Transposon
Name: Tn5041
Family: Tn3        Group: Tn4651
Evidence of Transposition: yes
 Host     

Host Organism:Pseudomonas sp. Molecular Source:plasmid
Place of Origin:Central Asia Date of Isolation:1997
Other Geographic Information:isolated from soil of Khaidarkan mercury mine

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 47 bp)GGGGTTATGCCGAGATAAGGCAAAAATTAGGACATTCGTTCTGCAAG
IRR (Length: 47 bp)GGGGGCGTGCCGAGATAAGCCAAAAATTAGGACATTCGTTCTGTAAG

 Sequence     
DNA SequenceLength  14907 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTTATGC CGAGATAAGG CAAAAATTAG GACATTCGTT CTGCAAGATA TTGAACTAAA AGGAAATTTA TTGAGTTCTT GATTGCTGGT CATCCCCCGC 100
CTGACTAGCC GTCTATGCTG ATGTTTTGCC TTACTTGGGG GATGAACTCA ATGGCTTCGG TGGAAAGGAC AGCCTACCCG CTCTTGCCCA GTCAGTTGCC 200
AGCTAAGGAG CTGCATCGAT GCTATTCCCT GTCTGATTCA GAGATCGAAT GGGTCAATAA CACCGCTAAG AGTCCAGCGC TATCGATTGG GCTGGCAATC 300
CAACTAAAGG TGTTTCAGCA GCTACACTAT TTTGTTCCGT TCGAGGAGCT TCCTCAGGAG CTCATCAGTC ATGTCCGACA ATGCCTTCGC TACGGCGCAC 400
GAATAGCTCC GCGCTACAGC AACCCCCGCA CCCTTTACCG ACACCAAGCG GCGGTTCGGC AGTACCTGCA GGTTACACCC TTCTATAGCA GCGACGGGCT 500
AGCGATCACT GAGGAAATCG CACGTGACTG CGCTGTAGTG CTTGAGCAGC GAGTCGATCT CATTAATGCC ATGCTTGATG AGCTGATTCA GCGTGGCTAT 600
GAGCTTCCGG CTTATTCGAC GCTCAACAAC ATCGCAGAAA CCGCTTTGGC GAGTGCTCAG GAAGTTACCT TCAACCTGAT CGTGCTCCGA GCGCCAATCG 700
AGGTGATCTA CAAGCTAAAG GAGCTGCTCG ACACGGATTT CGGGCGTCGG CAGAGTGACT TCAACGCACT CAAGCAGGCA CCCAAGAAGC CTTCCCGCAA 800
GCACCTGGAG GTGTTGATCG ACCACCTGGC GTGGTTAGAG AGCTTCGGAG ATCTGGATGC CATTCTTGAG GGGGTCGTCG ATGCTAAGAT CCGCCACTTC 900
GCCACCCAAG CCGCCGCGTC GGACGTCGCC GAGCTGAAGG ACTGCTCGCT GCCGAAACGC TACACACTGA TGCTGGCCTT GATCTATCGG ATGCGGGTGC 1000
GAACTCGGGA TCACCTGGCC GAGATGTTCA TCCGACGGAT TTCGACGATC CACAAACGCG CCAAGGAGGA GAAGGAGCAA ATCCAGGCGC GGCAACGCCA 1100
GAAGCTGGAG CAACTGGCGG CCACCCTGGA TGGCGTGGTG CAGATTCTTG TTCAGGAACC GGATGACCAG GAGGCTGGCA GTCTGATCCG GGAATTCCTC 1200
TCTCCCGATG GCAACCTGGA TCGGTTGCGC GAGACTTGCG CCGAAGTCCA GGCTACGGGC GGTAACAACT ACCTGCCGCT GATCTGGAAG CACTTCAAGT 1300
CCCATCGCTC GCTGTTGTTC CGTCTGAGCC ACCTTCTTCA ACTGGAACCC ACGACTCAGG ATCGCTCACT TATCCAGGCG CTTCAGCTCA TCCAGGACAG 1400
CGAAAATCTA CACCGCGAGT GGATCGACGA GCATGTCGAC TTGTCGTTTG CGTCGGAGCG CTGGGTTAAG GTCGTGCGTC GTCCTGCCAG TGAAGGGCCA 1500
CCTACCAACC GGCGCTATCT GGAAGTCTGC GTGTTCTCTT ACCTGGCCAG TGAGCTGCGC TCGGGTGATA TGTGCGTGCT GGGGTCGGAA TCTTTCGCCG 1600
ACTACCGTAA GCAGTTGCTG CCCTGGGAAG AATGTTTCCA TCGTCTACCG GCCTACTGCG AAAAGGTGGG GCTGCCTGGC ACGGCGAAGG AGTTTGTCGC 1700
CTCCCTCAAG ATTCAGCTGG AGGAAACCGC GCAGCATCTG GATGAAAAAT TCCCTTCTTG CCGAGGTGAC GTATCGATCA ATGAAGCCGG CGAACCGGTG 1800
CTACGCCGAG TGATAGCGCG GGACATCCCG CCTTCGGCCA TCTCGCTACA GACGGCGCTT ATGCAGCGCA TGCCGGCCAG GCACGTGCTC GACATCATGG 1900
CCAACATTGA GCATTGGATT CAGTTCACTC GGCATTTCGG GCCGATGTCC GGCAACGAGC CAAAGCTCAA AGAACCGGCC GAGCGCTACC TGATGACGAT 2000
CTTCGCCATG GGCTGCAACC TTGGCCCCAA CCAGGCCGCA CGGCATCTGG CCGGTAATGT CACGCCGCAC ATGCTGTCCT ATACGAATCG CCGCCATCTC 2100
TCGCTTGAGA AGTTAGACAA GGCTAACCGC GAGCTGGTGG AACTCTATCT GCAACTTGAC CTGCCCAAGC TCTGGGGCGA TGGCAAGGCG GTGGCCGCGG 2200
ACGGTACGCA GTTCGACTTC TATGACGACA ATCTGCTGGC CGGCTACCAC TTCCGCTATC GCAAGATGGG GGCCGTGGCG TACCGACACG TGGCCAATAA 2300
CTACATCGCG GTGTTCCAGC ACTTCATCCC GCCTGGTATC TGGGAGGCAA TCTATGTGAT TGAGGGGTTG CTCAAGGTCG ACCTCAGCGT CGAACCCGAT 2400
ACGGTGTACT CTGACACCCA GGGCCAGTCG GCCACGGTGT TCGCCTTCAC TCATCTGCTG GGCATCAATC TGATGCCGCG TATCCGCAAC TGGCGCGACC 2500
