Transposon
Name: Tn4662a
Family: Tn3        Group: Tn3000
Evidence of Transposition: no
 Host     

Host Organism:Pseudomonas putida HS Molecular Source:plasmid pDK1
Place of Origin:St.Paul Minnesota, U.S.A. Date of Isolation:2018
Other Geographic Information:soil 1981 2010

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGATGTAAGCCGGAACCCCAGAAATTTCCGTCACCC
IRR (Length: 38 bp)GGGGTTGTACGCCGGAATCCCAGAAATTTCCGTCAGCC

 Sequence     
DNA SequenceLength  7200 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGATGTAA GCCGGAACCC CAGAAATTTC CGTCACCCTA GTTGGGTGGG CTCAACACTC GTGTCACCAG CTACCTTCTG GAGAATCGAG CTCGGCCATC 100
CCTCCCTGGA CGGGCATCGC TCGACGATGT TCAACGGCTC CCTCACGGGG CCGTCGTTTT GTGGGGGCTA TTCCATCCAC AAGTCGTCGA GGTTCTTGAA 200
GTTCCAGAGC GTCGGGTCTT CGGGGCCAGT GATACTGTCC TTGCAACTCG TGGCCGCCAG GTCGATGGTC TGCATCGGGA TCGGCTCTCT CGAGCGTAGC 300
GAGAAGAACA CGCGAACCTT GGGAGTCAGC AGTGATTCCA TTCCCGGCTC AACGACAACG GCCAGACGCT GAGAGGACAG GCGAACCAAG GAGCCGACGG 400
GGTAGATGCC CACGGCCTTG ACGAAGGCGT GGAAGATGCG TTTGTCGAAA TGGCCCTCCC ACTTGGCCAT CTGCCGCATC GCCGCGGACG GGTCCCACGG 500
CTTTTTGTAG GCTCGCTCCG ACGTCACGGC ATCATAGACG TCGCAGATTG CGCCCATGCG GGCCAGGAGT GAAATGGCGT CACCGGCCAA GCGATCCGGG 600
TAGCCGGTTC CGTCGATCTT CTCGTGATGG TGCAGGGCAA TGTCCACCAC CCCGGGCTCG GCCCCGCCTG CGCGCAGCAT CTTTGCGCCC TCCACAGGGT 700
GGCGCTTCAT GATGGCGAAC TCGGCATCGG TGAGCTTGCC TGGTTTGTTA AGCACTTCCA GCGGCATCGC GGCCTTGCCT AGGTCGTGCA TCAGTCCGCC 800
GATGCCAGCC AGGCGCGTTT GCTCCTCGTC TAGATCGAGA TGCCGGGCCA GCGATAGCAT CAGGGCGCAG ACGGCAACCG AGTGCAGGTA GGTGTAATCG 900
TCGTGCGTTT TGATGCGTGC GACGCTGATG AGGGCATGAG GTTGGCGCAG CACCGAGGCA GCGATTTCTC CGACCAGCGG CAACGTCGTG CTTGGGTCGA 1000
CGGCCTTGCC AAGCCGGGCT TCCTGGAACA TGTCCATGAC TTGGGACTTG GCCGCAAGAC AGAGTTTCCG TGCATAACAC ATTTCGCTCT CCATTGAGGT 1100
TGCGCCGTCA CTTTTCTTGC TTAGTGGACT AGACGGCAGA GATTGCTCCT CCGACAATTC TCTGGGCTCT GGGCTCTGGG CTCTGGGCTC TGGGCTCTGG 1200
GCTCTGGGCT CTGGGCTCTC TGGGCTCTCT GGGCTCTCTG GGCTCTCTGG GCTCTCTGGG CTCTCTGGGC TCTCTGGGCT CTCTGGGTCG ACTTGGCTTT 1300
TGGCCAAGTC GACCCAGACC TCCCCGACGC CACATTCTCG AATGGCAGAG AGATCCTGAG GCTCGGTCAG CAGGAAGCTG CCGCGCCAGA ATGGGTGTCG 1400
AACCCAAGAG CCGGCGAGCT TGTGGATGTA CATGCCGAGA CGAAGCTCGG ATACGGGAAT GCGTTTTACC AACTTATTTT CCTTTCTGAG TTGGGTGGTT 1500
