Transposon
Name: Tn4659
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Pseudomonas putida MT53 Molecular Source:plasmid pWW53
Date of Isolation:2001

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGCGCCTCAGAAAAGGGATTTTAAAGTACGCTAAG
IRR (Length: 38 bp)GGGGTCGCCTCAGAAAAGGGATTTCAAAGTACGCTAAG

 Sequence     
DNA SequenceLength  3747 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGCGCCT CAGAAAAGGG ATTTTAAAGT ACGCTAAGCA TGGGCGGGGC TGACAGCACG CGTCTGTCAG ATGAACTTAT GATGCCAGCA CTTTGTAGAC 100
CGTCGAGCGA CCAATCTTCA GTCGTTTGGC AATTTCCATC GCACTGATAC CCTGACCGTG GAGCGTGAAT ACCTCGGCTT TGTCCACCGT AGGTTTGCGG 200
CCAAACTTCA CGCCCTTGGC CTTTGCTTCC AAACGACCTT CGTTGGTCCG TTCCAGTATC CGCAGGCGTT CGGCCTGAGC CACGGCTGAC AGGATGGTCA 300
CCACCATTTT GCCCATGGTT CCCTCTGTGC TGATGCCGTC ATCCAAAAAT CGGATGGCCA CGCCCATGTC GTCGAACTCC TTAATGAGCT GGATCATGTC 400
CGCGGTATCG CGACCGAGCC GGTCGAGTTT TTTTACCAGG ACCACATCAC CTTCTTCGAC CTTGAGCCGG AGCATCCTTA GGCCTTCGCG GTTCACGTGA 500
CTGCCAGATA CCTTGTCGGT AAAAATTCGG GTTGCTCTGA CGTTTTCAGC CTTGAGCGCC TTTATCTGTA CATCAAGGGA CTGTTGACTG GTGGAGACGC 600
GGGCATAACC AAAAAGTCGC ATGGCAAAAT GTCTCATAAG TCGATTTTTA GATCTTCCGT CTATGAAGTA GCGATAAACG AATTAATAGA CGTCTTGGGA 700
GGATCACTTT ACCGTGTCCA CAAACTTATG AGAAAGGAGA CTGTATGCCA CGTCGTTCGA TTCTTTCCGT CGCCGAGCGG GAAAGCTTAC TGGCGTTGCC 800
AGACTCCAAA GATGACCTGA TTCGTCACTA CTCTTTCAGC GACGCCGATC TGACCCTCAT TAGTCAACGG CGCGGGTCTG CGAATCGGCT GGGCTTCGCT 900
GTACAACTCT GTTACATGCG CTATCCCGGC GTAACGCTTG CGGTGGATGA AGAACCATTC GCGCCATTGC TGCGTTTGGT GGCCACGCAG TTGAAGGTGC 1000
CGCCTGAAGC ATGGGCGGAT TATGGGCAAC GCGCCGAGAC GCGTCGCGAG CACCTATTGG AATTACAAGC GCTTTTTGAC TTTAAGCCAT TCACAACACG 1100
GCATTATCGT CCCTGTGTTC ATAGCCTGGA TGAATTGGCA TGGCAGTCCG ATAAAGGCTT CGTGTTAGCG ACGGAATTGG TCAAAGGGTT ACGACAAAAA 1200
AACATACTGC TTCCATCACT AAGCGTCATC GAGCGCATTT GTGCTGAGGC AATCACCCGT GCCAACCGGC GCATTTACGA AACCTTGTCC GAGCCTCTTT 1300
CGAATACACA TCTCGGTTGC CTCGACGGCC TGCTCAAGCG CCGAGATAAA GGCCAGACCA CCTGGTTGGC CTGGCTTCGC CAGTCGCCGG TTAAACCGAA 1400
CTCGCGGCAC ATGCTTGAAC ATATCGAACG CCTAAAAGCA TGGCAGGCTC TTGATCTGCC TGCAGGCATT GAGCGGCTGG TTCACCAAAA CCGCCTGCTC 1500
AAAATCGCCC GTGAAGGTGG CCAAATGACA CCCGCTGACT TGGCTAAGTT CGAGCCGCAG CGGCGCTACG CCACCCTTGT GGCGCTGGTC ATCGAGGGTA 1600
TGGCCACCGT CACCGACGAA ATCATCGATC TGCACGATCG TATCTTGGGC AAGCTGTTTA ACGCAGCCAA GAATAAACAC CAGAAACAGT TCCAGGCATC 1700
CGGCAAAGCG ATCAACGCCA AGGTGCGCCT TTATGGACGC ATCGGCCAAG TCCTACTGGA TGCCAAGCAA AACGGTGGAG ATCCGTTTGC CGCCATCGAA 1800