TGGTGATGTG CCGGCCAGAT CGCGGCGTTT CGTATAAACA CATCAACCGT CTGTTCACCG ACACCGCCGA CTGGCACCTG ATCGAAACCC ACTGGCAGGA 2600
TCTGATGCAG GTCGCGTTGT CAATCCAGGC CGGCAAGATT TCCTCACCTA TGCTGCTGCG CAAACTTGGC TCCTACAGTC GGCGCAACAA GCTCTATCAT 2700
GCCGCGCAAG CGCTGGGCAG CGTGATCCGG ACGATCTTCC TACTCAACTG GATCGGCAGC CGCGAGTTGC GCCAGGAAGT CACCGCCAAC ACCAATAAGA 2800
TCGAGTCCTA CAACGGCTTC TCTAAGTGGC TGTCCTTTGG CGGTGACGTG ATCGCCGAAA ACGATCCGGA CGAGCAACAG AAACGCCTGC GCTACAACGA 2900
CATGGTGGCC TCGTCGGTGA TCCTGCAGAA CACCGTGGAC ATGATGCGCA TCCTGCAGAA GCTCGCCCGT GATGGCTGGC AGTTCACTGA CGACGACGTA 3000
TCGTTTCTCA GCCCCTACCT AACCAGCAAT GTCAAACGTT TTGGGGAGTT CAACCTGAAA CTCAAACGCC CACCGGAACC CTGGATCAAG GATTCCATTT 3100
TCCAGCAGGC TGCGGGATCA ATGCGTGCGA AACAGATGTC TGACAGCAAC GTTGAGGTGA CGAACTGATG CATATCCCGC CAGCTTCGTT CCGCGTGACA 3200
CCTTATGGGG ACGTCGATAC CAAGGTACTC GACTCTCTGC GTGCAAGCTA CGACACCGCT CAGTTGCTCA ACTTGGTCGA CCGGCTGGAT GCCTGCCTTG 3300
CTGAAATCGG AGGGGTCGGC AGCATTCGAG AAGACTTCCT ACGCCTGCAT GGCATGGCCA TGACGGTACT GGAAGGTTTC CCCCTCACTG TGGCTACCAG 3400
TGATGTCGAC AGTATTTGGG CGCAGGCGAT GGCCCTTCAA GAGGATATTT CTGCTTTATG TTCATGCTTG CAGGCGGGTT CTAAACACGT TGCTCCTTTG 3500
GCAGCGCTTG CTCCTGACTA TCAGGACTAG ACTATTCGTG CAAATGGGCT GCCGGCAGAC TGAATACAAT GGAGGTGCAG AGTAAAACTG ATGCTGCAGG 3600
ACTGACGAGT AACTCTATAG CATCGCTGTA CTGTGGGGTG AATTTGACTC TGGGTAGCCG GTTTTGACGC CCTGTAGGCA CGCTGCCATC CTCCCGGGCA 3700
TCGGCCTAGA TAAAACTACT GACGAAGCCT TCGGGCTTAC ATTAGCCACG AGCGGACTTG CATTAAATCT CAATGGACTC ACGCTTTCTA AAAAAAACCA 3800
GAGCCACTTT CCAGAGGCAA AGATTAGTCG TCGTGACGGG TACTGACCTC TGGTGTGCAG GGGTGATCAG GCTCGGATGC CGCTCTCTTA TCCGCGCGCG 3900
ATATGAAGCG CTGATAGCAT TCAAGGCCAC AGAAGTGCAC GACGTACTCG GTACCTTCCG GCGTCAGTGC GGCGTCAAGG GAAATTTCCT TGCAACATTC 4000
GCAGCAACTG ATAGTGGGGG TGTCGTTTGC GTTCATGATG GGGTTTCTCC ATCGTCCAAG AAAACCTAGT AACTCTTCCA CACCTGCGAT CGAACCTGCG 4100
CGCAGATCGA CCTGCGGCTG GCAGTGCAGC AACAATTCCC AACGCTCCCA AGCCTGCCGC AACTCGGCAG CGGAGACCGC GCCGTGCTCC GAGCGGGTCA 4200
CGCCCGCTTC CGAAAGGCCC GTAGAGCCGC TCTCAGGAAG AGGACGAAGA GAACCGTCAG CACGAGCGTC GCGAGGCTCC AATGCTCGCT GACGAAGGCC 4300
CCGGCCGCAG TCCCCGAGAG CAGTAATGCC AGCACCGGCA GATGGCAGGG GCAAGTGAGC GCGGCGAGCA CACCCCACGT GTAGGCGTGC CAGCGGGGCA 4400
TCTTGATTGA TTCGGATTGG TTGGTATTAC GCATGGGTGT GACCTTCGAT GGCACGATGA GTCAGCCCGG CCAACTCCGT TTTCACTGCG TCTAAAGCTG 4500
CCAGCCGGGT CGCGATTTGC CCAAGCAAGC GGTCGATACA CCCGATCACA TCGGTACTAT CGTCTGCATC GAGCGCTCGA CAGAGCCGCG CCAATTCGTC 4600
GAGCCCGATA CCGGACTCAA AGGCGGCACG TACGAAGCAC AGCCGCGCCA GGGACCGCTC ATCGAAAATG CCGTAACCGC TTTCCGTGCG CCGCGCGGGG 4700
TGCAGCAAGC CGCGCAGCAT ATAATCTCGG ACTATATGGA CACTGACGCC CGCGTCCTCG GCCAATCTGG ATATGGAGTA GGCATTCATC GCCGACACTC 4800
CCGACCTTCA CCGCAAACTG GGGCGCTCAG ATATTTCCTT CCGGCTAGGC GCTCAGGTAG CCAGATGAGC AACGGTGCAG CTCCCAGAGC CAGTAGCAGC 4900
CACAACCTGG AGAGATGCTC GCCGTTTTGG TCAAACACAT AAGCCAATAG CGCACCAACT GCGAGCAACA GGAAGTGAGG CCCCGTTATG TAGCAGTGAA 5000
GGCGGCGACA ACGCGTGGCG TTGACCAGGC AGGCGCCGCC CATCACGGCC AGCGCGGCGC CTGCTGCCAG GAACAACGCG GGGCGTCGAT TAGACAGAAC 5100
AATCGCTATC GTCGCCACGA CGGCAGGCAG GCCCCAGAAG CTGACCAACT GCCATGTCTT GCGTAGGCTG TCGCACCTAC CGAGATCGTC TGCCGTGTTG 5200
CTCATGTTTC AACCTCCCTC TCTCATTACC CTGCGCAGCA GGACAATTGT TTGACGTCTT TGTTAAAGGT CTGTGCGGCG AGTTTCAGTC CCTCGACCAT 5300
CGTCAGGTAG GGGAACAACT GGTCAGCCAA TTCCTGCACG GTCATACGGT TGCGGATGGC GAGTACCGCC GTCTGGATCA GTTCTCCTGC TTCCGGGGCC 5400
