Transposon
Name: Tn501
Family: Tn3        Group: Tn21
Evidence of Transposition: Yes
 Host     

Host Organism:Pseudomonas aeruginosa Molecular Source:plasmid pVS1
Date of Isolation:1977

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGAACCGCAGAATTCGGAAAAAATCGTACGCTAAG
IRR (Length: 38 bp)GGGGGGCTCGCAGAATTCGGAAAAAATCGTACGCTAAG

 Sequence     
DNA SequenceLength  8355 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGAACCG CAGAATTCGG AAAAAATCGT ACGCTAAGCT AACGGTGTTC TCGTGACAGC TCTTTGACTA GGCTTTCTAA GGGGTCGTCT CAGAAAACGG 100
AAAATAAAGC ACGCTAAGGC ATAGCCGAAC CTGCCAAGCT TGCTCCACCC TGTAGTGACG CGATCAGCGG GCAGGAAACG TTCCCCCTTC GCGCATGGCA 200
GGCGCACACC AACTCAGACA GCACGGCCTC CATGCGCGCC AGGTCAGCCA TTTTCTCGCG CACGTCCTTG AGCTTGTGCT CGGCCAGACT GCTGGCTTCC 300
TCGCAATGGG TGCCATCCTC CAGCCGCAGC AGCTCGGCGA TCTCATCCAG GCTGAAGCCC AGCCGCTGGG CTGATTTCAC GAAGCGCACC CGCGTTACAT 400
CCGCCTCGCC ATAGCGGCGG ATGCTGCCAT AGGGCTTGTC AGGCTCCAGC AACAAGCCCT TGCGCTGATA GAAACGGATG GTCTCCACAT TGACCCCGGC 500
CGCCTTGGCG AAAACGCCAA TGGTCAGGTT CTCCAAATTG TTTTCCATAT CGCTTGACTC CGTACATGAG TACGGAAGTA AGGTTACGCT ATCCAATTTC 600
AATTCGAAAG GACAAGCGCA TGTCTGAACC AAAAACCGGG CGCGGCGCGC TCTTCACTGG AGGGCTTGCC GCCATCCTCG CCTCGGCTTG CTGCCTCGGG 700
CCGTTGGTTC TGATCGCCTT GGGGTTCAGC GGCGCTTGGA TCGGCAACTT GGCGGTGTTG GAACCCTATC GCCCCATCTT TATCGGCGTG GCGCTGGTGG 800
CGTTGTTCTT CGCCTGGCGG CGCATCTACC GGCAGGCAGC GGCCTGCAAA CCGGGTGAGG TCTGCGCGAT TCCCCAAGTG CGAGCTACTT ACAAGCTCAT 900
TTTCTGGATC GTGGCCGCGC TGGTTCTGGT CGCGCTCGGA TTTCCCTACG TCATGCCATT TTTCTACTGA TCGGAGTTCA CCATGAAGAA ACTGTTTGCC 1000
TCCCTCGCCC TCGCCGCCGT TGTTGCCCCC GTCTGGGCCG CCACCCAGAC CGTCACGCTG TCCGTACCGG GCATGACCTG CTCCGCCTGC CCGATCACTG 1100
TCAAGAAGGC GATTTCCGAG GTCGAAGGCG TCAGCAAAGT TGACGTGACT TTCGAGACAC GCCAAGCGGT CGTCACCTTC GACGATGCCA AGACCAGCGT 1200
GCAGAAGCTG ACCAAGGCAA CCGCAGACGC GGGCTATCCG TCCAGCGTCA AGCAGTGAGT CACTGAAAAC GGCACCGCAG CACAACGGAC GTCATTGTCT 1300
GGCGCCACAA ACGATAAAGG ATCTGTTGCA TGACCCATCT AAAAATCACC GGCATGACTT GCGACTCGTG CGCGGCGCAC GTCAAGGAAG CGCTGGAAAA 1400
AGTGCCAGGC GTGCAGTCGG CGCTGGTGTC CTATCCGAAG GGCACAGCGC AACTCGCCAT CGTGCCGGGC ACATCGCCGG ACGCGCTGAC TGCCGCCGTG 1500
GCCGGACTGG GCTACAAGGC AACGCTAGCC GATGCGCCAC TGGCGGACAA CCGCGTCGGA CTGCTCGACA AGGTGCGGGG ATGGATGGCC GCCGCCGAAA 1600
AGCACAGTGG CAACGAGCCC CCGGTGCAGG TAGCGGTCAT TGGCAGCGGT GGAGCCGCGA TGGCGGCGGC GCTGAAGGCC GTCGAGCAAG GCGCGCAGGT 1700
