Transposon
Name: Tn4656
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Pseudomonas putida MT53 Molecular Source:plasmid pWW53
Date of Isolation:2001

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGAGCCCGCAGAATTCGGAAAATAACGTACGCTAAG
IRR (Length: 39 bp)GGGGAGCCTACAGAATTCGGAAAAAATCGTACGCTAAGG

 Sequence     
DNA SequenceLength  5699 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGAGCCCG CAGAATTCGG AAAATAACGT ACGCTAAGGA TGGCCTGAGA AAGTCCTTTC TCGGGAAAAA GAGCCCAGCA GCCGAGCGGG TTACAGCGCA 100
TCAATTCCGC GAAGCTGGGG CTTTTCAGAG TTTCCCTAAA GACGGAACAT GTGCATCAGA CGCTGAAGTT GGCTTGCCAG AGAAGCCAAT TGCGTACTGG 200
TGGCAACATT CTGACGTGAG GCTTCGCTAG TTTTTTCGGC AATCTGGCTT ACGTTGGTAA CGTTACGGCT GATCTCCTCC GCGACAGAGC TTTGCTCCTC 300
AGCTGCAGAA GCAATCATGG CATTCATGTC ATTAATGGTC GCCACAGCAT TACTGATTTG CTCCAGCATA TGGCCTGCAC TGGCAACCTG CTGCTTACCA 400
GCTTGTGCTT TGCTGCAACT GCTTTCCATG ACAGCAACAG CACGATTTGC GCCGCTCTGC AGCTTTTCAA TCATGGCCTG AATTTCGTTG GCTGACTGTT 500
GCGTGCGCGA AGCAAGCGAG CGCACCTCAT CCGCGACAAC AGCAAAGCCT CGTCCGTGCT CACCAGCATG TGCAGCTTCA ATAGCCGCGT TAAGGGCAAG 600
CAGGTTGGTT TGTTCGGTAA TGCTTCGAAT GACATCCACT ACAGAGCTAA TACCAGCACT GTCTGCCTCA AGCTCATGAA TCACAGTGGC AGCGTGTTCA 700
ACTTCACTGG CGAGGCTGTC AATAGAAGCG ATTGTTTGAT GAACCACGCG CATGCCGCTT TCAGACTGCT GATCGGCCTC CTGTGCCGCC CGTGCCGCAC 800
TGGCAGCGTT CCCCGCTACG TCCTGAACAG TAGCGGACAT TTCGTTCATC GCAGTAGCTA TCAGGTCTGT CTCCAGCTGC TGGCGGCGGA TACCGTCACT 900
GGTTTGACTA CTTGCCTGGG CCGTCTGCTC AGCTGCAGCT GCCAGTTGCT CCACGGCACC TGCCAACTCT TGAAAGGTGT GGTGAAAACG CGAAGCCATT 1000
TCATTGAATG CGCTAGATAT TTCGCCCAGC TCATCACGCC CCTGATAGGT AACTCGATAG CCCAAATTGC CATCAGCGAG CTGCTGACCG CCGACTTGAA 1100
GCTCCCGAAC GCCTTTGGTG ATACTTGGCA CAGTGGCCAG AGCCGTGACT GTGACCAGAG ACAGAGCCAC TACCAGCGCC AGTCCTATCA TCGCCACAAG 1200
ACGCTCGAAT TGCTTATCCG CGTTTTGAAA GCTTAATTCA GCTGCCGACG CCTCCGACTC AATAAGAGTG CGCAAGCTGG CATAGGTAGT CATAAAAGCA 1300
GGATCAAGGC GGGTTAGCAG GATTTGGTTC CCTCCCGCAT AGTCGCCTTG GCGCATCGCA TTGAGCGTCG GCAGAACACC ATTATCCAAG TAATCAGACA 1400
ATTTGTTCTG CAGCTCAGTG CTAAGGCGCT GCTGTTCTTT GCTCATTGGT ATACGCTGGT AGTCAGAAAG GCGCTCACGG ATGATGCTTA CGCTTTTATC 1500