AGGCGTGCGC CGAGGCTGGC ACCCAGCGGT AGAGCGGAGG TAAGGTCACG CCAAGATTCT TGGATCAGCC GGAACCGCCG AAATTTCCGT CAGCCGATCA 1600
ACATGGCTTT GTCTCGCGCT CGGTCGATGC GTTCCTGCAT CGCCTGCATG ACTTCTTCGT GGGTGTACGA CTTGGCGTTG GGGTCGTCGG CCTCTCGGAG 1700
AGCTTCCTCG ACCTCGCGGG TCATCCGCGC ATATTCTTCC GGCCACAGCG CTTGCTCCAT GCGCAGCGAC GCCTGCCCAA GCAGGTGCAG CAGGCCGAAC 1800
AGCCGCATGT CATTGGTGGC GACGACGTGC TCTCGAATCC GCTCCTGGAT CACCTCGCAG GCCCGATGCG CCTCTGGCGT CGCCGTGCCC TCGTAGCCGG 1900
CTGGGAGTTC TGCTTCTTCA GCGATTCGCG CCCAAGCGAT AGCCAGCGCC TCGATGGTGG ACAGGTTCAT TTGCTCATCC ACTTGCGCAG CAGACGCTTT 2000
TTCAGGGAGG CGCGCTCTTG CGGATTGCGT CCCTTGTGGT TGGCAATGCG ATCCGCCGTG GCGGCCTGGC GCTTGATGGG CCAGTAGGAG CGGCCATCCT 2100
TACCCATCGA CCAGACGTTG CTGACCTGGT TTTCCAGTAG AGGCAGATGG GCGCATAGAG CTTCCGGCGA CGCGCTGGCC AGCGCGGTGC GCTCGTGGGT 2200
TCGCCAGCGC TGATGCCAGA GTTTCTTGTC CTCGCGCTCG CTACGGCAGG TCGTGTGCCC AACGATGGGC GTTTTGCGGC GGCTGCGGCT CATGATGTGG 2300
TTGTCTCCAA GAACATTCAG GACAGGCTTT CTGGGTAGAG CGCCGTCAAC CGGGACAGGG TTTCTTGCAC TTGTTCCAGC GAGGTCATCA GATGATCAAC 2400
CTGATCCTGA AGATCCACGG CGAGATCAAA TAGCTCAGCC ACTCGGCTGC GTGATCTCTC GTTGAACGCG GCCATTGCCA GTTGATGCAG CTTCAACAGG 2500
TCGGTGCGCA GTTGCGGAGG TGCGCCGTCT GCGCTGTCAT TCAAATCGCC GCGCAGCACG TCCACGGCAT CGACTGCACG CAGCAGTGCC GTGGTATCGA 2600
AATTCTCGGG AGTCAGTTCG TCCCATTCGT CGTCGGTGAT GCGGGCTGCC ATCAGGAGGG CTCCGATTAA GCGGTTGCGA GCGTTAGATG CCCGATCGGC 2700
TCGGCTGCTG GCCGTACCTT GATTTCGATG TCGTAGCCGA GGCGATTCAG ACAATCCATC AGCTTGCGTT CGGATAGATT GGTGAAGTCG CCGCGCATCA 2800
TGCCCGACAC CTTCGGTTGC GGGATGCCCA TGCGTTTGGC CGCCGCTTGT TGAGTCAGCC CAAGGGCGCG CATGGCCCTC CTGATCTCGA CCACCAGGCC 2900
GGTCTTGATC TTGAGCTTTT CAGCGTCAGG CAGTCCAAGG TCGGCAAAGA CGTTGCCCGA GCTGCGCTGA ACCTCGACGC CTTCAATGAT TCGTTTTTGC 3000
ATTTCGTAGC TCCTGTGCCA ATACCTCGGC CACCTTCAGC CGAGCGCGGA TGATGTCCAT GTCGGCCTTT GGCGTGGCGA TTCCGCTCTT GCTCTTCTTC 3100
TGGAAGCAGT GCAGGACGAA CACCGCTTCC GCAAACTTGA CCGTGTATAC CGCTCGATAG GTGCCGCCGG CATCGTCTTC GACGACCTCC AGCACGCCGG 3200
CACCACCGAA CCCCTTGAGC ACCTTTGCTG CGTCATCCTG ATCGCCTATC TGCGCCAACG AGAGCGCGTA ACCGAAACGG CGACGCACGT CGGACGGCAA 3300
CGCCATCAAA TCCTTGTGGC TGCTCGCGAT CCATTCGAGC GGTTTTTCTT TGTTTGTCAT GACGGAATTT TATACCTGTT CAGGTAATGA TGTAAACGCG 3400
