Transposon
Name: Tn4430
Family: Tn3        Group: Tn4430
Evidence of Transposition: yes
 Host     

Host Organism:B. thuringiensis
Place of Origin:Paris, France Date of Isolation:1988
Other Geographic Information:the Centre O.I.L.B. (Institut Pasteur)

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTACCGCCAGCATTTCGGAAAAAAACCACGCTAAG
IRR (Length: 38 bp)GGGGTACCGCCAGCATTTCGGAAAAAAACCACGCTAAG

 Sequence     
DNA SequenceLength  4149 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTACCGC CAGCATTTCG GAAAAAAACC ACGCTAAGAA AATCAGAGTT AAAAAATCAG AAAATATATC ATTATTCCAA GACACATACA GTGTCTTTTT 100
TTATACAAAA AATAATACAA CACAATATTA ATTGTGTTGT ATTAGGTGTT ATAATAAATA TAAATCTAGG GGTTTAACGC AACACAATTT ATCGATAAAT 200
AAATACTTTT AGACGCAACA CAATTTATAG ACGCGGAGGA AATCACATGG ATGTTGCAAA ACAGTTTTCT TCTTATCTTA AACAAGAGAA TAAAACCGAG 300
AACACTGTTC AGGGATACAC ATCAGGTATT AGACAGTACA TAAAATGGTT TGAAGGTTCC TATGACAGAA AATTAACAAA ATTGTACCGA CAAAATATCT 400
TAGAGTACAT TAGTTATTTA AAGAATGTCA AAATGTTGAA CGCCAAGTCC ATTAACCACA AGATTAGTAG CCTTGCTAAA TTTAATGAAT TTCTAATACA 500
GAAAGGAAGT CAACAAGATC AAGTAATTTT AAAAACAGAC ATGATAAAGG TTCAAACTGT CTATGCTTCT CCAACCCAAA TTGTTGAATT AGATGTAAAA 600
AAGTTTTTAC AAAGTGTGTT AGAGGATAAT AACAAACGTA ATTATGCAAT TGCCACTCTC CTAGCATATA CAGGAGTACG TATTTCAGAG GCATTATCTA 700
TCAAAATGAA TGACTTCAAT TTACAGACTG GGGAATGTAT TATTCGAAGT GGAAAAGGAG GTAAACAACG AATTGTATTA CTAAATAGTA AGGTACTTAG 800
TGCTATCAAA GATTATCTCA TCGATCGAAA AACATACAGT ACAGCACATG AATCTCCGTA TCTTTTTATT AGTAAAAAGC GAGAAAAGCT CGACCGTACG 900
GTCGTCAATC GTATCTTTAA ATCATACAGC AATGTTATTA CTCCACACCA ATTACGACAC TTCTTCTGTA CGAATGCAAT TGAAAAAGGA TTTAGCATTC 1000
ATGAAGTTGC AAATCAAGCT GGGCACTCTA ACATCCATAC GACACTACTT TACACAAATC CAAACCAACT GCAGCTAAAA AATAAAATGG AGCTCTTATA 1100
AAGGAGTAAA GGGGAAACAA TGGGAGTTAA ACAATTACTG TCAGAGGCAC AACGAAATGA GTTAATGGAT TTATCACGTT TAACAGAATG GGATTTGGTA 1200
ACATTTCGTA CTTTTTCTAA ACATGACTTA CATTTAATAT TAAAACACCG TAGAGGATAC AATCGTTTAG GGTTCGCTCT TCGGCTTGTA TTAATTCGTT 1300
ATCCTGGCTG GTCCTTAACG GAATATAAGG ACATTCCACA ATATGTAGTG GCTTACGTTA CGAGTCGGTT ACGGATTCCA CCTGAAGAAT TTTTGGTATA 1400
TGCCAAACGT GGGAATACTT TATGGGAGCA TCTTGGGGAA ATTCGAACAG AATATGGATA TCAGAATTTT TCTTCTGAAT ATAAAGAAAC TTTATTACAA 1500
TTTTTAGTGC AACAAGCAAT GGATAACAAT AATACCCTCT ATTTAATCGA AATAACAATA TCTACATTGC GAAAAACGAA AGTCATTCTT CCAGCTATGT 1600
