGC CTGTCGACAA CCTCTCGCGC AACCAAGACA TCGCGGTCGG 14000
ACTGCAAGTG ATCTTGAAGC CACGGGCCCG TCCCACCCCG ACATGGACCT CGATGCCCGA ACGGACGTTA GATTTCGAGT TCTAGGCGTT CTGCGATGAA 14100
GGTTGGATCC CAGCCGGGAT TGAAAGTGTC GACGTGGGTG AATCCGAGCC GCTCGTATAG GCCACGCAGG TTCGGGTGGC AGTCGAGCCG CAGCTTGGCG 14200
CACCCCTGCG TTCGCGCGGC ATGGCGGCAA GCCTCGATCA GCGCGGAGCT GACACCCCGG CCCGCATGTG TCCGTCGCAC CGCGAGCTTG TGCAGATATG 14300
CGGCCTCCCC CTTGAGGGCG TCGGGCCAGA ACTCGGGATC CTCGGCCGAC AAGGTGCAAC AGCCGACGAT GCCGTCGCTG CAACTCGCGA CTAGGAGCTC 14400
GGATCTCAGG ACGAAGGTCT CCGCGAATGT CCGGTCGATC CGCGCGACGT CCCAGGCGGG CGTTCCCTTG GCGGACATCC ACGCCGCAGC GTCGTGCATC 14500
AGCCGCACAA CCTCGTCGAT ATCACCCGAG CAGGCGACCC GAACGTTCGG AGGCTCCTCG CTGTCCATTC GCTCCCCTGG CGCGGTATGA ACCGCCGCCT 14600
CATAGTGCAG TTTGATCCTG ACGAGCCCAG CATGTCTGCG CCCACCTTCG CGGAACCTGA CCAGGGTCCG CTAGCGGGCG GCCGGAAGGT GAATGCTAGG 14700
CATGATCTAA CCCTCGGTCT CTGGCGTCGC GACTGCGAAA TTTCGCGAGG GTTTCCGAGA AGGTGATTGC GCTTCGCAGA TCTCCAGGCG CGTGGGTGCG 14800
GACGTAGTCA GCGCCATTGC CGATCGCGTG AAGTTCCGCC GCAAGGCTCG CTGGACCCAG ATCCTTTACA GGAAGGCCAA CGGTGGCGCC CAAGAAGGAT 14900
TTCCGCGACA CCGAGACCAA TAGCGGAAGC CCCAACGCCG ACTTCAGCTT TTGAAGGTTC GACAGCACGT GCAGCGATGT TTCCGGTGCG GGGCTCAAGA 15000
AAAATCCCAT CCCCGGATCG AGGATGAGCC GGTCGGCAGC GACCCCGCTC CGTCGCAAGG CGGAAACCCG CGCCTCGAAG AACCGCACAA TCTCGTCGAG 15100
CGCGTCTTCG GGTCGAAGGT GACCGGTGCG GGTGGCGATG CCATCCCGCT GCGCTGAGTG CATAACCACC AGCCTGCAGT CCGCCTCAGC AATATCGGGA 15200
TAGAGCGCAG GGTCAGGAAA TCCTTGGATA TCGTTCAGGT AGCCCACGCC GCGCTTGAGC GCATAGCGCT GGGTTTCCGG TTGGAAGCTG TCGATTGAAA 15300
CACGGTGCAT CTGATCGGAC AGGGCGTCTA AGAGCGGCGC AATACGTCTG ATCTCATCGG CCGGCGATAC AGGCCTCGCG TCCGGATGGC TGGCGGCCGG 15400
TCCGACATCC ACGACGTCTG ATCCGACTCG CAGCATTTCG ATCGCCGCGG TGACAGCGCC GGCGGGGTCT AGCCGCCGGC TCTCATCGAA GAAGGAGTCC 15500
TCGGTGAGAT TCAGAATGCC GAACACCGTC ACCATGGCGT CGGCCTCCGC AGCGACTTCC ACGATGGGGA TCGGGCGAGC AAAAAGGCAG CAATTATGAG 15600
CCCCATACCT ACAAAGCCCC ACGCATCAAG CTTTTGCCCA TGAAGCAACC AGGCAATGGC TGTAATTATG ACGACGCCGA GTCCCGACCA GACTGCATAA 15700
GCAACACCGA CAGGGATGGA TTTCAGAACC AGAGAAAGAA AATAAAATGC GATGCCATAA CCGATTATGA CAACGGCGGA AGGGGCAAGC TTAGTAAAGC 15800
CCTCGCTAGA TTTTAATGCG GATGTTGCGA TTACTTCGCC AACTATTGCG ATAACAAGAA AAAGCCAGCC TTTCATGATA TATCTCCCAA TTTGTGTAGG 15900
GCTTATTATG CACGCTTAAA AATAATAAAA GCAGACTTGA CCTGATAGTT TGGCTGTGAG CAATTATGTG CTTAGTGCAT CTAACGCCGG AGTTAAGCCG 16000
CCGCGCGTAG CGCGGTCGGC TTGAACGAAT TGTTAGACAT CATTTACCAA CTGACTTGAT GATCTCGCCT TTCACAAAGC GAATAAATTC TTCCAAGTGA 16100
TCTGCGCGTG AGGCCAAGTG ATCTTCTTTT TGTCCCAGAT AAGCTTGCTT AGCTTCAAGT AAGACGGGCT GATACTGGGC AGGTAGGCGT TTTATTGCCC 16200
AGTCGGCAGC GACATCCTTC GGCGCGATTT TGCCGGTTAT TGCGCTGTAC CAAATGCGGG ACAACGTAAG CACTACATTT CGCTCATCGC CGGCCCAGTC 16300
GGGCTGCGAG TTCCATAGCT TCAAGGTTTC CCTCAGCGCC TCGAATAGAT CCTGTTCAGG AACCGGGTCA AAGAATTCCT CCGCTGCCGG ACCTACCAAG 16400
GCAACGCTAT GTTCTCTTGC TTTTGTAAGC AGGATAGCTA GATCAATGTC GATCATGGCT GGCTCGAAGA TACCCGCAAG AATGTCATTG CGCTGCCATT 16500