GCAACCTCAA GGAGGTGTCG TAAAACATTT GTTTTGCGAC AGGCTGTCAG CCGCCGCTGT GCTACCTGTG CAACCACCCC CTCAAAAATG TACGGAAAAC 3500
TCTATCGCTA TTCACTATTA TGCGGAAACC TGTTTTTGAT GGTTATCCGC CTATGTTGGT TGGCTACATG CGCGTGTCGT CGGACTCCGA CCGCCAGAGC 3600
ACGGACTTGC AGCGCGACGC GCTGCTCGCC GCCGGCGTCG ATCCGCGTCA CCTGTTTGAG GATCGTGCCT CTGGCGCGAA GGATGACCGT GCCGGCTTGG 3700
CGCGGGCGCT TGAGTTCGTT CGAGCCGGCG ATGTGCTGGT GGTGTGGAAA CTCGACCGGC TCGGTCGCTC GCTGTCGCAC CTGCTCGCCA TTGTGACTTC 3800
GCTCAAGGAC AAGCGGGTGG CGTTCCGCTC GCTGACAGAG AACCTGGACA CTACGACGCC CTCGGGCGAA TTCCTGTTCC AGGTGTTCGG TGCGCTCGCG 3900
CAGTACGAGC GCGCCTTGAT TCAGGAGCGC GTCGTCGCGG GCTTGGCCGC CGCACGCAAA CGCGGCCGGA TCGGCGGCCG GCCGCAGGCG ATCACTGGTG 4000
AGAAGCTGGA CGCCATCGTC GCCGCGCTCG ATGGCGGCAT GTCTAAGGCG GCGGTGTGCC GCAACTTCAA TGTCAAGCGC ACTACGTTGA TCGAAACATT 4100
GACGCGAGCA GGTTGGCGTG GTGCGGGAAG GACGGTCGAT GAGCAACAAG AATAAGCTAC TCACCGTCTT TTCTGACGCA GAGCAGGAAG CCTTGTACCG 4200
CCTACCGGAC TTCGACGATG CTCAGCGGCT GGAATACCTG GCGTTGGCCG AATCTGAACT GGCGTTCGCC AGCAGCCGGC CTAGCCTGCA GGCCCAAGTC 4300
TATTGCGTCT TGCAGATCGG CTACTTCAAG GCCAAGCATG CTTTCTTCCG CTTCGATTGG CATGAGGTCG AGGACGATTG CGCCTTCGTG CTGAGTCGCT 4400
ATTTCCACGG CGAAGCGTTC GAACGCAAGG CGATCACCAA GCATGAGCAC TACAGCCAGA GGGGTCAGAT CGCCGAACTG TTCGGCTACC GGTCGTGGGC 4500
GGCTAGCTTC CTGCCGCAAC TGGCACAGCA GGCTGAACAG ATCGTGCGGC GCGACGTAAT GCCAGGATTC GTGGCCGCCG AACTGATCGT TTGGCTCAGC 4600
GAGCACAAAA TCATCCGGCC CGGCCACACC ACCTTACAAG AGCTGGTCAG TGAAGCCCTG TCCACCGAAC GCAGGCGCTT GGGCGGCTTG CTGGCAGAAG 4700
TGTTGGACGA ATCGGCCAAA GCTGCGCTGG GCCAGCTCCT GGTGCGTGAC GACACCCTGT CTCAACTGGC AGCGCTCAAG CAGGACGCTA AAGATTTCGG 4800
CTGGCGTCAG ATGGCAGGGG AGCGCGAGAA GCGCGCCACG CTGAAGTCCT TGCACGGGAT CGCCAAGGCG CTGCTGCCCA AGCTCGGCAT CTCGCAGCAG 4900
AACCTGCTGT ACTACGCGAG CCTGGCGAAC TTCTATACCG TCCATGACCT GCGCCACCTG AAGGCGGAGC AGACCCGGCT CTACCTGCTG TGCTATGCCT 5000
GGGTACGTTA CCGGCAGCTC ACCGACAACC TGGTCGACGC GATGGCCTTC CACATGAAAA AACTTGAGGA CGAGAGCCGC ACGGGTGCGA AACAGTCCTT 5100
TGTCGCCGAA CAGCTGCGAC GCCATCAGGA AACGCCGCAG GTTGGCCGCC TGCTGTCGCT GTACGTGGAC GACAGCGTGG CCGATCCGAC GCCGTTCGGC 5200
GAGGTGCGCC AACGCGCCTA CAAAATCATG TCCAGGGAAT TGCTGCAAAA CACGGCGCAG CGCATGAGCG TCAAGCCACT GAACAAACTG GCGCTGCACT 5300