GCTGTCATGT CCTGGGATGC TTTTGCCAAG AGCGTCACCG AAGCGCAAAA GCTCGCGCAG CCCGAAGACT TCGATTTCCT GCATCACATT GGTGATAGCT 1900
ACACCACGCT GCGCCGCTAT GCGCCGCAAT TTCTCGACGT ACTCAAACTG CGGGCTGCGC CCGCGGCCAA GGACGTGTTC GATGGTATTG AGGTGTTGCG 2000
CGCAATGAAC ATCAACAACG CCCGCAAGGT TCCCGTTGAT GCCCCGACCA GCTTCATCAA GAAACGCTGG AAGAAACTGG TGATAACTGA CGTCGGTATC 2100
GACCGACGCT ATTACGAGTT GTGCGCGCTG TCGGAACTGA AGAACGCGCT ACGTTCCGGC GATATCTGGG TGCAGGGATC GCGTCAATTC AAGGATTTTG 2200
AGGACTACCT GGTACCACCC GAAAAATTCG CCCGTCTCAA GCAGACCAGT GAATTACCAC TGGCCGTGGC CACCGACTGC GACAAGTACC TGCATGACCG 2300
TCTGACTCTG CTGGAAGCGC AGCTTGCCAT CGTCAACCGT ATGGCGTTAG CCAACGATCT TCCGGATGCC ATCATCACCG AGTCTGGCTT GAAGATCACT 2400
CCGCTGGATG CGGCAGTACC AGAGACCGCG CAAGCGCTGA TTGACCAAAC TGCGATGGCG CTGCCGCACA TCAAGATCAC CGAATTGTTG TTGGAGGTGG 2500
ACGAGTGGAC GGGGTTCACC CGGCACTTCG CGCACCTGAA ATCGGGCGAC GAAGCCAAAG ACAAGTACCT ACTGCTGTCC ACCCTCTTGG CCGATGCGAT 2600
CAATCTGGGC CTGACCAAGA TGGCCGAGTC TTGCCCTGGC ACTACCTACG CCAAACTGTC CTGGCTGCAA GCCTGGCATA TCCGTGACGA AACCTATTCG 2700
ACAGCACTGG CGGAGCTGGT AAACGCGCAG TTACGGCATC CCTTTGCCAC GCATTGGGGA GATGGCACCA CGTCCTCGTC AGACGGCCAG AATTTCAGGA 2800
CGGGAAACAA AGCCGAGAGC ACCGGTCACA TCAACCCGAA ATATGGCAGC AGCCCAGGGC GAACGTTCTA CACACATATT TCCGACCAAT ACGCGCCATT 2900
TCATATCAAG GTAGTCAACG TGGGACTGCG CGACTCGACC TATGTGCTAG ACGGCCTGCT GTATCACGAA GCCGACCTAC GCATTGAGGA ACACTACACC 3000
GACACAGCAG GTTTCACCGA TCACGTCTTT GGTCTGATGC ACCTGCTCGG CTTTCGCTTC GCACCGCGTA TCCGTGACCT GGGCGACACC AAGCTGTTCA 3100
TCCCCAAGGG CAATATGACT TATGACGGGC TTAAGTCGAT GATTAGCAAA GACAAGCTGG ATATCAAAGC CATTCGTACC CACTGGGATG AAATCCTGCG 3200
GCTAGCCACC TCGATCAAGC AGGGCACCGT AACAGCCTCG TTGATGCTCA GGAAACTCGG CAGCTATCCG CGTCAAAACG GCCTGGCCGT CGCCCTGCGC 3300
GAATTGGGGC GCATCGAGCG CACATTGTTT ATTTTAGATT GGTTGCAAAG CGTTGAGCTG CGCCGCCGCG TGAATGCTGG GCTGAACAAG GGCGAAGCGC 3400
GCAATGCGCT GGCCAGAGCT GTGTTCTTTA ATCGGTTGGG CGAAATCCGT GACCGCAGTT TCGAACAGCA ACGCTACCGG GCCAGCGGTC TCAACCTGGT 3500
GACCGCTGCC ATAGTGCTGT GGAACACCGT TTACCTCGAG CGGTCCGCCA ACGCATTGCA CGGACATGGT CACGCAGTCG ATGAATCGCT ATTGCAGTAC 3600
CTGTCGCCGC TGGGGTGGGA GCACATCAAC CTGACCGGTG ATTACCTGTG GCGCCGCAAC ACCAAGGTTG GTGCGGGAAA ATTCAGACCG TTACGACGAC 3700
TGCAATTGGC TTAGCGTACT TTGAAATCCC TTTTCTGAGG CGACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 623-744 122 GGCAAAATGT CTCATAAGTC GATTTTTAGA TCTTCCGTCT ATGAAGTAGC GATAAACGAA
TTAATAGACG TCTTGGGAGG ATCACTTTAC CGTGTCCACA AACTTATGAG AAAGGAGACT
GT