CACTCTATCG AAATGCATAC TCGATGGATG ATCATGCGCC TTCTCGAAGG CACTTCCGGG CTCATGCTGA AGGGCAAGCA AAAGCTGAGC ACGCGCGTTG 1600
TGCATGTGGT TATTGATGTC GCCAAGCTTG TCGATCGGTA GCAACATGTT GTTGTACAGC CGATCAATCA CTGCATTGCT GGTGCGCATT CCATTAAGAC 1700
CAGCCATTGG CAAGCCGACA GCCATAGATG CTAGAAGCAC GAGCAAGCCG ATGAGACGGG TTTTTATTGA GAAACGGGCT AGCCAACCAC TCATCGTGTC 1800
ACCTCATTAT TAGATATTTC AATGTGCCTT CATTGTATCG GCTGGTTCAT TTGAAATCTT GAGTCAGGCT CCCCCTCAAG GCTTCTCGCC ATATGGTCTG 1900
GGGCAATATT AGTACTCAGA TCAAAAACAA GACATAAAGG CCGTCAGGTT GGGCTATACC CTAACTGGAT GTCAGGAAAG GCCGCGCCAC GCCGTCAGAA 2000
TAGAGTCGCC TTTTGCATTC TTTGACACCT GCTTGCCAAG GTCATAGATT TTAGCCTGAC AAATTCACGG CTTAGGGCGC AATGGAACCA AAAACCAACG 2100
TAAGCCCTGC CGCCCATCCT GCCCATGGAG GCATCTTGCA GGGACAACGC ATCGGTTACG TCCGGGTCAG CAGTTACGAC CAGAACCCGG AACGCCAACT 2200
TGAGCAGGTC GAGGTCGGCA AGCTGTTCAC CGACAAAGCC TCGGGAAAGG ACACCCAGCG CCCCCAGCTG GAGGCCATGC TCGGCTTCGT CCGTGAGGGC 2300
GATACCGTGG TGGTGCACAG CATGGATCGC CTTGCCCGCA ACCTCGATGA CCTGCGCCGC CTGGTGCAAA AGCTGACCAA GCGCGGTGTG CGCATCGAGT 2400
TCTTGAAGGA AGGCTTGGTG TTCACCGGTG AGGACTCGCC CATGGCCAAC CTCATGTTGT CGGTCATGGG GGCCTTTGCC GAGTTCGAGC GCGCCCTGAT 2500
CCGCGAGAGG CAGCGCGAGG GTATCGCCCT GGCCAAGCAG CGCGGGGCCT ACCGGGGTCG TAAGAAGGCC CTTTCCGACG AACAGGCTGC TACCCTGCGG 2600
CAGCGAGCAG CAGCAGGCGA GCCCAAGGCG CAGCTCGCCC GCGAATTCAA CATCAGCCGA GAAACCCTCT ACCAGTACCT CCGCACGGAC GACTGATACA 2700
TGCCGCGTCG CTTGATCCTC TCGGCTACGG AGCGGGACAC CCTGCTTGCG TTGCCAGAAA GCCAGGATGA CCTGATCCGC TACTACACCT TCAACGACTC 2800
CGACCTGTCG CTGATCCGTC AGCGGCGCGG CGACGCCAAC CGGCTGGGCT TTGCGGTGCA GCTCAGCCTG TTGCGTTACC CCGGCTATGC GTTGGGCACC 2900
GACAGCGAGC TGCCAGAGCC AGTCATCCAG TGGGTGGCTA AGCAAGTTCA GGCCGATCCG GAGAGCTGGG CGAAGTACGG CGAGCGCGAC GTGACCCGTC 3000
GCGAGCATAC CCAGGAACTT CGCACCTACC TGCAACTGGC CCCGTTCGGA CTGTCGGACT TCCGCGCCCT GGTGCGCGAA TTGACCGAGC TGGCCCAGCA 3100
GACCGACAAG GGCTTGCTGC TGGCCGGTCA GGCGCTGGAG AGTTTGCGGC AGAAGCGGCG CATCCTGCCG GCGCTGAGCG TAATTGATCG AGCTTGTTCG 3200
GAGGCCATTG CGCGGGCCAA TCGGCGGGTC TATCGCGCCC TGGTCGAGCC GCTAACGGAC TCGCATCGGG CCAAGTTGGA CGAGCTGTTG AAGCTCAAGG 3300
CCGGCAGCAG CATCACCTGG TTGACCTGGC TGAGGCAGGC ACCGCTTAAG CCGAACTCTC GGCACATGCT CGAACACATC GAGCGGCTGA GGACATTTCA 3400