GGCAGGCGGT GGACGGCCTG GCCGAACGCA TTCGACGCCA TCTACGGCCG CTGTACGTCG CGCTCGACTT CGCCGGCACG GCCCCCGATA ACCCATGGCT 5400
CGCGGCGCTG ACTTGGGCCA AGAGCGTGTT CGCCAAGCAG CAGCGCCTAT CACAACGGCC ACTCGACGAA TGTCCGGCGG CAACGCTGCC GAAACGCTTG 5500
CGTCCGTACC TGCTGATGTT CGATGCCGAA GGCACGCCGA CAGGCCTGCA TGCCGATCGT TACGAATTCT GGCTTTACCG TCAGGTCAGG AAACGCTTCC 5600
AGGCGGGCGA GCTCTACATT GACGATAGCT TGCAGCACCG GCATTTGTCC GACGAGTTGG TTTCGATGGA CGAGAAAGCC GCCGTGCTCG CGCAGATGGA 5700
CATCCCCTTC CTGCGGCAGC CGGTCAGTGC CCAGCTCGAT GCACTGGCGG CCGAGTTGCG TGCGCAATGG GTGGCGTTCA ATCGCGAGCT GAAACAGGGC 5800
AAGCTGACGC ACCTGGAATA CGACAAGGAC ACGCAGAGAC TGACCTGGCG CAAGCCCAAG GGGGAGAACC AGAAGGCGCG CGAGCAAGCT CTCTACGAGC 5900
AACTGCCATA CTGCGATGTC GCCGACGTGT TTCGCTTCGT CAACGGCCAG TGCCAGTTCC TGTCGGCGCT GACACCATTG CAGCCACGCT ATGCGAAGAA 6000
GGTAGCCGAC GCCGACAGTC TGATGGCGGT GATCATTGCC CAAGCCATGA ACCACGGCAA CCAGGTTATG GCACGTACCA GCGACATCCC GTACCACGTC 6100
CTGGAGAGTA CCTACCAGCA GTACCTGCGC CAGGCGACGC TACATGTGGC CAACGATTGC ATCAGCAACG CCATCGCCGC ACTGCCGATC TTCCCGCATT 6200
ACTCGTTCGA CCTCGATTCG TTGTACGGTG CCGTTGATGG GCAGAAATTC GGCGTCGAGC GACCAACTGT GAAGGCGCGC TACTCGCGCA AATATTTCGG 6300
CCGCGGCAAG GGCGTCGTCG CCTACACGCT GCTGTGCAAT CACGTGCCGT TGAACGGCTA CCTGATAGGC GCACACGAGT ACGAGGCTCA CCACGTGTTC 6400
GACATCTGGT ACCGCAACAC GTCGGACATC GTGCCGAGCG CGATCACCGG CGACATGCAC AGCATCAACA AGGCCAACTT CGCCATCCTG CACTGGTTCG 6500
GACTTCGTTT CGAGCCGCGC TTCACCGACC TCGACGACCA GTTGCAGGAG CTGTATTGCG CCGATGATCT GGCATTGTAC GAGAAATGCC TGATCCGGCC 6600
GGCTGGCCAG ATCGACCGGC AACTCATCGT CGGTGAGAAG GCGAACATCG ACCGAATCGT CGCCACACTG GGCCTGAAGG AAATGACGCA GGGCACGCTG 6700
ATCCGCAAGC TGTGCACCTA TACGGCGCCG AACCCGACGC GGCGCGCAAT CTTCGAGTTC GACAAGCTCA TCCGCAGTAT CTACACACTG CGCTACCTGC 6800
GCGACCCGCA ACTGGAGCGT AATGTTCACC GCTCGCAGAA CCGCATTGAG TCCTATCACC AGCTACGCTC GACCATCGCC CAAGTCGGTG GGAAGAAGGA 6900
ATTGACCGGC CGCACCGACA TCGAAATCGA GATCAGCAAC CAGTGCGCCA GGCTGATCGG CAACGCGATC ATCTTCTACA ACTCGGCGAT CCTGTCCCTG 7000
CTGCTGACGA AGTACGAGGC AGCTGGCAAT GCCAAGGCGC TGGCGTTGAT CACGCAGATG TCGCCAGCGG CCTGGCGGCA CATCCTGCTG AACGGGCATT 7100
ACACCTTCCA GACTGACGGC AAGTTCATCG ACCTGGATGC GCTCGTGGCG GGACTGGAGC TGGGCTGACG GAAATTTCTG GGATTCCGGC GTACAACCCC 7200