CACGCTGATC GAGCGCGGCA CCATCGGCGG CACCTGCGTC AATGTCGGCT GTGTGCCGTC CAAGATCATG ATCCGCGCCG CCCACATCGC CCATCTGCGC 1800
CGGGAAAGCC CGTTCGATGG CGGTATTGCG GCAACTGTGC CTACGATTGA CCGCAGTAAG CTGCTGGCCC AGCAGCAGGC CCGCGTCGAC GAACTGCGGC 1900
ACGCCAAGTA CGAAGGCATC CTGGGCGGTA ATCCGGCCAT CACCGTTGTG CACGGTGAGG CGCGCTTCAA GGACGACCAG AGCCTTACCG TCCGTTTGAA 2000
CGAGGGTGGC GAGCGCGTCG TGATGTTCGA CCGCTGCCTG GTCGCCACGG GTGCCAGCCC GGCGGTCCCG CCGATTCCGG GGTTGAAAGA GTCACCCTAC 2100
TGGACTTCCA CCGAGGCCCT GGCGAGCGAC ACCATTCCCG AACGCCTTGC CGTAATCGGC TCGTCGGTGG TGGCGCTGGA GCTGGCGCAA GCCTTTGCCC 2200
GGCTGGGCAG CAAGGTCACG GTCCTGGCGC GCAATACCTT GTTCTTCCGT GAAGACCCGG CCATCGGCGA GGCGGTGACA GCCGCTTTCC GTGCCGAGGG 2300
CATCGAGGTG CTGGAGCACA CGCAAGCCAG CCAGGTCGCC CATATGGACG GTGAATTCGT GCTGACCACC ACGCACGGTG AATTGCGCGC CGACAAACTG 2400
CTGGTTGCCA CCGGTCGGAC ACCGAACACG CGCAGCCTCG CGCTGGACGC AGCGGGGGTC ACTGTCAATG CGCAAGGTGC CATCGTCATC GACCAAGGCA 2500
TGCGCACGAG CAACCCGAAC ATCTACGCGG CCGGCGACTG CACCGACCAG CCGCAGTTCG TCTATGTGGC GGCAGCGGCC GGCACCCGTG CCGCGATCAA 2600
CATGACCGGC GGCGATGCGG CGCTCGACCT GACCGCAATG CCGGCCGTGG TGTTCACCGA TCCGCAAGTG GCGACCGTGG GCTACAGCGA GGCGGAAGCC 2700
CACCACGACG GGATCGAGAC CGACAGCCGC ACCTTGACCT TGGACAACGT GCCGCGTGCG CTCGCCAACT TCGACACACG CGGCTTCATC AAGTTGGTTA 2800
TCGAGGAAGG CAGCCATCGG CTGATCGGCG TACAGGCGGT CGCGCCGGAA GCGGGTGAAC TGATCCAGAC GGCGGCTCTG GCCATTCGCA ACCGCATGAC 2900
GGTGCAGGAA CTGGCCGACC AGTTGTTCCC CTACCTGACG ATGGTCGAGG GGTTGAAGCT CGCGGCGCAG ACCTTCAACA AGGATGTGAA GCAGCTTTCC 3000
TGCTGCGCCG GGTGAGAAAA AGGAGGTGTT CAATGAACGC CTACCCGGTG TCCCGGCTGG CTCTTGATGC CGGGGTGAGC GTGCATATCG TGCGCGACTA 3100
CCTGCTGCGC GGATTGCTGC GCCCGGTGGC GTGCACACCA GGCGGCTACG GCTTGTTCGA TGACGCCGCC TTGCAACGGC TGTGCTTCGT GCGGGCGGCC 3200
TTCGAGGCGG GCATCGGCCT CGACGCGCTG GCGCGGCTGT GCCGGGCGCT GGATGCGGCG GACGGCGACG AAGCGGCCGC GCAGCTTGCC CTGCTGCGTC 3300
AGTTCGTCGA GCGTCGGCGC GAAGCGTTGG CCGATCTGGA AGTGCAGTTG GCCACCCTGC CGACCGAGCC GGCACAGCAC GCGGAGAGTC TGCCATGAAC 3400
AACCCCGAGC GCTTGCCGTC CGAGACGCAC AAACCGATCA CCGGCTACCT GTGGGGCGGA CTGGCTGTGC TGACTTGCCC CTGCCACCTG CCCATCCTCG 3500
CTGTCGTGCT GGCCGGCACA ACCGCCGGTG CTTTCCTCGG CGAGCATTGG GTCATCGCGG CGCTCGGTTT GACCGGCCTG TTCCTTCTGT CCCTGTCGCG 3600
GGCGTTGCGG GCATTCAGGG AAAGAGAATG AGCGCTTTCC GGCCGGATGG ATGGACGACG CCGGAACTGG CCCAAGCGGT CGAGCGCGGG CAGCTTGAAC 3700
TGCACTACCA GCCCGTCGTC GATCTGCGCA GTGGTGGGAT TGTCGGCGCG GAAGCCCTGT TGCGCTGGCG TCATCCGACG CTTGGACTAT TGCCACCGGG 3800