CTCCAAATTG CAGCTCGCGC TTAGCCGGAT AACGCCACGG GATGATGTCG TCATGCACGA CAAGGGTGAC TTCTATAGCG CGGAGCGTCT CGCTCTCGCC 16600
AGGGAAAGCC GAAGCCTCCA TAAGATCATT GAGCAATGCT CGCCGCGTCG TTTCATCAAG CTTTACGGCC ACAGTAACCA ACAAATCAAT ATCGCTGTAT 16700
GGCTTCAGGC CGCCATCCAC TGCGGAGCCG TACAAATGCA CGGCCAGCAA CGTTGATTCC AGATGGCGCT CAATGACGCT TAGCACCTCT GATAGTTGGT 16800
TCGAAATTTC GATGGTCACC GCTTCCCTCA TGATGTCTAA CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCAAACA 16900
TCGACCCACG GCGTAACGCG CTTGCTGCTT GGATGCCCGA GGCATAGACT GTACAAAAAA ACAGTCATAA CAAGCCATGA AAACCGCCAC TGCGCCGTTA 17000
CCACCGCTGC GTTCGGTCAA GGTTCTGGAC CAGTTGCGTG AGCGCATACG CTACTTGCAT TACAGTTTAC GAACCGAACA GGCTTATGTC CACTGGGTTC 17100
GTGCCTTCAT CCGTTTCCAC GGTGTGCGTC ACCCGGCAAC CTTGGGCAGC AGCGAAGTCG AGGCATTTCT GTCCTGGCTG GCGAACGAGC GCAAGGTTTC 17200
GGTCTCCACG CATCGTCAGG CATTGGCGGC CTTGCTGTTC TTCTACGGCA AGGTGCTGTG CACGGATCTG CCCTGGCTTC AGGAGATCGG AAGACCTCGG 17300
CCGTCGCGGC GCTTGCCGGT GGTGCTGACC CCGGATGAAG TGGTTCGCAT CCTCGGTTTT CTGGAAGGCG AGCATCGTTT GTTCGCCCAG CTTCTGTATG 17400
GAACGGGCAT GCGGATCAGT GAGGGTTTGC AACTGCGGGT CAAGGATCTG GATTTCGATC ACGGCACGAT CATCGTGCGG GAGGGCAAGG GCTCCAAGGA 17500
TCGGGCCTTG ATGTTACCCG AGAGCTTGGC ACCCAGCCTG CGCGAGCAGC TGTCGCGTGC ACGGGCATGG TGGCTGAAGG ACCAGGCCGA GGGCCGCAGC 17600
GGCGTTGCGC TTCCCGACGC CCTTGAGCGG AAGTATCCGC GCGCCGGGCA TTCCTGGCCG TGGTTCTGGG TTTTTGCGCA GCACACGCAT TCGACCGATC 17700
CACGGAGCGG TGTCGTGCGT CGCCATCACA TGTATGACCA GACCTTTCAG CGCGCCTTCA AACGTGCCGT AGAACAAGCA GGCATCACGA AGCCCGCCAC 17800
ACCGCACACC CTCCGCCACT CGTTCGCGAC GGCCTTGCTC CGCAGCGGTT ACGACATTCG AACCGTGCAG GATCTGCTCG GCCATTCCGA CGTCTCTACG 17900
ACGATGATTT ACACGCATGT GCTGAAAGTT GGCGGTGCCG GAGTGCGCTC ACCGCTTGAT GCGCTGCCGC CCCTCACTAG TGAGAGGTAG GGCAGCGCAA 18000
GTCAATCCTG GCGGATTCAC TACCCCTGCG CGAAGGCCAT CGGTGCCGCA TCGAACGGCC GGTTGCGGAA AGTCCTCCCT GCGTCCGCTG ATGGCCGGCA 18100
GCAGCCCGTC GTTGCCTGAT GGATCCAACC CCTCCGCTGC TATAGTGCAG TCGGCTTCTG ACGTTCAGTG CAGCCGTCTT CTGAAAACGA CAGCGCCGTC 18200
AGAATAGAAT CCGCTTTCAC ATTCTTTGAC ACATGCTTGC CAAGGTCATA GATTTCAGCC TGACAAATTC AAGGCTTCGG GCGCAATGGA ACCAAAAACC 18300
AACGTAAGCC CTACAGCCCA TGGAGGCATC TTGCAGGGAC AACGCATCGG TTATGTCCGG GTCAGCAGTT ACGATCAGAA TCCGGAACGA CAACTTGAGC 18400
AAGTTGAGGT CGGCAAGCTG TTCACCGACA AAGCCTCGGG CAGGGACACC CAGCGTCCCC AGCTGGAGGC CATGCTCGGC TTCGTCCGCG AGGGCGACAC 18500
CGTTGTGGTG CACAGCATGG ATCGCCTGGC CCGTAACCTC GATGACTTGC GACGCCTGGT GCAGAAGCTG ACCCAGCGCG GCGTGCGTAT CGAGTTCCTG 18600
AAAGAGGGCC TGGTGTTCAC CGGCGATGAC TCGCCGATGG CCAACCTGAT GCTGTCGGTG ATGGGGGCCT TCGCCGAGTT CGAGCGCGCC CTGATCCGTG 18700
AGCGGCAACG GGAGGGCATC GCCCTGGCCA AGCAGCGCGG CGCGTACCGG GGCCGCAAGA AGGCCCTGTC CGACGAGCAG GCTGCTACCC TGCGACAGCG 18800
GGCGTCGGCC GGCGAGCCCA AAGCGCAGCT TGCCCGCGAG TTCAACATCA GCCGGGAAAC TCTCTACCAG TACCTACGCA CGGACGATTG ATACATGCCG 18900
CGTCGCTTGA TCCTCTCGGC TACGGAGCGG GATACCCTGC TCGCGTTGCC GGAAAGCCAG GATGACCTGA TCCGCTACTA CACCTTCAAC GACTCCGACC 19000