ACAGCCTGCA CTCCCAGCAG TCGGCCGGAG CCCGCTTCGG CAACCAACTT GATGAAACCC CGCGTGTCGA AGTTGGCCAA CGCGCGCGGC ACGTTGTCCA 5500
GGGTCAAGGT GCGGCTGTCG GTTTCGATCC CGGCGTGCTG CGCTTCGGCT TCGCTGTAGC CGACGGTGGC CACTTGCGGA TCGGTGAACA CCACGGCCGG 5600
CATGACGTCG AGATTGAGCT TGGCCTCGCC GCCGGTCATG TTGATTGCCG CGCGGGTGCC AGCCGCTGCC GCGACGTAGA CGAACTGCGG TTGGTCGGTG 5700
CAGTCGCCGG CCGCATAGAT ATCCGCTGCG CTGGTGCGCA TGCGCTCGTC GATCTGGATG CCGCCGCGCT CGTCCAGCTG CACGTCGGCC GCTTCCAGGT 5800
TCAGGCCCTG GGTATTGGGC GTGCGGCCGG TGGCGACGAG CAGTTGGTCG GCACGTAACT CACCATGGTT GGTGGCCAGT ACGAACTCGC CGTTGGCGTG 5900
GGACACCTGG CTGGCTTGCG TTTGCTCCAG CACTTCGATG CCCTCCATAC GGAAGGCCTC CGTCACCGCC GCGCCGATGG CCGGGTCTTC GTGGAAGAAC 6000
ATCGCACTGC GTGCCAGGAT CGTGACCTCG CTACCCAGCC GGGCGAAGGC CTGCGCCAGT TCCACTGCCA CTACGGAGGC GCCGATCACG GCGAGCCGCT 6100
TAGGGATTGT ATCGCTCGCC AGTGCCTGGT CTGAGGTCCA GTACGGCGTG TCTTTCAGTC CTGGAATCGG TGGAACGGCC GCGCTTGCGC CGGTGGCGAC 6200
CAGGCAGCGG TCGAAGGCTA CGATGTGCTC GCCACCCTCG GCCAGTTTCA CGCTGAGCGT GTGGCCGTCC TGGAAACGGG CGGTGCCGCG CAGCACGCTG 6300
ATCGCCGGCG TGCTCTCCAG GATGCTTTCG TACTTGGCGT GGCGCAGTTC GGCGACACGG TCTTGTTGCT GCGCGAGCAG ACGTTCGCGT AGGACGGTCG 6400
GCGTCATGGC GGAAAGCCCG GCGTCGAACG GGCTCTCGCG GCGCAGATGG GCCACATGCG CGGCACGAAT CATGATCTTG GAGGGCACGC AGCCCACGTT 6500
GACGCAGGTG CCGCCGATGA TGCCGCGCTC GATCAGGGTG ACGCGGGCAC CGCCTTCCAC CACCTTGAGC GCGGCCGCCA TGGCGGCGCC ACCACTGCCG 6600
ATGACCGCGA CGTGGAGCTT GTCGCCCTCT TTCCCGGCGT CAGTGCTGCT CAACCAACCC CGTGCCTTAT CGAGCAGGCC AGGACGGGCT TGTACCATGG 6700
CGTCTTCGAA CGCCGCTCGA TACCCCAGGG CCTCGACAGC GGCCTGCATC TGCTCACGGC TTGCGCCCTC GTCGACCTTC AGTTCGGCCT TCCCGCTGGC 6800
GTAGGAAACA TCCGCCCGAT GCACGCCCGG AATCTTCTCC AAGGCCTCTT TCACATGCAC GACACAGGAG GCGCAGGTCA TACCAATGAT TTTCAGTTCG 6900
GTCATTTCGT TACTCATTAG ATCGTCTCTT GTCAGGTTCA CTGGTTTGGC GGCGTCGGAC AGGCATCCGG CCCACAACGG CGATGAGCGG GCGACACGAG 7000
ATCCCATATC GACACCCCAA ACATGAGGGC CAGGCCGATA TAGAGCAGCC AACCGCTCCG CCAGCCATAA GCCCGCATAA AAAATACCGC TGCCAGTACC 7100
AGGGTAGGAC CGATCAGGCC GAGCGCAGTC CGTCGCCACT GCCGATGATT GAGCCAGCCG AGGGCATTGA CGAGCAGAGC CAGTCCAGCA AACAGAGGCA 7200
GCAGCGTGGT GATGAACAGG CCTTCCCACT GGCTCAAAAA GCCCAGACCG AACGCGGCCC CCAGACTAGC AAGGGCGGGA AAGCACATGG CGCAGCCTAT 7300
GGCAGAAATC AGCACGCCGA CGGAGCCGGC TTTGTCACCG ATCCGCGTGA ACAGATTGAG AGGATTTGCC ATCGGAAGTC CCTCCTATTG CTTGACGCTG 7400
GACGGATAGC CAGCGTCCTC GGTCGCCTTA GTCAGCGCCA GGGCATTGGT CTTGGTATCG TCGAAGGTGA CGATGGCCTC GCGGTTCTCG AAACTCACCT 7500
CAGCCTTGGT CACGCCATCG ACCTTGGTCA ACGCCGTCTT CACCGTAATC GGGCAGGCGG CGCAGGTCAT GCCCGGCACC GCCAGGGTGA CGGTCTGCGT 7600
GGCCGCCCAG ACGGGTGTGG CGACCAGGCT GGCGAGGGCT AAGGATGCGA GCAGTTTTCT CATGGTGAAC TCCTGATCAG TAGAACAAGG GAAGGATGTA 7700
GGGGAAGCCG AGCGCGACCA GCACCAAGGC CGCCACCAGC CAGTACAGCA GCTTGTAGGA GGTACGTACC TGAGGGATGG CGCAGACCTC GCCCGGTGCG 7800
CAGGCTTGAG CGGGGCGGAA AATGCGCCGG TAGGCGAAGA ACAGCGCCAC CAGTGCCGCG CCGATGAAGA GCGGGCGGTA CGGTTCCAGC ACGGTCAGGT 7900
TACCGATCCA GGCCCCGCTG AATCCCAGTG CGATCAGAAT CAGCGGCCCG AGACAGCAAG CCGAGGCGAG AATCGCCGCA AGCCCCCCGG CGACAAGAGG 8000
GGCGCGCCCG TTTGATGGTT CAGACATGCA TTTCTCCTTT CGAGCATTTG ATCGATGGTT TAAGGTTAGT CCCGTAGTCA TGTACGGAAT CAAGCGGTAT 8100
GAAAAACAAT TTGGAAAGCC TGACCATTGG CGCTTTCGCC AAGGCGGCCG GGGTCAACGT GGAAACCATC CGGTTCTATC AACGCAAGGC GCTGTTACCC 8200
GAACCGGACA AGCCCTACGG CAGCATTCGC CGTTACGGTG AGGCGGATGT CGCCCGGGTG AAATTCGTTA AATCCGCGCA ACGGCTGGGC TTTAGCCTCG 8300