CCAGTTCCTG CCCGTGGTCG AATCGTCCGG CCTGATGCCT GAAATCGGCG CTTGGGTGCT GGGCGAAGCC TGCCGCCAGA TGCGTGACTG GCGAATGCTG 3900
GCATGGCGAC CGTTCCGGCT GGCCGTCAAT GCTTCGGCGA GCCAAGTGGG ACCGGACTTC GACGGGTGGG TAAAGGGCGT GCTGGCTGAT GCCGAGTTGC 4000
CCGCCGAGTA TCTCGAAATC GAGCTGACCG AATCGGTCGC GTTTGGTGAT CCGGCGATCT TCCCCGCCCT GGACGCCTTG CGGCAGATCG GTGTGCGCTT 4100
CGCCGCCGAT GACTTCGGGA CGGGGTATTC CTGTCTGCAA CATCTGAAGT GCTGCCCAAT CAGCACGCTC AAGATCGACC AATCGTTTGT CGCCGGGCTC 4200
GCCAACGACC GCCGCGACCA AACCATCGTG CACACCGTGA TTCAGCTTGC GCACGGGCTG GGCATGGATG TGGTGGCTGA AGGCGTGGAA ACATCGGCGA 4300
GTCTTGATCT ATTGCGACAA GCGGACTGCG ACACAGGACA AGGCTTCCTG TTCGCGAAGC CAATGCCGGC GGCGGCATTC GCCGTCTTCG TCAGTCAATG 4400
GAGGGGTGCC ACCATGAATG CAAGTGACTC GACCACCACC AGTTGCTGCG TGTGCTGCAA GGAAATCCCG CTCGATGCCG CCTTCACCCC GGAAGGCGCG 4500
GAATACGTCG AGCACTTCTG CGGGTTGGAG TGTTATCAAC GCTTCGAAGC GCGTGCCAAG ACAGGGAACG AAACCGATGC CGATCCGAAC GCCTGCGACT 4600
CGCTACCGTC AGATTGAGGC ATACCCTAAC TGGATGTCAG GCAGGGCCGC GCCGCTTAGT CAGAATAGAG TCATCTTTCG CATTTTTGAC ACATGCCTGC 4700
GAAGGTCATA GATTTCAGCC TGACAGAAAC GGGGTTTGAG GCACAACGGA ACAGAAGGAG CACTTAAGCC GCCTTCAACC AAGGAGACAT CGTGCAGGGG 4800
CACCGCATCG GCTACGTCCG GGTCAGCAGC TTCGACCAGA ACCCGGAACG CCAGCTGGAA CAGACACAGG TGAGCAAGGT GTTCACCGAC AAGGCATCGG 4900
GCAAGGACAC CCAGCGCCCC CAGCTCGAAG CGCTGCTGAG CTTCGTCCGC GAAGGCGATA CAGTGGTGGT GCACAGCATG GACCGGCTGG CCCGCAACCT 5000
CGATGACCTG CGTCGCTTGG TACAGAAGCT GACTCAACGC GGCGTGCGCA TCGAGTTCCT GAAGGAGGGC CTGGTGTTCA CTGGCGAGGA CTCGCCGATG 5100
GCCAACCTGA TGCTGTCGGT GATGGGGGCC TTCGCTGAGT TCGAGCGCGC CCTGATCCGC GAGCGGCAGC GTGAGGGCAT CACCTTGGCC AAGCAGCGTG 5200
GCGCGTACCG GGGCCGCAAG AAAGCCCTGT CCGATGAGCA GGCTGCTACC CTGCGGCAGC GAGCGACGGC CGGCGAGCCC AAGGCGCAGC TTGCCCGCGA 5300
GTTCAACATC AGCCGGGAAA CCCTCTACCA GTACCTCCGC ACGGACGACT GACACATGCC GCGTCGCTTG ATCCTCTCGG CCACGGAGCG GGGCACCCTG 5400
CTCGCGTTGC CAGAAAGCCA GGATGACCTG ATCCGCTACT ACACCTTCAA CGACTCCGAC CTGTCGCTGA TCCGTCAGCG GCGCGGCGAC GCCAACCGCC 5500
TCGGCTTCGC CGTGCAACTC TGCCTGCTGC GCTACCCCGG CTATGCGTTG GGCACTGACA GCGAGCTGCC CGAACCGGTC ATCCTGTGGG TGGCCAAGCA 5600
AGTCCAGACC GATCCGGCGA GTTGGACGAA GTACGGCGAG CGCGATGTGA CCCGTCGCGA GCACGCCCAG GAACTGCGCA CCTACCTTCA ACTGGCCCCG 5700
TTCGGCCTGT CCGACTTCCG CGCCCTGGTG CGCGAGCTGA CCGAACTGGC CCAGCAGACC GACAAGGGCT TGCTGCTGGC CGGCCAGGCG CTGGAGAGCC 5800