TGTCGCTGAT CCGCCAGCGG CGCGGCGACG CCAACCGCCT GGGCTTCGCG GTGCAGCTCA GCCTGCTGCG ATATCCAGGC TATGCGCTGG GCAGCGACAG 19100
CGAGTTGCCC GAGCCGGTCA TCCAGTGGGT GGCCAAGCAA GTTCAGGCCG ACCCAACGAG TTGGGCGAAA TACGGCGAAC GCGACGTGAC TCGCCGCGAG 19200
CACGCCCAGG AACTGCGCAC CTACCTACAA CTGGCCCCGT TCGGCCTGTC CGACTTCCGC GCCCTGGTGC GCGAGCTGAC CGAGTTGGCC CAGCAGACCG 19300
ACAAGGGTTT GCTGCTGGCC GGCCAGGCGC TGGAGAGTCT GCGGCAGAAG CGGCGCATCC TGCCGGCGCT GAGCGTGATT GACCGGGCCT GCTCGGAAGC 19400
CATTGCGCGG GCCAATCGCC GGGTCTACCG CGCCCTGGTC GAACCACTCA CGGACTCGCA TCGGGCCAAA CTGGACGAGC TGTTGAAGCT CAAGGCCGGC 19500
AGCAGCATCA CCTGGTTGAC CTGGTTGCGG CAGGCCCCAC TAAAACCGAA CTCCCGGCAC ATGCTCGAAC ACATCGAGCG GCTGAAGACA TTTCAGCTGG 19600
TGGATTTGCC CGAAGCTCTG GGCCGGCACA TCCACCAGAA CCGCCTGCTC AAGCTGGCCC GCGAGGGTGG GCAGATGACG CCCAAAGACC TCTGTAAGTT 19700
CGAGCCGCAG CGGCGCTACG CGACCCTGGC CGCCGTGGTG CTGGAGAGTA CGGCGACCGT GATTGATGAG CTGGTCGATC TGCACGACCG CATCCTGGTC 19800
AAGCTGTTCA GCGGCGCGAA GCACAAGCAT CAGCAGCAGT TCCAGAAGCA AGGCAAGGCG ATCAACGACA AGGTGCGCCT GTACTCCAAG ATCGGCCAGG 19900
CCCTGCTGGA GGCCAAGGAA AGCGGCAGCG ATCCCTACGC CGCCATCGAG GCGGTGATTC CCTGGGACGA GTTCACCGAG AGCGTCAGCG AGGCCGAGCT 20000
GCTGGCCCGG CCGGAGGGCT TCGACCATCT GCACCTGGTT GGAGAGAACT TCGCCACCCT GCGCCGCTAT ACGCCAGCCT TGTTGGAGGT GCTGGAACTG 20100
CGCGCCGCCC CGGCTGCGCA AGGCGTGCTG GCGGCCGTGC AGACCCTGCG CGAGATGAAC GCCGACAACC TGCGCAAGGT GCCGGCCGAT GCGCCCACCG 20200
CCTTCATCAA GCAGCGCTGG AGGCCGCTAG TGATAACCCC GGAAGGCCTC GACCGGCGCT TCTACGAAAT CTGCGCCCTG TCAGAGCTGA AGAACGCGCT 20300
GCGCTCCGGC GACATCTGGG TCAAGGGCTC GCGGCAGTTC CGCGACTTCG ACGACTACCT GCTGCCGGCA GAGAGGTTCG CCGCGCTCAA GCATGCGCAG 20400
GCTCTGCCCC TGGCGATCAA CCCGAACAGG AACCAGTACC TGGAAGAGCG CTTGCAGCTG CTGGACGAGC AGCTGGCCAC CGTCACCCGC CTGGCCAAGG 20500
ACAACGAGCT GCCCGATGCC ATCCTCACCG AGTCGGGGCT GAAGATCACC CCACTGGATT CCGCGGTGCC CAATACCGCG CAGGCGCTGA TCGACCAGAC 20600
CAGCCAGTTG CTGCCGCGCA TCAAGATCAC CGAACTGCTG ATGGACGTGG ACGACTGGAC GGGCTTCAGC CGCCACTTCA CCCACCTGAA GGACGGTGCC 20700
GAGGCCAAAG ACCGGACATT GCTGCTGGCA GCGATCCTGG GCGATGCGAT CAACCTCGGG CTGACCAAGA TGGCCGAGTC GAGCCCCGGC CTGACCTACG 20800
CCAAGCTGTC CTGGCTGCAA GCCTGGCACA TCCGAGACGA AACCTACTCG GCGGCCCTAG CCGAGCTGGT CAACCACCAG TACCGTCATA CCTTCGCCGC 20900
TCACTGGGGC GACGGCACGA CCTCTTCTTC CGATGGCCAG CGCTTCCGGG CGGGCGGTCG GGGCGAAAGC ACCGGGCACG TCAACCCGAA GTACGGCAGC 21000
GAGCCGGGGC GGCTGTTCTA CACCCATATC TCCGACCAGT ACGCACCGTT CAGCACCCGC GTGGTGAATG TCGGCGTGCG CGATTCCACC TATGTGCTCG 21100
ACGGCTTGCT GTACCACGAG TCCGACCTAC GGATTGAGGA GCACTACACC GACACGGCTG GCTTCACCGA TCACGTCTTC GCCCTGATGC ACCTGCTGGG 21200
CTTCCGCTTC GCACCGCGCA TCCGCGACCT CGGCGAAACC AAGCTGTATG TTCCGAATAG CGTCCAGGAC TACCCGACAT TGCGCCCAAT GGTTGGCGGC 21300
ACCCTGAACA TCAAGCATGT CCGCGCCCAC TGGGACGACA TCCTGCGCCT GGCCAGCTCG ATCAAGCAGG GCACCGTCAC TGCCTCGCTG ATGCTGCGCA 21400
AGCTCGGCAG CTACCCGCGC CAGAACGGTC TGGCCGTGGC CTTGCGCGAA CTGGGCCGGA TTGAGCGCAC ACTGTTCATC CTCGACTGGC TGCAAAGCGT 21500