ATGAAGTGGC CGGGCTGTTG AGGCTGGATG ACGGTGCTCA CTGCGATGAA GCGCGTGTGC TCGCCGAGCA GAAGCTTGGG GATGTGCGTG GCAAGCTCGC 8400
GGATCTGCGA CGGATCGAGT CAGTTTTGGA GCAACTGGTT CACGACTGTT GTGCGAGCCA CGGGACTGTT TCCTGTCCGC TGATCGTTTC GCTGCATGGG 8500
GACAACTCGG GCGTTAACCG AGGATTTCCC GTTGCGTAAG GCGCCCCTGT TGGTCGGCTT GCGCTTAGAA AAAAGCGGCG CTCAATGAGC GCCGCTGAAT 8600
GGCCAAAGGA GCACTTGCAA AGGGCACAGT TTGGTATTGC TATTTGCCCT CGCGCCTCAG CAGAGTGGGC TCACGTTGCA TCTGGTCGAG TAGCACAGGC 8700
TCTACTTTGC AGGCGGACAG GCGGGCTGCG CTTCGCTACG GCCTGCCGCC GTGGGGCCCA GTTGCTTAAT CTCCTTGACG GTTTCCGCCA CCAGGGTCGC 8800
TTCAGCCCTC TCGCGTGCAG CAATTCGCTC AATCGCTCGG TCGCTCCCGC CCTCGGCCCA TACGGTGGAT GACAGCAGAG TCGCACCCAC TACCAGCAGC 8900
AGTCTTAGGT GTTTCATAAC GGCGATCTCC TCTCGGGTTT TCGATCCACG ATTCAACTCT ACCTCCGTAG TTAAGTACGG AATCAAGGAG AGAGGAGATG 9000
AAGGTCCTGG ATTATGGCGC TGAGAGGAAA TGGCAGGGCT CCGCCATGAA GACGGCGATT GCTTCAGGGC CGTCTAGGGC TGCTGCTGGG TCGTAGTCGT 9100
AAATTTTTTC GCTCATTCTG ACCTCCACTC GCTGGCGAGT TTTTTAGCCG CTTCAATATC ACGGCTTTGG CTGCTTTTGT CGCCGCCGCA CAACAGCAAA 9200
ACGAATTCAT CACCTCGCTG CTGGAAATAG GGGTTGGGGG AGCAACGGAA CAGAAAGTGC ACTTAAGCTC AGTCGCTGCC CCGCAAACCC TTGCAACGTC 9300
TGGATAGTTT CGAAAAACGA CCGTTTTATG AAACCGTTTC CGCTATCGCG AGGAAAGGTC ACCAACACCC GAAAATCAGT GCAATAAACC TTTCTCACGA 9400
ATCAAAGTTC GTTAATTCGC AGTCGCTGAC GAGTAAAACG AACTCTAATT CGGCTTACGT TGGTTTTCAG TTCCATTGCT CCCCAACCCC CGATGTCGCC 9500
CGGGTGAAAT TCGTAAAGTC CGCGCAACGG CTGGGCTTTA GCCTCGAAGA AGTGGCCGGG CTGTTGAGGC TCGATGACGG CGCTCACTGT GATGAAGCGC 9600
GCGTGCTCGC CGAGCAGAAG CTTGGGGATG TGCGTGGCAA GCTCGCGGAT CTGCGACGGA TCGAGTCTGT TTTGGTGCAA CTGGTTCACG ACTGTTGTGC 9700
GAGCCACGGG ACCGTTTCCT GTCCGCTAAT CGTTTCGCTG CATGGGTAAA ACGCTCTGCG TTGGCCAGTG GTTGTGAAGG GAACCAGCGG ACAAGGTCTA 9800
CGGCTGCCGC GGCTGTGAAG CCGCACCGGT CACCGCCGAC AAACCGGCTC AACTGATCGA AAAGAGCATG GCCAGTCCTA GCGTCCTGGC GATGCTGTTG 9900
ATCACCAAAT ACGTCGATGG TCTGCCGCTG CACCGCTTCA AAAAAATCCT CGGTCGTCAC GGCGTCGATA TCCCCCGCCA AACCCTGGCG CGCTGGGTGA 10000
TCCAGTGCGG CGAGCACCTG CAACCGCTGC TGAATCTGTC TACGAAAACA GCCCGGCGTG CCGCGTCGGC ACGAAGGCCG TATTGCGGTG CAAACCAGCG 10100
ATACGCGTTG GTGCTCGGAC GGCTTTGAGT TCCGCTGCGA GGACGGAGCC AAATTGAGCG TAACCTTCGC CCTGGACTGC TGTGATCGCG AGGCCATCGG 10200
CTAGGTCGCG AGCCCGACCG GGTACAGCGG CGATGATATC CGCGACTTGA TGCTGGAAAG CGTGGAGAGG CGCTTCGGTG ATCAACTGCC CGCCACGCCG 10300
GTGCAATGGC TAAGCGATAA CGGCTCGGCG TACACCGCCG ACCAGACGTG CCTGTTTGCT CGACAGATCG GCTTGCAGCC GGTGACCCCC CAGTTCGCAG 10400
CCCGCAGAGC AACGGCATGG CCGAGAGCTT CGTGAAGACG ATCAAGCGTG ATTACGTGGC GCACATACCT AAGCCGGATC GAGAAACGGC ACTACGTAAC 10500
TTGGCCAATC CCTGTGATCC TGCGTGGTCG TCTTACTTTG CCCAACGTCG AGCTGCGATA GACGTGGATT GATTGCCCGG TACTAGACCA TGGTGCTGAC 10600
GAAAGACTTG AGCCGGATGA GGCGCGACTC TCATGCCCGG TTCTTTGGGG GCGGTAGCGC AGTAATGCGC TGCTGTTACC CGACGAAAGT GTACTTAAGC 10700
CCTACCATCT TATCTCGGCG CCATAAACCA GGACCTTCAT CTCCTCCCTC CTTGATTCCG TACTTAACTA CGGAGGTAGA GTTGAATCGT GGATCGAAAA 10800
CCCGAGAGGA GATCGCCGTT ATGAAACACC TAAGACTGCT GCTGATAGTG AGTGCGACTC TGCTGTCATC CACCGTATGG GCCGATGGCA GTTCCGATCG 10900
CCTGTACGGT AAGATGATCC AGGCCAACGA GCAATCCATG CGCGAATACG CTAGCGCCCA AGGCAAGAAC CCGCCAGAAG TCACTCACTA CCGCTATGGC 11000
ATGAAGCTCG ACATCGCCAA GGTCATTCAC GTCACGTCGA CCAATGGCAA CTGCGATGTG ATGCCTGCGC AAATGACCTA CGAGGATTCG AGCGGAAACC 11100
TGCATATTCT GGAGTACCGC GTATCAGGAA CGGACTGCAG GAGCCAGCAC TGAGCATTGT TGACGTGTTG CTGACGGAAA AGTAATTTTC ACGTCACCCT 11200