 Recombination Sites     

Name Coordinates Gene Sequence
res 3376-3506 131 CTGTTCAGGT AATGATGTAA ACGCGGCAAC CTCAAGGAGG TGTCGTAAAA CATTTGTTTT
GCGACAGGCT GTCAGCCGCC GCTGTGCTAC CTGTGCAACC ACCCCCTCAA AAATGTACGG
AAAACTCTAT C
res_site_I 3376-3405 30 CTGTTCAGGT AATGATGTAA ACGCGGCAAC
res_site_II 3413-3443 31 AGGTGTCGTA AAACATTTGT TTTGCGACAG G
res_site_III 3482-3506 25 TCAAAAATGT ACGGAAAACT CTATC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
rpfG Tn4662a 168-1472 Passenger Gene Other -
pDK1_p018 Tn4662a 1590-1982 Passenger Gene Hypothetical -
pDK1_p017 Tn4662a 1967-2293 Passenger Gene Hypothetical -
WP_000741275.1 Tn4662a 2350-2652 Passenger Gene Hypothetical -
HTH_37 Tn4662a 2667-3002 Passenger Gene Antitoxin -
Gp49 Tn4662a 2983-3360 Passenger Gene Toxin -
tnpR Tn4662a 3520-4155 Accessory Gene Resolvase +
tnpA Tn4662a 4139-7168 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
rpfG RpfG Tn4662a 1305 168-1472 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   metal dependent phosphohydrolase with conserved HD motif
Protein Sequence:  
MVKRIPVSEL RLGMYIHKLA GSWVRHPFWR GSFLLTEPQD LSAIRECGVG EVWVDLAKSQ VDPESPESPE SPESPESPES PESPESPEPR AQSPEPRAQS
PEPRELSEEQ SLPSSPLSKK SDGATSMESE MCYARKLCLA AKSQVMDMFQ EARLGKAVDP STTLPLVGEI AASVLRQPHA LISVARIKTH DDYTYLHSVA
VCALMLSLAR HLDLDEEQTR LAGIGGLMHD LGKAAMPLEV LNKPGKLTDA EFAIMKRHPV EGAKMLRAGG AEPGVVDIAL HHHEKIDGTG YPDRLAGDAI
SLLARMGAIC DVYDAVTSER AYKKPWDPSA AMRQMAKWEG HFDKRIFHAF VKAVGIYPVG SLVRLSSQRL AVVVEPGMES LLTPKVRVFF SLRSREPIPM
QTIDLAATSC KDSITGPEDP TLWNFKNLDD LWME

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
pDK1_p018 PDK1_p018 Tn4662a 393 1590-1982 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MDEQMNLSTI EALAIAWARI AEEAELPAGY EGTATPEAHR ACEVIQERIR EHVVATNDMR LFGLLHLLGQ ASLRMEQALW PEEYARMTRE VEEALREADD
PNAKSYTHEE VMQAMQERID RARDKAMLIG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
pDK1_p017 PDK1_p017 Tn4662a 327 1967-2293 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MSRSRRKTPI VGHTTCRSER EDKKLWHQRW RTHERTALAS ASPEALCAHL PLLENQVSNV WSMGKDGRSY WPIKRQAATA DRIANHKGRN PQERASLKKR
LLRKWMSK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
WP_000741275.1 WP_000741275.1 Tn4662a 303 2350-2652 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Protein Sequence:  
MAARITDDEW DELTPENFDT TALLRAVDAV DVLRGDLNDS ADGAPPQLRT DLLKLHQLAM AAFNERSRSR VAELFDLAVD LQDQVDHLMT SLEQVQETLS
R

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
HTH_37 HTH_37 Tn4662a 336 2667-3002 -
Class:   Passenger Gene
Sub Class:   Antitoxin
Sequence Family:  HTH_37 (Pfam:PF13744)
Protein Sequence:  
MQKRIIEGVE VQRSSGNVFA DLGLPDAEKL KIKTGLVVEI RRAMRALGLT QQAAAKRMGI PQPKVSGMMR GDFTNLSERK LMDCLNRLGY DIEIKVRPAA
EPIGHLTLAT A