AGAGCTACGT CGCCGCGTGC ATGCCGGACT GAACAAGGGC GAGGCGCGCA ACTCCCTGGC CAGGGCGGTG TTCTTCAACC GCCTCGGCGA AATCAGGGAT 21600
CGGAGCTTCG AGCAGCAGCG CTACCGGGCC AGCGGTCTCA ACCTGGTGAC GGCCGCCATC GTGCTGTGGA ACACGGTGTA CTTGGAACGC GCCACCCAGG 21700
CGATGGGCGA AGCGGGGAAG TCGGTGGATG GCGAGCTGCT GCAGTACCTG TCGCCGCTGG GGTGGGAGCA CATCAACCTG ACCGGCGATT ATGTCTGGCG 21800
GCAGAGCCGC AGGCTGGAGG ACGGGAAGTT TCGGCCGCTA AGGCTGCCCG GAAAACCTTA GCGTACGATT TTTTCCGAAT TCTGCGGGCT CCCC

 Recombination Sites     

Name Coordinates Gene Sequence
attC-aadA3 5'-end 15985-16038 54 CGCCGGAGTT AAGCCGCCGC GCGTAGCGCG GTCGGCTTGA ACGAATTGTT AGAC
attI 16841-16896 56 CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCA
res_site_II 18205-18231 27 TAGAATCCGC TTTCACATTC TTTGACA
res_site_III 18234-18265 32 TGCTTGCCAA GGTCATAGAT TTCAGCCTGA CA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
taoD Tn5045 83-1045 Passenger Gene Other -
taoC' Tn5045 1167-1370 Passenger Gene Other -
taoB Tn5045 1370-2221 Passenger Gene Other -
taoA Tn5045 2236-3723 Passenger Gene Other -
tniA In_Tn5045 4205-5920 Transposase   +
tniB N-ter In_Tn5045 5923-5991 Transposase   +
tnpA TnOtChr.1 6025-8991 Transposase   -
chrF TnOtChr.1 9022-9474 Passenger Gene Heavy Metal Resistance -
chrC TnOtChr.1 9471-10079 Passenger Gene Heavy Metal Resistance -
chrA TnOtChr.1 10089-11456 Passenger Gene Heavy Metal Resistance -
chrB TnOtChr.1 11453-12391 Passenger Gene Heavy Metal Resistance -
tnpR TnOtChr.1 12562-13128 Accessory Gene Resolvase +
tniB C-ter In_Tn5045 13172-14099 Transposase   +
GNAT_fam In_Tn5045 14068-14568 Passenger Gene Antibiotic Resistance -
sul1 (ARO:3000410) In_Tn5045 14696-15535 Passenger Gene Antibiotic Resistance -
qacEdelta1 (ARO:3005010) In_Tn5045 15529-15876 Passenger Gene Antibiotic Resistance -
aadA3 (ARO:3002603) In_Tn5045 16040-16831 Passenger Gene Antibiotic Resistance -
intI1 In_Tn5045 16977-17990 Integron Integrase Class 1 +
tnpR Tn5045 18331-18891 Accessory Gene Resolvase +
tnpA Tn5045 18895-21861 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
taoD TaoD Tn5045 963 83-1045 -
Class:   Passenger Gene
Sub Class:   Other
Sequence Family:  SdiA-Regulated Motif Containing Protein
Comment:   DNA binding protein
Protein Sequence:  
MYLMAKNWLS RTRKASAWMW ALLCLVLLTV FQVRTHHLDD RLYFWIKTSW HTDDWQERSV WLPGYRVELD AKAVPGVDNN LSGLTFDPDL NLLWAVTNGP
NELLALSRDG DVERRYNLDG FHDVEAVSYA GNGQLVIAEE RRQSLVIVDV PIAEDGKLSP DRSLSRDQYP ALTLALGKED NKGLEGLAYD LKGDRLFVTK
ERDPRQLLEV GGLRASLAGG FSLHVRDLSN LVKDKVFATD LSSVVFDQQS GHLILLSDES KLLIEMTDEG KVVSFRSLAR GFAGLLKGIP QAEGVTIDDE
GYLYVVSEPN LFYRFTREPD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
taoC' TaoC' Tn5045 204 1167-1370 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   truncated compared to Tn1404 due to frameshift-causing deletion
Protein Sequence:  
MSMDDALDLA HFKTLLEQRA AELDQLLEDA ESRSQSVELD QSKVGRLSRI DALQQQAMMA GVTNAAS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