GACGTTATTT TGCATGTGGA AGTATGTAAG AAGCGCACCC GGCTATGCCC GGCGCGCTTC GGCATATACA CAACCGCACA ATGAAAAATC TGCCAAAACA 11300
TCAAGAGCGT TTATGAACAA CAAGGCCCTG TTGGGACTTT CTCAGATCGT CTTGAGCATC AGCGCTGCGC AGGCTGCAAT GGCCGCCGAG GAAAAAGGCG 11400
AGGGATTCAT CGAAGGCAGC AGCCTGAGCA TCCTCAATCG AAATTTCTAC TTCAACCGTG ATTTTCGCAA AGGCCAGTCC AGCAGTACAG GAAATGGCTA 11500
CTCGGAAGAA TGGGCCCACG GAGTCATAGG CCGATTCGAG TCGGGCTCGG CCAGGCCGAG GACAATTACT CCAAGCTCGG CGGCGCCGTA AAGACCCGTT 11600
TCCTGGACAC TGAAATCAAA GTAGGCGATG TCTTCCCTGT CACGCCTGTC GTGCAGTACG GCGATTCGCG ACTGCTTCCG GAAAGCTTCC GCGGCGTCAC 11700
CGCATACAAC ACCAGTGTCG AGGGCTTGGT GCTACAGGGC GGACGCCTGC ACGCGATGAG CCAACCCAGC TCCAGCAGCA TGCGGGATGA TTTTGCAACC 11800
TTCTACGCAG GCGAAGTCGG CTCTCCGTGG ATAGTCGGCG GTGATTACAC ACCCAACGAC AACCTTGGCT TCAGCCTTTA CACCAGTTGT CTCAAGGATG 11900
CCTGAAACCA ATACTATACC GGCACTACCT GGAGCTACCC GCTTGCAGAT GATGTCGCCT TGGTCGGTGG TTTGAATTAC TACAAGGCCG TCGATGAGGG 12000
GAAGCAGCTC CTCGGCAGTT TTGAGAACGA TATCTGGAGC GGCAAGGTCG GCCTCCGTGT CGGGGCGCAC ACCGGCGAGG GACGGAGACG GCCGACGTGA 12100
ACCAGATCGC TATTGTGCCT TGCTATCGCC CTTCGGGGAC TCCATTCCAA TGTGTTGGTT CATGTTCTCC ATCATTGTAT TGCAGTTTTT CATCATCTTG 12200
GACATTTCCT GCATGTCCAT CATCGGCATA TGGTTGCCGT CCATCATGTG CATGTCCTCA CCCTTATTTG TCTCGGCACT GCTTTGGGCG GGGGCTTTGG 12300
CCTGTTCGGC AAATCCCGTG GCAACAGTTC CAAGGGCTAT GAAGGTAGCT TGGACGGTGT AGGTAATGGC GTTACGCATG GCGACTCTCC TCATCTACGA 12400
CCTTGGTTTC CAGCCAGGCT GTGTATTGAA GAGTTGATTG CTCCACTGTC CTCCTGTTTG GCTCCTTTGG TTTGGAGGAT GGTTTCAGGC GCCTGAGGTA 12500
GGCGCCTTTT TCGGTCAACA AGTCTTCGGC TTCATCGCTC TGGACTCTGC GAGCTGGCTT GACAGCACCG CGTTGTCTTG CACGAGAAGC TGCTTTTCTG 12600
TGGCCAACTG GCTCAATTGG CTTTCAGTTT GGCTTAAGCG TTCCGCCAGC AGGCTTCGCT CCCGTTCATT GACGGCCAGG TAAGTCCGCG TCTCAGCCAA 12700
ACGCTGCTCA CCTTGGCCAT GGCGCTGCTC CAGTGCCTGA TGCGACTGTT GCAAGTCGGT GAATTGAAGT AAGACGTGTT CATGCGCAAT CTGACTCTGC 12800
GCGAGCGTCG CTTGCGTCGT GAGCAGGGTG CTCTCTAGAC GATCATGGTC CTGCACCAGG CGTTGTTCCT GCGCCTGCAG TTCGCCCAGG CGGGTTTGCT 12900
GCGCGAGCAG ACGCTGCCGG AGCGCTGCCA ATTCGTGTTC CAGGCGCTGC TGGCGTTGCT CAGTGGCCTG GCGCTCGTCG CTGCGTTGTT GCGCGACCGA 13000
TGCCTGGTAG TGCTCAAACT GCTCCCGCGC TTGTTGCAGT TGCCGGGTCA GTGCGGCCGC CTCGGCGGCG CGGTCAGCCA GACGTTGTTC GAGCCCGGTC 13100
TTTTCACTGC CCAGGCTGGC CAGGGCGATC TCCTGACGCT GCAGGGTGTC AGCCAGCCCC TGGCTGCGCG TAGTGGCTAC GGCAAGTGCC TGGGCCTGCT 13200
GCTCCTGAAC GCTGAGTTGC GCGTCGCGCT CGACGAATGC CTGCTGCAAC TGTTCCTGCA ACGCGTCGGC CTCTGCCTGG TGAGCCGCTA CGGCCTGCTG 13300
GAGTTGGACG GCCGCCTCCG CCTGAACTTT TTCGTACAGT CCTTTCAGCG CCAGGACCAG CTCCGCGGGC AATCCCAGTT CGGCCTGGGC CAGCGTGCCG 13400
GGATGCGCGG CTTTCCAACG CTTTAACAAC GGAGCAATCG TGCTTTTGCT GCCCGTCCCA CCCAGGGCGA CGCGGATGCT GTCAATGGTG GGGTTGTGGC 13500
CCGCAGCCAC CAGTTGGGTG GCCGCCTGGG CAACATGCAG GTAGAGGACG CCGGAACGGG CCATGAACAC CTCGGATTTT TTCGTACCGT ATTATGGAAA 13600
ACGTAATACC TCGATTTAAG TACAGAATAG TTCAGCCGAC TGAGACCGTC AGTTGACCCA CGATAAGCGC GGTTATCGTG AGTTAAGTCA TCGCGATCGA 13700
GGGTTGTGTC TATAATCTGC GGTACACATG GCCTAAACAG GCGCTTCGTG ATGACAGCCG GCAATAATGA CGAAAACCTC CCCACCAGGC GGCACGAAGA 13800
GCCGACAGTA CTTGCGCGTA CCCCCGGTAC GCTCACCACC CCCGAACAAT TGGCTGAGCA ACATCAGCGT TTTCTCGCCG CCGCGACAAC CGACAACACC 13900
CGGCGCACCT ACCGCTCGGC CATTCGCCAC TTTCTCGCCT GGGGCGGCGT GCTGCCGTGC GATGAAGCCG CGCTGATTCG TTATCTATTG TCTTTTGCGG 14000
AAGTATTGAA CCCGCGCACC CTGGCCCTGC GCCTCACGGC GCTGTCGCAA TGGCACCGTT ATCAGGGTTT TCCTGACCCT ACCGCCAGCG CCACCGCGGG 14100