GCTGGTGGAT TTGCCCGAAG GCCTGGGCCG GCACATCCAC CAGAACCGCC TGCTCAAGCT GGCCCGCGAG GGCGGGCAGA TGACGCCCAA AGACCTCGGC 3500
AAGTTCGAGC CGCAGCGGCG CTACGCGACC CTGGCCGCCG TGGTGCTGGA GAGCACCGCG ACCGTGATTG ATGAGTTGGT CGATCTGCAC GACCGCATCC 3600
TGGTCAAGCT GTTCAGCAGC GCGAAACACA AGCATCAGCA GCAGTTCCAG AAGCAGGGCA AGGCGATCAA CGACAAGGTG CGCCTGTACT CCAAGATCGG 3700
CCAGGCGCTT CTGGAGGCCA AGGAAACCGG CAGCGATCCC TATGCCGCCA TCGAGGCGGT GATTCCTTGG GACGAGTTCA CCGAGAGCGT CAGCGAGGCT 3800
GAGCTACTGG CCCGACCGGA GGGCTTCGAT CATCTGCACC TAGTCGGCGA GAATTTCGCC ACCCTGCGCC GCTACACGCC GGCCTTGCTG GAGGTGCTGG 3900
AACTGCGCGC CGCGCCGGCC GCGCAAGGGG TACTGGCCGC TGTGCAGACC CTACGCGAAA TGAACGCCGA CAACCTGCGC AAGGTGCCAG CCGACGCACC 4000
CACAGCCTTC ATCAAGCCGC GCTGGAAGCC GCTGGTGATC ACCCCGGAAG GCCTCGACCG GCGTTTCTAT GAAATATGTG CGCTGTCCGA GCTGAAGAAC 4100
GCCCTGCGTT CCGGCGACAT CTGGGTCAAG GGCTCGCGGC AGTTTCGCGA CTTCGACGAC TACCTGCTGC CGGCAGAGAA GTTCGCCGCG CTTAAGCGCG 4200
AGCAGGCCCT GCCCCTGGCG ATCAACCCGA GCAGCGACCA GTACCTGGAA GAGCGTTTAC AGCTGCTGGA CGAGCAGTTG GCCACCGTCA CCCGGCTGGC 4300
CAAGGACAAC GAGCTGCCCG ATGCCATCCT CACCGAGTCC GGGCTGAAAA TCACCCCGCT GGATTCTGCG GTGCCCAACA CCGCGCAGGC GCTGATCGAC 4400
CAGACCAGTC AGCTGTTGCC GCGCATCAAG ATCACCGAAC TGCTGATGGA CGTGGACGAC TGGACGGGTT TCAGCCGCCA CTTCACCCAC CTGAAGGACG 4500
GTGCCGAGGC CAAAGACCGG ACATTGCTGC TGTCAGCAAT CCTGGGCGAT GCGATCAACC TCGGGCTGAC CAAGATGGCC GAGTCGAGCC CCGGCCTGAC 4600
CTACGCCAAG CTGTCCTGGC TGCAAGCCTG GCACATCCGC GACGAAACCT ACTCGGCGGC CCTGGCCGAG CTGGTCAACC ACCAGTACCG TCATACCTTC 4700
GCCGCTCACT GGGGCGACGG TACTACCTCT TCTTCCGATG GCCAGCGCTT CCGGGCGGGC GGCCGGGGCG AAAGCACCGG GCACGTCAAC CCGAAGTACG 4800
GCAGCGAGCC GGGGCGGCTG TTCTACACCC ATATCTCCGA CCAGTACGCG CCCTTCAGCA CCCGCGTGGT GAATGTCGGC GTGCGTGACT CCACCTATGT 4900
GCTCGACGGC CTGCTGTACC ACGAGTCCGA CTTGCGGATC GAGGAGCACT ACACCGACAC GGCCGGTTTC ACCGATCACG TCTTCGCCCT GATGCACCTG 5000
CTGGGCTTCC GCTTCGCACC GCGCATCCGC GACCTCGGCG AAACCAAGCT GTATGTTCCG AATAGCGTCC AGGACTACCC GACATTGCGC CCAATGGTTG 5100
GTGGCACCCT GAACATCAAG CACGTCCGCG CCCATTGGGA CGACATCCTG CGCCTGGCCA GCTCGATCAA GCAGGGCACG GTCACCGCCT CTCTGATGCT 5200
GCGCAAGCTC GGCAGCTATC CGCGCCAGAA CGGCCTGGCC GTGGCCCTGC GCGAGCTGGG CCGGATCGAG CGCACGCTGT TCATCCTCGA CTGGCTGCAA 5300