TGCGGCAGAA GCGACGCATC CTGCCGGCGT TGAGCGTGAT CGACCGGGCT TGCTCGGAGG CCATTGCACG GGCCAATCGG CGGGTCTACC GCGCCCTGGT 5900
TGAACCGCTC ACGGACTCGC ATCGGGCCAA GCTGGACGAG CTGTTGAAGC TCAAGGCCGG CAGCAGCATC ACCTGGTTGA CCTGGCTGCG CCAGGCACCG 6000
CTGAAACCCA ACTCTCGGCA CATGCTTGAG CACATCGAGC GGCTGAAGAC ATTTCAGCTG GTGGACTTGC CCGAAGTCCT GGGCCGGCAC ATCCACCAGA 6100
ACCGCCTGCT CAAGCTGGCC CGCGAGGGTG GGCAGATGAC GCCCAAAGAC CTCGGCAAGT TCGAGCCGCA GCGGCGCTAT GCGACCCTGG CCGCCGTGGT 6200
GCTGGAGAGC ACTGCAACCG TGATTGATGA GCTGGTGGAT CTGCACGACC GCATCCTAGT CAAGCTGTTC AGCGGCGCGA AGCACAAGCA TCAGCAGCAG 6300
TTCCAGAAGC AGGGCAAGGC GATCAACGAC AAGGTGCGCC TGTACTCCAA GATCGGCCAG GCGCTGCTGG AGGCCAAGGA AGCCGGCAGC GACCCCTATG 6400
CCGCCATCGA GGCGGTGATC CCCTGGGACG AGTTCACCGA GAGCGTCAGC GAAGCCGAGC TGCTGGCCCG GCCGGAGGGC TTCGACCACC TGCACCTGGT 6500
CGGCGAGAAC TTCGCCACCC TGCGCCGCTA CACGCCGGCT CTGCTGGAGG TATTGGAGCT GCGCGCCGCC CCGGCCGCGC AGGGCGTGCT GGCAGCCGTG 6600
CAGACGCTGC GCGAGATGAA CGCCGACAAC CTGCGCAAGG TGCCGGCCGA TGCTCCCACC GCCTTCATCA AGCCGCGCTG GAAGCCACTG GTGATCACCC 6700
CGGAAGGCCT CGACCGGCGC TTCTACGAAA TCTGCGCCCT GTCCGAGCTG AAGAACGCCC TGCGCTCCGG CGACATCTGG GTCAAGGGCT CGCGGCAGTT 6800
CCGCGACTTC GACGACTACC TGTTGCCGGC CGAGAAGTTC GCCGCGCTCA AGCGGGAACA GGCCCTGCCG CTGGCGATCA ACCCGAACAG CGACCAGTAT 6900
CTGGAAGAGC GCTTGCAGCT GCTGGACGAG CAGTTGGCCA CTGTCGCCCG CCTGGCCAAG GACAACGAGC TGCCCGATGC CATCCTCACC GAGTCCGGGT 7000
TGAAGATCAC CCCGCTGGAT GCGGCGGTGC CGGATCGGGC GCAGGCGCTG ATCGACCAGA CCAGTCAGTT ACTGCCGCGC ATCAAGATCA CCGAACTGCT 7100
GATGGACGTG GACGACTGGA CGGGCTTCAG CCGCCACTTC ACCCACCTGA AGGACGGGGC CGAGGCCAAA GACCGGACGT TGCTGCTGTC CGCGATCCTC 7200
GGTGATGCGA TCAACCTCGG GCTGACCAAG ATGGCCGAGT CGAGCCCCGG TCTGACCTAC GCCAAGCTGT CCTGGCTGCA AGCCTGGCAC ATCCGCGACG 7300
AGACCTATTC GGCGGCCCTG GCCGAGCTGG TCAACCACCA GTACCAGCAT GCCTTCGCCG CCCACTGGGG CGACGGCACC ACCTCATCCT CCGATGGCCA 7400
GCGTTTCCGG GCTGGCGGCC GGGGCGAGAG CACCGGACAC GTCAACCCGA AGTACGGCAG TGAGCCGGGA CGGCTGTTCT ACACCCATAT CTCCGACCAG 7500
TACGCGCCGT TCAGCACCCG CGTGGTGAAT GTCGGCGTGC GCGATTCCAC CTATGTGCTC GACGGCCTGC TGTACCACGA GTCCGACCTG CGGATCGAGG 7600
AGCACTACAC CGACACGGCC GGCTTCACCG ATCACGTCTT CGCCCTGATG CACCTGCTGG GCTTCCGTTT CGCGCCGCGC ATCCGCGACC TCGGCGAAAC 7700
CAAGCTGTAC GTGCCGCAGG GCGTGCAGAC CTACCCGACG CTGCGGCCGC TGATCGGCGG CACCCTGAAC ATCAAGCACG TCCGCGCCCA TTGGGACGAC 7800
ATCCTGCGCC TGGCCAGCTC GATCAAACAG GGCACCGTCA CTGCCTCGCT GATGCTGCGC AAGCTCGGCA GCTATCCGCG CCAGAACGGC CTGGCCGTGG 7900