CAAAACCTTG CGCGGTATTG AGCGGGTGAA CGGGCGGCCT CGACAAAAAG CCAAGGCCCT GGTCCTAGAG GATCTCGAAC GCATCGTGGT GCACCTGAAC 14200
ACGCTCGACG GACTGGCGAC ACTGCGGGAC AGTGCACTGC TCCAGGTCGG GTATTTTGGT GCGTTCCGGC GCAGCGAATT GGTCACGCTG GAGATGCAAT 14300
ACCTCGAGTG GGAGCAGGAA GGTCTACGGA TCACGCTGCC CCGTTCCAAG ACCGATCAGG AGGGCGAGGG ACTCGACAAG GCGATCCCAT ACGGCGACAG 14400
CATCTGCTGC CCCGCGACAG CGCTACGCCG GTGGTTGGAC GCGGCTCAGA TCGTTCAGGG GCCACTGTTC CGGCGCATCA GCCGCTGGGG CGTACTCGGC 14500
GAGGTGGCAC TGCACGAGGG CAGCGTGAAT ACCATCCTGA CGGCACGTGC CGAAGCCGCA GGGCTGTTGT ATGTGCCCGA ACTGAGCAGC CACAGTCTGC 14600
GTCGGGGACT GGCTACCAGT GCGCATCGGG CTGGGGCGGA TTTCCTTGAG ATCAAACGAC AGGGTGGCTG GCGGCACGAT GGCACCGTAC ACGGCTATAT 14700
CGAGGAAGCT GGAGCTTTCG AGGAGAATGC GGCTGGCTCG TTATTACGAC GCAAACCGTA GCCAAGGTTT GTAAGCAGGG CTGGTTAGAA TCCCAAGTGG 14800
CCACCCTCTA TTCTCGACCG TCCTTCCGCA GCACATGAGC AGTTCCCTTA AAAACAGTTA CTTACAGAAC GAATGTCCTA ATTTTTGGCT TATCTCGGCA 14900
CGCCCCC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnpA Tn5041 151-3168 Transposase   +
tnpC Tn5041 3168-3530 Accessory Gene Inhibitor +
urf2-ARD70099.1 Tn5041 3824-4201 Passenger Gene Hypothetical -
merE Tn5041 4198-4401 Passenger Gene Heavy Metal Resistance -
merD Tn5041 4427-4789 Passenger Gene Heavy Metal Resistance -
orfY-WP_017849615.1 Tn5041 4786-5205 Passenger Gene Hypothetical -
merA Tn5041 5226-6905 Passenger Gene Heavy Metal Resistance -
merC Tn5041 6938-7372 Passenger Gene Heavy Metal Resistance -
merP Tn5041 7385-7663 Passenger Gene Heavy Metal Resistance -
merT Tn5041 7677-8027 Passenger Gene Heavy Metal Resistance -
merR Tn5041 8099-8539 Passenger Gene Heavy Metal Resistance +
merR 3'-end Tn5041 9492-9754 Passenger Gene Heavy Metal Resistance +
tnpS Tn5041 12515-13564 Accessory Gene Resolvase -
tnpT Tn5041 13706-14761 Accessory Gene Resolvase +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn5041 3018 151-3168 +
Class:   Transposase
Function:   GO molecular function: DNA binding, transposase activity
Transpoase Chemistry:   DDE
Protein Sequence:  
MASVERTAYP LLPSQLPAKE LHRCYSLSDS EIEWVNNTAK SPALSIGLAI QLKVFQQLHY FVPFEELPQE LISHVRQCLR YGARIAPRYS NPRTLYRHQA
AVRQYLQVTP FYSSDGLAIT EEIARDCAVV LEQRVDLINA MLDELIQRGY ELPAYSTLNN IAETALASAQ EVTFNLIVLR APIEVIYKLK ELLDTDFGRR
QSDFNALKQA PKKPSRKHLE VLIDHLAWLE SFGDLDAILE GVVDAKIRHF ATQAAASDVA ELKDCSLPKR YTLMLALIYR MRVRTRDHLA EMFIRRISTI
HKRAKEEKEQ IQARQRQKLE QLAATLDGVV QILVQEPDDQ EAGSLIREFL SPDGNLDRLR ETCAEVQATG GNNYLPLIWK HFKSHRSLLF RLSHLLQLEP
TTQDRSLIQA LQLIQDSENL HREWIDEHVD LSFASERWVK VVRRPASEGP PTNRRYLEVC VFSYLASELR SGDMCVLGSE SFADYRKQLL PWEECFHRLP
AYCEKVGLPG TAKEFVASLK IQLEETAQHL DEKFPSCRGD VSINEAGEPV LRRVIARDIP PSAISLQTAL MQRMPARHVL DIMANIEHWI QFTRHFGPMS
GNEPKLKEPA ERYLMTIFAM GCNLGPNQAA RHLAGNVTPH MLSYTNRRHL SLEKLDKANR ELVELYLQLD LPKLWGDGKA VAADGTQFDF YDDNLLAGYH
FRYRKMGAVA YRHVANNYIA VFQHFIPPGI WEAIYVIEGL LKVDLSVEPD TVYSDTQGQS ATVFAFTHLL GINLMPRIRN WRDLVMCRPD RGVSYKHINR
LFTDTADWHL IETHWQDLMQ VALSIQAGKI SSPMLLRKLG SYSRRNKLYH AAQALGSVIR TIFLLNWIGS RELRQEVTAN TNKIESYNGF SKWLSFGGDV
IAENDPDEQQ KRLRYNDMVA SSVILQNTVD MMRILQKLAR DGWQFTDDDV SFLSPYLTSN VKRFGEFNLK LKRPPEPWIK DSIFQQAAGS MRAKQMSDSN
VEVTN

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpC TnpC Tn5041 363 3168-3530 +
Class:   Accessory Gene
Sub Class:   Inhibitor
Protein Sequence:  
MHIPPASFRV TPYGDVDTKV LDSLRASYDT AQLLNLVDRL DACLAEIGGV GSIREDFLRL HGMAMTVLEG FPLTVATSDV DSIWAQAMAL QEDISALCSC