AGCGTCGAGC TGCGCCGCCG TGTACATGCA GGGCTGAACA AGGGTGAGGC GCGCAACTCC CTGGCCAGGG CGGTGTTCTT CAACCGCCTA GGCGAGATCA 5400
GGGATCGGAG TTTCGAACAG CAGCGCTACC GGGCCAGTGG CCTCAACTTG GTGACCGCCG CCATCGTGCT GTGGAACACG GTGTACCTGG AGCGCTCCAC 5500
CCAAGCAATG GGCGAGGCTG GAAAGCAGGT GAATGGCGAG TTGCTGCAAT ACCTGTCGCC GCTGGGCTGG GAGCACATCA ACCTGACTGG CGATTACGTC 5600
TGGCGGCAGA GCCGCAGGCT GGAGGACGGG AAGTTCAGGC CGCTACGGTT GCCCGGAAAA CCTTAGCGTA CGATTTTTTC CGAATTCTGT AGGCTCCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 1937-2065 129 AAGGCCGTCA GGTTGGGCTA TACCCTAACT GGATGTCAGG AAAGGCCGCG CCACGCCGTC
AGAATAGAGT CGCCTTTTGC ATTCTTTGAC ACCTGCTTGC CAAGGTCATA GATTTTAGCC
TGACAAATT
res_site_I 1938-1976 39 AGGCCGTCAG GTTGGGCTAT ACCCTAACTG GATGTCAGG
res_site_II 1989-2033 45 ACGCCGTCAG AATAGAGTCG CCTTTTGCAT TCTTTGACAC CTGCT
res_site_III 2038-2065 28 AAGGTCATAG ATTTTAGCCT GACAAATT

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
mcp Tn4656 136-1794 Passenger Gene Other -
tnpR Tn4656 2082-2696   Resolvase +
tnpA Tn4656 2700-5666 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
mcp Mcp Tn4656 1659 136-1794 -
Class:   Passenger Gene
Sub Class:   Other
Function:   methyl-accepting chemotaxis protein
Sequence Family:  Methyl-Accepting Chemotaxis Protein
Protein Sequence:  
MSGWLARFSI KTRLIGLLVL LASMAVGLPM AGLNGMRTSN AVIDRLYNNM LLPIDKLGDI NNHMHNARAQ LLLALQHEPG SAFEKAHDHP SSMHFDRVDK
SVSIIRERLS DYQRIPMSKE QQRLSTELQN KLSDYLDNGV LPTLNAMRQG DYAGGNQILL TRLDPAFMTT YASLRTLIES EASAAELSFQ NADKQFERLV
AMIGLALVVA LSLVTVTALA TVPSITKGVR ELQVGGQQLA DGNLGYRVTY QGRDELGEIS SAFNEMASRF HHTFQELAGA VEQLAAAAEQ TAQASSQTSD
GIRRQQLETD LIATAMNEMS ATVQDVAGNA ASAARAAQEA DQQSESGMRV VHQTIASIDS LASEVEHAAT VIHELEADSA GISSVVDVIR SITEQTNLLA
LNAAIEAAHA GEHGRGFAVV ADEVRSLASR TQQSANEIQA MIEKLQSGAN RAVAVMESSC SKAQAGKQQV ASAGHMLEQI SNAVATINDM NAMIASAAEE
QSSVAEEISR NVTNVSQIAE KTSEASRQNV ATSTQLASLA SQLQRLMHMF RL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn4656 615 2082-2696 +
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MEPKTNVSPA AHPAHGGILQ GQRIGYVRVS SYDQNPERQL EQVEVGKLFT DKASGKDTQR PQLEAMLGFV REGDTVVVHS MDRLARNLDD LRRLVQKLTK