taoB TaoB Tn5045 852 1370-2221 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   also known as uspA1
Protein Sequence:  
MTQVIACIDA SASAPAVCDY AAWASLSLEA PLTFLHVLDQ RQYPVTADLS GNIGLGSREH LLDELASLDE QRGKLALEQG RIMLAAAKER AIKDGVAAPE
SKQRHGDLLE SLQELQTETR LLVIGRQGES SGGLSQHVGS QLESVIRIMH RPILVTPANF QKPESAMLAF DGGATTRKGV EMLAASPLLK GLPIHLVMVG
PVSDESSAQL DWAQKVLLNA GFTVRAEALN GEIEPTLHAY QKEHGIDLLV MGAYGHSRIR QFLVGSTTTS MLRTTTSPLL LLR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
taoA TaoA Tn5045 1488 2236-3723 -
Class:   Passenger Gene
Sub Class:   Other
Sequence Family:  SulP Family Inorganic Anion Transporter
Comment:   also known as sulP sulphate permease
Protein Sequence:  
MLHSLKQTWL SNIRGDILAG IVVALALIPE AIAFSIIAGV DPKVGLYASF CIAVVIAFVG GRPGMISAAT GAMALLMVTL VKNHGLEYLL AATLLCGVLQ
IAAGYLKLGS LMRFVSRSVV TGFVNALAIL IFMAQLPELT NVTWHVYAMT AAGLGIIYLF PYVPKIGKLI PSPLVCIIVL TAVAMSVGLD IRTVGDMGEL
PDTLPIFLWP DVPLTFETLA IIFPYSAALA VVGLLESMMT ATIVDDLTDT SSDKNRECKG QGVANIASGL IGGMAGCAMI GQSIINVKSG GRSRLSSLAA
GVFLLLMVVF LGDWLKQIPM AALVAVMIMV SIGTFSWDSL RNLKKHPLST NIVMVVTVVV VVATHNLAFG VLAGVLLAAM FFANKVGHYM AISSLLDEAG
EHRSYNVTGQ VFFSSADKFV AAFDFKEALN KVTIDLNRAH FWDITAVAAL DKVVIKFRRE GTEVEVLGLN EASATIVDRF GVHDKPDAID QLMGH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA In_Tn5045 1716 4205-5920 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Comment:   identical to tniA (Tn1721)
Protein Sequence:  
MLNTRVHQSE VSMATDTPRI PEQGVATLPD EAWERARRRA EIISPLAQSE TVGHEAADMA AQALGLSRRQ VYVLIRRARQ GSGLVTDLVP GQSGGGKGKG
RLPEPVERVI HELLQKRFLT KQKRSLAAFH REVTQVCKAQ KLRVPARNTV ALRIASLDPR KVIRRREGQD AARDLQGVGG EPPAVTAPLE QVQIDHTVID
LIVVDDRDRQ PIGRPYLTLA IDVFTRCVLG MVVTLEAPSA VSVGLCLVHV ACDKRPWLEG LNVEMDWQMS GKPLLLYLDN AAEFKSEALR RGCEQHGIRL
DYRPLGQPHY GGIVERIIGT AMQMIHDELP GTTFSNPDQR GDYDSENKAA LTLRELERWL TLAVGTYHGS VHNGLLQPPA ARWAEAVARV GVPAVVTRAT
SFLVDFLPIL RRTLTRTGFV IDHIHYYADA LKPWIARRER WPSFLIRRDP RDISRIWVLE PEGQHYLEIP YRTLSHPAVT LWEQRQALAK LRQQGREQVD
ESALFRMIGQ MREIVTSAQK ATRKARRDAD RRQHLKTSAR PDKPVPPDTD IADPQADNLP PAKPFDQIEE W

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB N-ter TniB N-ter In_Tn5045 69 5923-5991 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   disrupted by TnOtChr.1
Protein Sequence:  
VDEYPIIDLS HLLPAAQGLA RLP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA TnOtChr.1 2967 6025-8991 -
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRSILSAA ERESLLALPD TMEDLIRYYT FSESDLSIIR QRRGPANLLG FAVQLCYMRY PGMMLAVDTE PFPPLLRLVA TQLKVPPEAW ADYGQRAETR
REHLLELQSI FGFQAFATRH YRPSVHSLDE LAWQTDKGIV LATELIEGLR QKSVLLPSPG VIERICAEAI TRANRRIYEA LSEPLTDPHR HRLDDLLKRR
EFGKTTWLAW LRQSPVKPNS RHMLEHIERL KAWQALDLPT GIERLLHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LAIEGMATVI DEIIDLHDRI