CCCTGCGCGA GCTGGGCCGG ATCGAACGCA CGCTGTTCAT CCTAGACTGG CTGCAAAGTG TTGAGCTGCG CCGCCGCGTG CATGCCGGCC TGAACAAAGG 8000
TGAGGCGCGC AACTCGCTGG CCAGGGCGGT GTTCTTCAAC CGCCTTGGGG AAATCAGGGA TCGGAGCTTC GAGCAGCAGC GCTACCGGGC CAGCGGCCTC 8100
AACCTGGTGA CGGCGGCTAT CGTGCTGTGG AACACGGTGT ACCTGGAGCG CGCCACCCAG GGGTTGGTCG AGGCCGGCAA GCCGGTGGAC GGCGAGCTGC 8200
TGCAATTCCT GTCGCCGCTG GGCTGGGAGC ACATCAACCT CACCGGCGAT TACGTCTGGC GGCAGAGCCG CAGACTGGAA GACGGGAAGT TTCGGCCCCT 8300
ACGGATGCCC GGAAAACCTT AGCGTACGAT TTTTTCCGAA TTCTGCGAGC CCCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 4603-4729 127 CTACCGTCAG ATTGAGGCAT ACCCTAACTG GATGTCAGGC AGGGCCGCGC CGCTTAGTCA
GAATAGAGTC ATCTTTCGCA TTTTTGACAC ATGCCTGCGA AGGTCATAGA TTTCAGCCTG
ACAGAAA
res_site_I 4607-4637 31 CGTCAGATTG AGGCATACCC TAACTGGATG T
res_site_II 4662-4691 30 AGAATAGAGT CATCTTTCGC ATTTTTGACA
res_site_III 4694-4725 32 TGCCTGCGAA GGTCATAGAT TTCAGCCTGA CA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn501 114-548 Passenger Gene Heavy Metal Resistance -
merT Tn501 620-970 Passenger Gene Heavy Metal Resistance +
merP Tn501 983-1258 Passenger Gene Heavy Metal Resistance +
merA Tn501 1330-3015 Passenger Gene Heavy Metal Resistance +
merD Tn501 3033-3398 Passenger Gene Heavy Metal Resistance +
merE Tn501 3395-3631 Passenger Gene Heavy Metal Resistance +
urfM Tn501 3628-4617 Passenger Gene Other +
tnpR Tn501 4792-5352 Accessory Gene Resolvase +
tnpA Tn501 5356-8322 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn501 435 114-548 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLLEPDKPY GSIRRYGEAD VTRVRFVKSA QRLGFSLDEI AELLRLEDGT HCEEASSLAE HKLKDVREKM
ADLARMEAVL SELVCACHAR RGNVSCPLIA SLQGGASLAG SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn501 351 620-970 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPKTGRGA LFTGGLAAIL ASACCLGPLV LIALGFSGAW IGNLAVLEPY RPIFIGVALV ALFFAWRRIY RQAAACKPGE VCAIPQVRAT YKLIFWIVAA
LVLVALGFPY VMPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn501 276 983-1258 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFASLAL AAVVAPVWAA TQTVTLSVPG MTCSACPITV KKAISEVEGV SKVDVTFETR QAVVTFDDAK TSVQKLTKAT ADAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn501 1686 1330-3015 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MTHLKITGMT CDSCAAHVKE ALEKVPGVQS ALVSYPKGTA QLAIVPGTSP DALTAAVAGL GYKATLADAP LADNRVGLLD KVRGWMAAAE KHSGNEPPVQ