RGVRIEFLKE GLVFTGEDSP MANLMLSVMG AFAEFERALI RERQREGIAL AKQRGAYRGR KKALSDEQAA TLRQRAAAGE PKAQLAREFN ISRETLYQYL
RTDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn4656 2967 2700-5666 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRLILSAT ERDTLLALPE SQDDLIRYYT FNDSDLSLIR QRRGDANRLG FAVQLSLLRY PGYALGTDSE LPEPVIQWVA KQVQADPESW AKYGERDVTR
REHTQELRTY LQLAPFGLSD FRALVRELTE LAQQTDKGLL LAGQALESLR QKRRILPALS VIDRACSEAI ARANRRVYRA LVEPLTDSHR AKLDELLKLK
AGSSITWLTW LRQAPLKPNS RHMLEHIERL RTFQLVDLPE GLGRHIHQNR LLKLAREGGQ MTPKDLGKFE PQRRYATLAA VVLESTATVI DELVDLHDRI
LVKLFSSAKH KHQQQFQKQG KAINDKVRLY SKIGQALLEA KETGSDPYAA IEAVIPWDEF TESVSEAELL ARPEGFDHLH LVGENFATLR RYTPALLEVL
ELRAAPAAQG VLAAVQTLRE MNADNLRKVP ADAPTAFIKP RWKPLVITPE GLDRRFYEIC ALSELKNALR SGDIWVKGSR QFRDFDDYLL PAEKFAALKR
EQALPLAINP SSDQYLEERL QLLDEQLATV TRLAKDNELP DAILTESGLK ITPLDSAVPN TAQALIDQTS QLLPRIKITE LLMDVDDWTG FSRHFTHLKD
GAEAKDRTLL LSAILGDAIN LGLTKMAESS PGLTYAKLSW LQAWHIRDET YSAALAELVN HQYRHTFAAH WGDGTTSSSD GQRFRAGGRG ESTGHVNPKY
GSEPGRLFYT HISDQYAPFS TRVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG ETKLYVPNSV QDYPTLRPMV
GGTLNIKHVR AHWDDILRLA SSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNSLAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERSTQAMGEA GKQVNGELLQ YLSPLGWEHI NLTGDYVWRQ SRRLEDGKFR PLRLPGKP

 References     

1.Yano H, Garruto CE, Sota M, Ohtsubo Y, Nagata Y, Zylstra GJ, Williams PA, Tsuda M. Complete sequence determination combined with analysis of transposition/site-specific recombination events to explain genetic organization of IncP-7 TOL plasmid pWW53 and related mobile genetic elements. J Mol Biol. 2007 May 25;369(1):11-26. doi: 10.1016/j.jmb.2007.02.098. Epub 2007 Mar 14. PubMed ID: 17408691
2.Assinder SJ, de Marco P, Sayers JR, Shaw LE, Winson MK, Williams PA. Identical resolvases are encoded by Pseudomonas TOL plasmids pWW53 and pDK1. Nucleic Acids Res. 1992 Oct 25;20(20):5476. doi: 10.1093/nar/20.20.5476. PubMed ID: 1331988
3.Keil H, Keil S, Pickup RW, Williams PA. Evolutionary conservation of genes coding for meta pathway enzymes within TOL plasmids pWW0 and pWW53. J Bacteriol. 1985 Nov;164(2):887-95. doi: 10.1128/JB.164.2.887-895.1985. PubMed ID: 2997136