LGKLFNAAKH KHQQQFQASG KAINAKVRLY GRIGQALIDA KQSGGNPFAA IEAVMSWDAF AQSVTEAQKL AQPDDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKG VLDAVDVLRG MNTDNVRKVP TDAPTDFIKP RWQKLVMTDA GIDRRYYELC ALSELKNSLR SGDIWVQGSR QFKDFEDYLV PHEKFASLKQ
GSELPLDVAT DCDQYLYERL TLLEAQLATV NRMAAANDLP DAIITESGLK ITPLDAAVPD TAQALIDQTA MILPHVKITE LLLEVDEWTG FTRYFTHLKS
GDLAKDKNLL LTTILADAIN LGLSKMAESC PGTTYAKLAW LQAWHIRDET YSTALAELVN TQFRHPFACH WGDGTTSSSD GQNFRTGSKA KSTGHINPKY
GSSPGRTFYT HISDQYAPFH AKVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYLPKGD TAYEALKPMV
GGTLNIKHVR AHWDEILRLA TSIKHGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AVVLWNTVYL ERAAHALRGN GLGIDDALLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
chrF ChrF TnOtChr.1 453 9022-9474 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Chromate
Protein Sequence:  
MKWITRERPK IDRIACPWMV TRFIDTHAEF LYVPAGDVLR IAQETGAVPY DIPGVELSHD GELCSFDAFL AKYAMDDPAL KQLAVIVRGA DTSRLDLTPQ
STGLYALSLG LSQNFSDDHE MLKHGMVMYD AFYAWCKHCQ SETHNWPPKM

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
chrC ChrC TnOtChr.1 609 9471-10079 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Chromate
Comment:   superoxide dismutase unkown function
Protein Sequence:  
MSFDIKPLPF PASTLNGLSE KLIASHHENN YSGAVKRLNA IHTKLGTLDF TQEAGFLLNG LKREELIAYN SMLLHEIYFD SLGGNGVLPV GPLCEAIERD
FGSVERWQAE FSAMGKALGG GSGWVLLVQS ARDGKLSNQW AADHCHTLAG ALPILALDMY EHAYHIDYGA KAGAYVDAFM ANIDWQRAAI RWASHQPSGG
LS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
chrA ChrA TnOtChr.1 1368 10089-11456 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Chromate
Comment:   chromate efflux pump
Protein Sequence:  
MTQTVVTKEA VAVPPSPQVV SFWQAFRLWL KIGFIGFGGP AGQIAIMHRE LVEQRRWISE RRFLHALNFC MLLPGPEGQQ LATYMGWLMH RTWGGIVAGV
LFVLPSLFFL IALSWIYIAF GDTPLVSGLF YGIKPAITAV VVQAVHRIGS RALKNGLMWA IAAGAFVAIF AMNVPFPAIV AGAALIGYIG GRVTPDKFRA
GGAHRAADKS YGPALIDDNT PIPSHALFRW SGSLRVAAMG CLLWLIPMAF LLGTYGWDHT LTQMGWFFTK AALLTFGGAY AVLPYIYQGA VGHYSWLTPT
QMVDGLALGE ANPGPLIMVV AFVGFVGAYV QALFGPDMLF VAGAVAAALV TWFTFLPSFI FILAGGPFVE STRGDLRFTA PLTAITAAVV GVILNLAVFF
AYHVLWPKGL AGLFDWVSAL ITIGAAVALF RFKRNVIHVI AACAVLGLIL KTLIL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
chrB ChrB TnOtChr.1 939 11453-12391 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Chromate
Comment:   chromate-sensitive regulator of chrBACF operon exclusively activated by Cr(VI)
Protein Sequence:  
MNLLSLILSL PTENATVRQR TWRALKASGA AVLRDGVYLM PDRDECRAVL DNLASDVREG GGVAHVLRME DPEGVNFVAL FDRSNDFAAL LVDVHHLRQT
LTLDTVQDVL RQVRKLRKSF TTLVEIDFYP GEAQRQADSA LCELEQACAR TLSPDEPHAV EGTITRLDRL DYQARTWATR ARPWVDRLAS AWLIRRFIDP
QARILWLATP ADCPPDALGF DFDGATFSHV GSRVTFEVLA ASFGLEQPAI TRIGLVVHYL DVGGIQPPEA TGIESVLAGL RETVDHDDQL LAIASTVFDG
LLASFEKGTL TV

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR TnOtChr.1 567 12562-13128 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MRIGYARVST QEQDNQAQIS ALQSAGCELI FQEKASGGRW DRPELHRLLG HLRKADVVVV WKLDRLSRSL KDLLLTLEKI EEAGAGFQSL TESIDTTTPA