VAVIGSGGAA MAAALKAVEQ GAQVTLIERG TIGGTCVNVG CVPSKIMIRA AHIAHLRRES PFDGGIAATV PTIDRSKLLA QQQARVDELR HAKYEGILGG
NPAITVVHGE ARFKDDQSLT VRLNEGGERV VMFDRCLVAT GASPAVPPIP GLKESPYWTS TEALASDTIP ERLAVIGSSV VALELAQAFA RLGSKVTVLA
RNTLFFREDP AIGEAVTAAF RAEGIEVLEH TQASQVAHMD GEFVLTTTHG ELRADKLLVA TGRTPNTRSL ALDAAGVTVN AQGAIVIDQG MRTSNPNIYA
AGDCTDQPQF VYVAAAAGTR AAINMTGGDA ALDLTAMPAV VFTDPQVATV GYSEAEAHHD GIETDSRTLT LDNVPRALAN FDTRGFIKLV IEEGSHRLIG
VQAVAPEAGE LIQTAALAIR NRMTVQELAD QLFPYLTMVE GLKLAAQTFN KDVKQLSCCA G

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn501 366 3033-3398 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MNAYPVSRLA LDAGVSVHIV RDYLLRGLLR PVACTPGGYG LFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGDE AAAQLALLRQ FVERRREALA
DLEVQLATLP TEPAQHAESL P

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn501 237 3395-3631 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MNNPERLPSE THKPITGYLW GGLAVLTCPC HLPILAVVLA GTTAGAFLGE HWVIAALGLT GLFLLSLSRA LRAFRERE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM UrfM Tn501 990 3628-4617 +
Class:   Passenger Gene
Sub Class:   Other
Function:   possible diguanylate phosphodiesterase
Sequence Family:  EAL (Pfam:PF00563)||DUF3330 (Pfam:PF11809)
Comment:   similar to UrfM from E.coli
Protein Sequence:  
MSAFRPDGWT TPELAQAVER GQLELHYQPV VDLRSGGIVG AEALLRWRHP TLGLLPPGQF LPVVESSGLM PEIGAWVLGE ACRQMRDWRM LAWRPFRLAV
NASASQVGPD FDGWVKGVLA DAELPAEYLE IELTESVAFG DPAIFPALDA LRQIGVRFAA DDFGTGYSCL QHLKCCPIST LKIDQSFVAG LANDRRDQTI
VHTVIQLAHG LGMDVVAEGV ETSASLDLLR QADCDTGQGF LFAKPMPAAA FAVFVSQWRG ATMNASDSTT TSCCVCCKEI PLDAAFTPEG AEYVEHFCGL
ECYQRFEARA KTGNETDADP NACDSLPSD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn501 561 4792-5352 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MQGHRIGYVR VSSFDQNPER QLEQTQVSKV FTDKASGKDT QRPQLEALLS FVREGDTVVV HSMDRLARNL DDLRRLVQKL TQRGVRIEFL KEGLVFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI TLAKQRGAYR GRKKALSDEQ AATLRQRATA GEPKAQLARE FNISRETLYQ YLRTDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn501 2967 5356-8322 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRLILSAT ERGTLLALPE SQDDLIRYYT FNDSDLSLIR QRRGDANRLG FAVQLCLLRY PGYALGTDSE LPEPVILWVA KQVQTDPASW TKYGERDVTR
REHAQELRTY LQLAPFGLSD FRALVRELTE LAQQTDKGLL LAGQALESLR QKRRILPALS VIDRACSEAI ARANRRVYRA LVEPLTDSHR AKLDELLKLK