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnpR Tn4659 77-622 Accessory Gene Resolvase -
tnpA Tn4659 745-3714 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn4659 546 77-622 -
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MRLFGYARVS TSQQSLDVQI KALKAENVRA TRIFTDKVSG SHVNREGLRM LRLKVEEGDV VLVKKLDRLG RDTADMIQLI KEFDDMGVAI RFLDDGISTE
GTMGKMVVTI LSAVAQAERL RILERTNEGR LEAKAKGVKF GRKPTVDKAE VFTLHGQGIS AMEIAKRLKI GRSTVYKVLA S

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn4659 2970 745-3714 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRSILSVA ERESLLALPD SKDDLIRHYS FSDADLTLIS QRRGSANRLG FAVQLCYMRY PGVTLAVDEE PFAPLLRLVA TQLKVPPEAW ADYGQRAETR
REHLLELQAL FDFKPFTTRH YRPCVHSLDE LAWQSDKGFV LATELVKGLR QKNILLPSLS VIERICAEAI TRANRRIYET LSEPLSNTHL GCLDGLLKRR
DKGQTTWLAW LRQSPVKPNS RHMLEHIERL KAWQALDLPA GIERLVHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LVIEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQKQFQASG KAINAKVRLY GRIGQVLLDA KQNGGDPFAA IEAVMSWDAF AKSVTEAQKL AQPEDFDFLH HIGDSYTTLR RYAPQFLDVL
KLRAAPAAKD VFDGIEVLRA MNINNARKVP VDAPTSFIKK RWKKLVITDV GIDRRYYELC ALSELKNALR SGDIWVQGSR QFKDFEDYLV PPEKFARLKQ
TSELPLAVAT DCDKYLHDRL TLLEAQLAIV NRMALANDLP DAIITESGLK ITPLDAAVPE TAQALIDQTA MALPHIKITE LLLEVDEWTG FTRHFAHLKS
GDEAKDKYLL LSTLLADAIN LGLTKMAESC PGTTYAKLSW LQAWHIRDET YSTALAELVN AQLRHPFATH WGDGTTSSSD GQNFRTGNKA ESTGHINPKY
GSSPGRTFYT HISDQYAPFH IKVVNVGLRD STYVLDGLLY HEADLRIEEH YTDTAGFTDH VFGLMHLLGF RFAPRIRDLG DTKLFIPKGN MTYDGLKSMI
SKDKLDIKAI RTHWDEILRL ATSIKQGTVT ASLMLRKLGS YPRQNGLAVA LRELGRIERT LFILDWLQSV ELRRRVNAGL NKGEARNALA RAVFFNRLGE
IRDRSFEQQR YRASGLNLVT AAIVLWNTVY LERSANALHG HGHAVDESLL QYLSPLGWEH INLTGDYLWR RNTKVGAGKF RPLRRLQLA

 References     

1.Yano H, Garruto CE, Sota M, Ohtsubo Y, Nagata Y, Zylstra GJ, Williams PA, Tsuda M. Complete sequence determination combined with analysis of transposition/site-specific recombination events to explain genetic organization of IncP-7 TOL plasmid pWW53 and related mobile genetic elements. J Mol Biol. 2007 May 25;369(1):11-26. doi: 10.1016/j.jmb.2007.02.098. Epub 2007 Mar 14. PubMed ID: 17408691
2.Assinder SJ, de Marco P, Sayers JR, Shaw LE, Winson MK, Williams PA. Identical resolvases are encoded by Pseudomonas TOL plasmids pWW53 and pDK1. Nucleic Acids Res. 1992 Oct 25;20(20):5476. doi: 10.1093/nar/20.20.5476. PubMed ID: 1331988
3.Osborne DJ, Pickup RW, Williams PA. The presence of two complete homologous meta pathway operons on TOL plasmid pWW53. J Gen Microbiol. 1988 Nov;134(11):2965-75. doi: 10.1099/00221287-134-11-2965. PubMed ID: 3076178
4.Keil H, Keil S, Pickup RW, Williams PA. Evolutionary conservation of genes coding for meta pathway enzymes within TOL plasmids pWW0 and pWW53. J Bacteriol. 1985 Nov;164(2):887-95. doi: 10.1128/JB.164.2.887-895.1985. PubMed ID: 2997136