LQAGSKHVAP LAALAPDYQD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urf2-ARD70099.1 Urf2-ARD70099.1 Tn5041 378 3824-4201 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Function:   The EAL domain (InterPro:IPR035919) is found in diverse bacterial signalling proteins. It has been shown to stimulate degradation of a second messenger, cyclic di-GMP, and is a good candidate for a diguanylate phosphodiesterase function.
Protein Sequence:  
MTRSEHGAVS AAELRQAWER WELLLHCQPQ VDLRAGSIAG VEELLGFLGR WRNPIMNAND TPTISCCECC KEISLDAALT PEGTEYVVHF CGLECYQRFI
SRADKRAASE PDHPCTPEVS TRHDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn5041 204 4198-4401 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury ion transmembrane transporter activity (GO:0015097)
Target:   Mercury
Protein Sequence:  
MPRWHAYTWG VLAALTCPCH LPVLALLLSG TAAGAFVSEH WSLATLVLTV LFVLFLRAAL RAFRKRA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn5041 363 4427-4789 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   DNA binding (GO:0003677); negative regulation of transcription, DNA templated (GO:0045892); response to mercury ion (GO:0046689)
Target:   Mercury
Protein Sequence:  
MNAYSISRLA EDAGVSVHIV RDYMLRGLLH PARRTESGYG IFDERSLARL CFVRAAFESG IGLDELARLC RALDADDSTD VIGCIDRLLG QIATRLAALD
AVKTELAGLT HRAIEGHTHA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfY-WP_017849615.1 OrfY-WP_017849615.1 Tn5041 420 4786-5205 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MSNTADDLGR CDSLRKTWQL VSFWGLPAVV ATIAIVLSNR RPALFLAAGA ALAVMGGACL VNATRCRRLH CYITGPHFLL LAVGALLAYV FDQNGEHLSR
LWLLLALGAA PLLIWLPERL AGRKYLSAPV CGEGRECRR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn5041 1680 5226-6905 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   electron transfer activity (GO:0009055); flavin adenine dinucleotide binding (GO:0050660); mercury (II) reductase activity (GO:0016152); mercury ion binding (GO:0045340); NADP binding (GO:0050661); oxidoreductase activity, acting on a sulfur group of donors, NAD(P) as acceptor (GO:0016668); cell redox homeostases (GO:0045454); detoxification of mercury ion (GO:0050787); metal ion transport (GO:0030001)
Target:   Mercury
Protein Sequence:  
MTELKIIGMT CASCVVHVKE ALEKIPGVHR ADVSYASGKA ELKVDEGASR EQMQAAVEAL GYRAAFEDAM VQARPGLLDK ARGWLSSTDA GKEGDKLHVA
VIGSGGAAMA AALKVVEGGA RVTLIERGII GGTCVNVGCV PSKIMIRAAH VAHLRRESPF DAGLSAMTPT VLRERLLAQQ QDRVAELRHA KYESILESTP
AISVLRGTAR FQDGHTLSVK LAEGGEHIVA FDRCLVATGA SAAVPPIPGL KDTPYWTSDQ ALASDTIPKR LAVIGASVVA VELAQAFARL GSEVTILARS
AMFFHEDPAI GAAVTEAFRM EGIEVLEQTQ ASQVSHANGE FVLATNHGEL RADQLLVATG RTPNTQGLNL EAADVQLDER GGIQIDERMR TSAADIYAAG
DCTDQPQFVY VAAAAGTRAA INMTGGEAKL NLDVMPAVVF TDPQVATVGY SEAEAQHAGI ETDSRTLTLD NVPRALANFD TRGFIKLVAE AGSGRLLGVQ
AVAPEAGELI QTAVLAIRNR MTVQELADQL FPYLTMVEGL KLAAQTFNKD VKQLSCCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn5041 435 6938-7372 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury ion transmembrane transporter activity (GO:0015097); metal ion binding (GO:0046872)
Target:   Mercury
Protein Sequence:  
MANPLNLFTR IGDKAGSVGV LISAIGCAMC FPALASLGAA FGLGFLSQWE GLFITTLLPL FAGLALLVNA LGWLNHRQWR RTALGLIGPT LVLAAVFFMR
AYGWRSGWLL YIGLALMFGV SIWDLVSPAH RRCGPDACPT PPNQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn5041 279 7385-7663 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury ion binding (GO:0045340); mercury ion transmembrane transporter activity (GO:0015097)