AGSSITWLTW LRQAPLKPNS RHMLEHIERL KTFQLVDLPE VLGRHIHQNR LLKLAREGGQ MTPKDLGKFE PQRRYATLAA VVLESTATVI DELVDLHDRI
LVKLFSGAKH KHQQQFQKQG KAINDKVRLY SKIGQALLEA KEAGSDPYAA IEAVIPWDEF TESVSEAELL ARPEGFDHLH LVGENFATLR RYTPALLEVL
ELRAAPAAQG VLAAVQTLRE MNADNLRKVP ADAPTAFIKP RWKPLVITPE GLDRRFYEIC ALSELKNALR SGDIWVKGSR QFRDFDDYLL PAEKFAALKR
EQALPLAINP NSDQYLEERL QLLDEQLATV ARLAKDNELP DAILTESGLK ITPLDAAVPD RAQALIDQTS QLLPRIKITE LLMDVDDWTG FSRHFTHLKD
GAEAKDRTLL LSAILGDAIN LGLTKMAESS PGLTYAKLSW LQAWHIRDET YSAALAELVN HQYQHAFAAH WGDGTTSSSD GQRFRAGGRG ESTGHVNPKY
GSEPGRLFYT HISDQYAPFS TRVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG ETKLYVPQGV QTYPTLRPLI
GGTLNIKHVR AHWDDILRLA SSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNSLAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERATQGLVEA GKPVDGELLQ FLSPLGWEHI NLTGDYVWRQ SRRLEDGKFR PLRMPGKP

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IR Tn501 81-118 GGGGTCGTCT CAGAAAACGG AAAATAAAGC ACGCTAAG

 References     

1.Diver WP, Grinsted J, Fritzinger DC, Brown NL, Altenbuchner J, Rogowsky P, Schmitt R. DNA sequences of and complementation by the tnpR genes of Tn21, Tn501 and Tn1721. Mol Gen Genet. 1983;191(2):189-93. PubMed ID: 6312271
2.Brown NL, Ford SJ, Pridmore RD, Fritzinger DC. Nucleotide sequence of a gene from the Pseudomonas transposon Tn501 encoding mercuric reductase. Biochemistry. 1983 Aug 16;22(17):4089-95. doi: 10.1021/bi00286a015. PubMed ID: 6311258
3.Misra TK, Brown NL, Fritzinger DC, Pridmore RD, Barnes WM, Haberstroh L, Silver S. Mercuric ion-resistance operons of plasmid R100 and transposon Tn501: the beginning of the operon including the regulatory region and the first two structural genes. Proc Natl Acad Sci U S A. 1984 Oct;81(19):5975-9. doi: 10.1073/pnas.81.19.5975. PubMed ID: 6091128
4.Brown NL, Winnie JN, Fritzinger D, Pridmore RD. The nucleotide sequence of the tnpA gene completes the sequence of the Pseudomonas transposon Tn501. Nucleic Acids Res. 1985 Aug 12;13(15):5657-69. doi: 10.1093/nar/13.15.5657. PubMed ID: 2994007
5.Brown NL, Misra TK, Winnie JN, Schmidt A, Seiff M, Silver S. The nucleotide sequence of the mercuric resistance operons of plasmid R100 and transposon Tn501: further evidence for mer genes which enhance the activity of the mercuric ion detoxification system. Mol Gen Genet. 1986 Jan;202(1):143-51. doi: 10.1007/BF00330531. PubMed ID: 3007931