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
Gp49 Gp49 Tn4662a 378 2983-3360 -
Class:   Passenger Gene
Sub Class:   Toxin
Target:   ribosome associated mRNA
Sequence Family:  Gp49 (Pfam:PF05973)
Protein Sequence:  
MTNKEKPLEW IASSHKDLMA LPSDVRRRFG YALSLAQIGD QDDAAKVLKG FGGAGVLEVV EDDAGGTYRA VYTVKFAEAV FVLHCFQKKS KSGIATPKAD
MDIIRARLKV AEVLAQELRN AKTNH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn4662a 636 3520-4155 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MRKPVFDGYP PMLVGYMRVS SDSDRQSTDL QRDALLAAGV DPRHLFEDRA SGAKDDRAGL ARALEFVRAG DVLVVWKLDR LGRSLSHLLA IVTSLKDKRV
AFRSLTENLD TTTPSGEFLF QVFGALAQYE RALIQERVVA GLAAARKRGR IGGRPQAITG EKLDAIVAAL DGGMSKAAVC RNFNVKRTTL IETLTRAGWR
GAGRTVDEQQ E

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn4662a 3030 4139-7168 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MSNKNKLLTV FSDAEQEALY RLPDFDDAQR LEYLALAESE LAFASSRPSL QAQVYCVLQI GYFKAKHAFF RFDWHEVEDD CAFVLSRYFH GEAFERKAIT
KHEHYSQRGQ IAELFGYRSW AASFLPQLAQ QAEQIVRRDV MPGFVAAELI VWLSEHKIIR PGHTTLQELV SEALSTERRR LGGLLAEVLD ESAKAALGQL
LVRDDTLSQL AALKQDAKDF GWRQMAGERE KRATLKSLHG IAKALLPKLG ISQQNLLYYA SLANFYTVHD LRHLKAEQTR LYLLCYAWVR YRQLTDNLVD
AMAFHMKKLE DESRTGAKQS FVAEQLRRHQ ETPQVGRLLS LYVDDSVADP TPFGEVRQRA YKIMSRELLQ NTAQRMSVKP LNKLALHWQA VDGLAERIRR
HLRPLYVALD FAGTAPDNPW LAALTWAKSV FAKQQRLSQR PLDECPAATL PKRLRPYLLM FDAEGTPTGL HADRYEFWLY RQVRKRFQAG ELYIDDSLQH
RHLSDELVSM DEKAAVLAQM DIPFLRQPVS AQLDALAAEL RAQWVAFNRE LKQGKLTHLE YDKDTQRLTW RKPKGENQKA REQALYEQLP YCDVADVFRF
VNGQCQFLSA LTPLQPRYAK KVADADSLMA VIIAQAMNHG NQVMARTSDI PYHVLESTYQ QYLRQATLHV ANDCISNAIA ALPIFPHYSF DLDSLYGAVD
GQKFGVERPT VKARYSRKYF GRGKGVVAYT LLCNHVPLNG YLIGAHEYEA HHVFDIWYRN TSDIVPSAIT GDMHSINKAN FAILHWFGLR FEPRFTDLDD
QLQELYCADD LALYEKCLIR PAGQIDRQLI VGEKANIDRI VATLGLKEMT QGTLIRKLCT YTAPNPTRRA IFEFDKLIRS IYTLRYLRDP QLERNVHRSQ
NRIESYHQLR STIAQVGGKK ELTGRTDIEI EISNQCARLI GNAIIFYNSA ILSLLLTKYE AAGNAKALAL ITQMSPAAWR HILLNGHYTF QTDGKFIDLD
ALVAGLELG

 References     

1.Assinder SJ, de Marco P, Sayers JR, Shaw LE, Winson MK, Williams PA. Identical resolvases are encoded by Pseudomonas TOL plasmids pWW53 and pDK1. Nucleic Acids Res. 1992 Oct 25;20(20):5476. doi: 10.1093/nar/20.20.5476. PubMed ID: 1331988
2.Voss JA, Khedairy H, Baker RF, Benjamin RC. Molecular cloning of the xylL-xylE region from the P. putida TOL plasmid, pDK1. SAAS Bull Biochem Biotechnol. 1990 Jan;3:54-7. PubMed ID: 1366507
3.Shaw LE, Williams PA. Physical and functional mapping of two cointegrate plasmids derived from RP4 and TOL plasmid pDK1. J Gen Microbiol. 1988 Sep;134(9):2463-74. doi: 10.1099/00221287-134-9-2463. PubMed ID: 3076182