GRMMMQIVGS FAEFERAMLR ERTRHGLEAA RKDGRVGGRR PKLTQQQQKE IVALITSGQK TGADAARLFR VHPSTVVRLL AKHRQGPG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB C-ter TniB C-ter In_Tn5045 928 13172-14099 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   disrupted by TnOtChr.1
Protein Sequence:  
PADERIQRLR ADRWIGYPRA VEALNRLEAL YAWPNKQRMP NLLLVGPTNN GKSMIVEKFR RTHPASSDAD QEHIPVLVVQ MPSEPSVIRF YVALLAAMGA
PLRPRPRLPE MEQLALALLR KVGVRMLVID ELHNVLAGNS VNRREFLNLL RFLGNELRIP LVGVGTRDAY LAIRSDDQLE NRFEPMMLPV WEANDDCCSL
LASFAASLPL RRPSPIATLD MARYLLTRSE GTIGELAHLL MAAAIVAVES GEEAINHRTL SMACRQPLAQ PRHRGRTASD LEATGPSHPD MDLDARTDVR
FRVLGVLR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
GNAT_fam GNAT_fam In_Tn5045 501 14068-14568 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  Acetyltransf_1 (Pfam:PF00583)
Comment:   putative acetyltransferase ADU64769.1
Protein Sequence:  
MDSEEPPNVR VACSGDIDEV VRLMHDAAAW MSAKGTPAWD VARIDRTFAE TFVLRSELLV ASCSDGIVGC CTLSAEDPEF WPDALKGEAA YLHKLAVRRT
HAGRGVSSAL IEACRHAART QGCAKLRLDC HPNLRGLYER LGFTHVDTFN PGWDPTFIAE RLELEI

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
sul1 (ARO:3000410) Sul1 In_Tn5045 840 14696-15535 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Transpoase Chemistry:   dihydropteroate synthase
Target:   sulfonamide antibiotic (ARO:3000282)||sulfone antibiotic (ARO:3003401)
Sequence Family:  sulfonamide resistant sul (ARO:3004238)
Comment:   perfect match to reference sequence for ARO:3000410
Protein Sequence:  
MVTVFGILNL TEDSFFDESR RLDPAGAVTA AIEMLRVGSD VVDVGPAASH PDARPVSPAD EIRRIAPLLD ALSDQMHRVS IDSFQPETQR YALKRGVGYL
NDIQGFPDPA LYPDIAEADC RLVVMHSAQR DGIATRTGHL RPEDALDEIV RFFEARVSAL RRSGVAADRL ILDPGMGFFL SPAPETSLHV LSNLQKLKSA
LGLPLLVSVS RKSFLGATVG LPVKDLGPAS LAAELHAIGN GADYVRTHAP GDLRSAITFS ETLAKFRSRD ARDRGLDHA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacEdelta1 (ARO:3005010) QacEdelta1 In_Tn5045 348 15529-15876 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   acridine dye (ARO:3000054)||quaternary ammonium salts
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Comment:   subunit of the qac multidrug efflux pump||perfect match to reference sequence for ARO:3005010 (bitscore:219)
Protein Sequence:  
MKGWLFLVIA IVGEVIATSA LKSSEGFTKL APSAVVIIGY GIAFYFLSLV LKSIPVGVAY AVWSGLGVVI ITAIAWLLHG QKLDAWGFVG MGLIIAAFLL
ARSPSWKSLR RPTPW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aadA3 (ARO:3002603) AadA3 In_Tn5045 792 16040-16831 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  ANT(3'') (ARO:3004275)
Comment:   strict match to reference sequence for ARO:3002603 (bitscore: 522)
Protein Sequence:  
MREAVTIEIS NQLSEVLSVI ERHLESTLLA VHLYGSAVDG GLKPYSDIDL LVTVAVKLDE TTRRALLNDL MEASAFPGES ETLRAIEVTL VVHDDIIPWR
YPAKRELQFG EWQRNDILAG IFEPAMIDID LAILLTKARE HSVALVGPAA EEFFDPVPEQ DLFEALRETL KLWNSQPDWA GDERNVVLTL SRIWYSAITG