Target:   Mercury
Protein Sequence:  
MRKLLASLAL ASLVATPVWA ATQTVTLAVP GMTCAACPIT VKTALTKVDG VTKAEVSFEN REAIVTFDDT KTNALALTKA TEDAGYPSSV KQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn5041 351 7677-8027 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury ion binding (GO:0045340); mercury ion transmembrane transporter activity (GO:0015097)
Target:   Mercury
Protein Sequence:  
MSEPSNGRAP LVAGGLAAIL ASACCLGPLI LIALGFSGAW IGNLTVLEPY RPLFIGAALV ALFFAYRRIF RPAQACAPGE VCAIPQVRTS YKLLYWLVAA
LVLVALGFPY ILPLFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn5041 441 8099-8539 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   DNA binding (GO:0003677); mercury ion binding (GO:0045340); regulation of transcription, DNA templated (GO:0006355); response to mercury ion (GO:0046689)
Target:   Mercury
Protein Sequence:  
MKNNLESLTI GAFAKAAGVN VETIRFYQRK ALLPEPDKPY GSIRRYGEAD VARVKFVKSA QRLGFSLDEV AGLLRLDDGA HCDEARVLAE QKLGDVRGKL
ADLRRIESVL EQLVHDCCAS HGTVSCPLIV SLHGDNSGVN RGFPVA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR 3'-end N Tn5041 263 9492-9754 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Comment:   incomplete
Protein Sequence:  
DVARVKFVKS AQRLGFSLEE VAGLLRLDDG AHCDEARVLA EQKLGDVRGK LADLRRIESV LVQLVHDCCA SHGTVSCPLI VSLHG*N

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpS TnpS Tn5041 1050 12515-13564 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   DNA binding (GO:0003677); DNA integration (GO:0015074); DNA recombination (GO:0006310)
Transpoase Chemistry:   Tyrosine
Sequence Family:  Tyrosine Site-Specific Recombinase
Protein Sequence:  
MARSGVLYLH VAQAATQLVA AGHNPTIDSI RVALGGTGSK STIAPLLKRW KAAHPGTLAQ AELGLPAELV LALKGLYEKV QAEAAVQLQQ AVAAHQAEAD
ALQEQLQQAF VERDAQLSVQ EQQAQALAVA TTRSQGLADT LQRQEIALAS LGSEKTGLEQ RLADRAAEAA ALTRQLQQAR EQFEHYQASV AQQRSDERQA
TEQRQQRLEH ELAALRQRLL AQQTRLGELQ AQEQRLVQDH DRLESTLLTT QATLAQSQIA HEHVLLQFTD LQQSHQALEQ RHGQGEQRLA ETRTYLAVNE
RERSLLAERL SQTESQLSQL ATEKQLLVQD NAVLSSQLAE SRAMKPKTC

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpT TnpT Tn5041 1056 13706-14761 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   DNA binding (GO:0003677); recombinase activity (GO:0000150); DNA integration (GO:0015074)
Comment:   enhances recombination (resolution)||integrase-like protein
Protein Sequence:  
MSIICGTHGL NRRFVMTAGN NDENLPTRRH EEPTVLARTP GTLTTPEQLA EQHQRFLAAA TTDNTRRTYR SAIRHFLAWG GVLPCDEAAL IRYLLSFAEV
LNPRTLALRL TALSQWHRYQ GFPDPTASAT AGKTLRGIER VNGRPRQKAK ALVLEDLERI VVHLNTLDGL ATLRDSALLQ VGYFGAFRRS ELVTLEMQYL
EWEQEGLRIT LPRSKTDQEG EGLDKAIPYG DSICCPATAL RRWLDAAQIV QGPLFRRISR WGVLGEVALH EGSVNTILTA RAEAAGLLYV PELSSHSLRR
GLATSAHRAG ADFLEIKRQG GWRHDGTVHG YIEEAGAFEE NAAGSLLRRK P

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
kappa_gamma-X98999.3 kappa 9230-9491 262

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRR kappa_gamma 9230-9267 GGGGTTGGGG GAGCAACGGA ACAGAAAGTG CACTTAAG
IRL kappa_gamma 9454-9491 GAATGCAACC AAAAGTCAAG GTAACGAGGG GTTGGGGG

 References     

1.Kholodii G, Gorlenko Z, Mindlin S, Hobman J, Nikiforov V. Tn5041-like transposons: molecular diversity, evolutionary relationships and distribution of distinct variants in environmental bacteria. Microbiology (Reading). 2002 Nov;148(Pt 11):3569-3582. doi: 10.1099/00221287-148-11-3569. PubMed ID: 12427948