KIAPKDVAAD WAIKRLPAQY QPVLLEAKQA YLGQKEDHLA SRADHLEEFI RFVKGEIIKS VGK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 In_Tn5045 1014 16977-17990 +
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LRTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn5045 561 18331-18891 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MQGQRIGYVR VSSYDQNPER QLEQVEVGKL FTDKASGRDT QRPQLEAMLG FVREGDTVVV HSMDRLARNL DDLRRLVQKL TQRGVRIEFL KEGLVFTGDD
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKALSDEQ AATLRQRASA GEPKAQLARE FNISRETLYQ YLRTDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn5045 2967 18895-21861 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   putative transposase of Tn5045 identical to tnpR of Tn1013 in pBS228
Protein Sequence:  
MPRRLILSAT ERDTLLALPE SQDDLIRYYT FNDSDLSLIR QRRGDANRLG FAVQLSLLRY PGYALGSDSE LPEPVIQWVA KQVQADPTSW AKYGERDVTR
REHAQELRTY LQLAPFGLSD FRALVRELTE LAQQTDKGLL LAGQALESLR QKRRILPALS VIDRACSEAI ARANRRVYRA LVEPLTDSHR AKLDELLKLK
AGSSITWLTW LRQAPLKPNS RHMLEHIERL KTFQLVDLPE ALGRHIHQNR LLKLAREGGQ MTPKDLCKFE PQRRYATLAA VVLESTATVI DELVDLHDRI
LVKLFSGAKH KHQQQFQKQG KAINDKVRLY SKIGQALLEA KESGSDPYAA IEAVIPWDEF TESVSEAELL ARPEGFDHLH LVGENFATLR RYTPALLEVL
ELRAAPAAQG VLAAVQTLRE MNADNLRKVP ADAPTAFIKQ RWRPLVITPE GLDRRFYEIC ALSELKNALR SGDIWVKGSR QFRDFDDYLL PAERFAALKH
AQALPLAINP NRNQYLEERL QLLDEQLATV TRLAKDNELP DAILTESGLK ITPLDSAVPN TAQALIDQTS QLLPRIKITE LLMDVDDWTG FSRHFTHLKD
GAEAKDRTLL LAAILGDAIN LGLTKMAESS PGLTYAKLSW LQAWHIRDET YSAALAELVN HQYRHTFAAH WGDGTTSSSD GQRFRAGGRG ESTGHVNPKY
GSEPGRLFYT HISDQYAPFS TRVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG ETKLYVPNSV QDYPTLRPMV
GGTLNIKHVR AHWDDILRLA SSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNSLAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERATQAMGEA GKSVDGELLQ YLSPLGWEHI NLTGDYVWRQ SRRLEDGKFR PLRLPGKP

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
TnOtChr.1-FN821089.1 TnOtChr.1 Transposon 4095-4099 5

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRt In_Tn5045 4100-4132 TGTCATTTTC AGAAGACGAC TGCACCAGTT GAT
repeat t1 In_Tn5045 4108-4126 TCAGAAGACG ACTGCACCA
repeat t2 In_Tn5045 4148-4166 AACACGTCGG TCGAGGACT
repeat t3 In_Tn5045 4177-4196 TCAGAAGTGA TCTGCACCAA
repeat t4 In_Tn5045 4209-4227 TCAATACTCG TGTGCACCA
IRR TnOtChr.1 5992-6029 GGGGTCGTCT CAGAAAACGG ACCGCAAAGT ACGCTAAG
IRL TnOtChr.1 13134-13171 GAATCGCATG AAACGCCAGG CAAAAGACTC TGCTGGGG
repeat i4 In_Tn5045 18073-18091 AGGAGGGACG CAGGCGACT
repeat i3 In_Tn5045 18101-18119 CGTCGGGCAG CAACGGACT
repeat i2 In_Tn5045 18143-18161 ATCACGTCAG CCGAAGACT
IRi In_Tn5045 18160-18192 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 In_Tn5045 18166-18184 GTCACGTCGG CAGAAGACT

 References     

Petrova M, Gorlenko Z, Mindlin S. Tn5045, a novel integron-containing antibiotic and chromate resistance transposon isolated from a permafrost bacterium. Res Microbiol. 2011 Apr;162(3):337-45. doi: 10.1016/j.resmic.2011.01.003. Epub 2011 Jan 22. PubMed ID: 21262357