ATGTGATTGA AGATATCGTC TGGGAAGCAA AGCAACAAGC AGATCAGAAA GTGTATAGTA TACTACATGA CGGTTTGGTC CAAGAACAAA AAGATCAATT 1700
AGATGCGTTA CTTTTACCAA CTATAAATGG TAAGTCTCCA TTAGCATGGC TAAAAGATGT ACCGGCCCAG CCTTCACCAG AATCATTTTT AAAAGTAATA 1800
GACCGATTAC AATTTGTTCA AAAAATTGGT CTTACTATTG ATACCACAAA AATTAATACA AATCGTCTTC GGCAGCTCGC TAGATTAGGA TCAAAATATG 1900
AGCCATATGC TTTTAGACGA TTCAATGAAG TAAAAAGATA TAGTATGTTA GTCTCATTTT TATTGGAGAT TACACAAGAC CTTATAGATT ACGCAATTGA 2000
AATTCATGAT CGTCTTATGA TGAATCTTCA AACAAAAGGG AAAAAAGAAC AAGACGAAAT ACAGCAAGCA AATGGGAAAA AATTAAACGA GAAGATTTTA 2100
CAATTTATTA CTGTATGCGG GACACTAATT GAGGCAAAAG AAACGGGTAA AGATGCTTTT GCAGCCCTAG ATGAAGTAAT GTCATGGAAT GAGATGGTCG 2200
AATCTGTTGA AGAAGCAAAA CAACTATCAC GGCCTTTAAA TTATGACTAT TTGGATTTGT TAAATACTCG TTATTCCTAT GTTAGACGAT ATGCACCTAC 2300
TTTATTACGC AGTCTTCATT TTAGAGCGAC GAAATCTGGA GAACCCGTTT TACAAGCACT TGATACGATT CATGAATTGA ATGAAACAGG TAAACGAAAA 2400
GTGCCTCATG GCGCTCCCTT ACACTTTGTA TCTAACCGTT GGCAAAAACA TGTATATGAT GATGACGGAA ACATTAATCG GCACTATTAT GAATTGGCAG 2500
CTTTAACCGA GTTAAGAAAT CATATTCGTT CAGGAGATAT TTTTGTATCA GGCAGTAGAC ATCATAAGGC ATTTGATGAT TATCTTATAC CGTATGATGA 2600
ATGGAACGAA GTTTCAAACA TTCCAAATGG CCTTACAGCC CCTTTAAAAG CTGAAGATTA TATAACTGAC CGAATAAACC GATTAAATGA ACATTTAGAA 2700
TGGTTATCAA AAAATAGCGA GAAATTAGAA GGAGTAGATA TTAGTCAAGG AAAACTACAT GTTGAGCGAT TGGATAGAGG AACTCCAGAA GAAGCAAAAG 2800
CATTTAGTAA ACTTCTTCAT AGTATGTTAC CCAGAATAAA ACTGACAGAT TTACTAATAG AAGTGGCCAG TTGGACTGGA TTTCATGATC AATTTATCCA 2900
CGCCTCTACC AATCAATCTC CTGATCAAGA GGAACAGAAT ATTGTATTAG CTACTTTGAT GGCAATGGGG ACAAATATAG GTCTTACAAA AATGGCGGAA 3000
GCTACCCCTG GAATCTCCTA TAGACAAATG GCAAATGCTT CACAATGGAG AATGTATGAT GATGCAATGG TTCGCGCTCA ATCTATTCTC GTGAATTTCC 3100
AAAAGGAACA AAAGTTATCA TCCTATTGGG GAGATGGGAC AACTTCTTCT TCTGATGGTA TGCGTTTATC CATTGCTGTA CGTTCTCTAC ATGCAGATTC 3200
CAATCCACAC TATGGAACGG GAAAAGGTGG AACCATTTAT CGATTTGTAA GTGATCAGCT ATCTGCCTAT CATGTGAAAG TCATTACTAC CAATGCACGA 3300
GATGCTCTTC ATGTATTAGA TGGGCTTCTT CATCATGAAA CAGATTTAAA AATTGAAGAA CATTACACAG ATACAGCTGG ATATACAGAT CAAGTTTTCG 3400
CTTTAACACA CTTGTTGGGA TTTCGATTTG CTCCTCGTAT TCGTGATTTG GCAGATACTA AGCTTTTTTC TATACCTGGT GGAGAAGAAT ATGAAAATGT 3500
TCAAGCACTT TTAAAAGGAA AAATTAATGT AAAGTTAATA AAAGAAAACT ATGAAGATAT TAGAAGGTTG GCATACTCGG TTCAAACAGG AAAAGTATCT 3600
AGCGCTCTTA TCATGGGGAA GCTCGGATCA TATGCAAGAC AAAATAAACT CGCAACAGCA CTTGGAGAAA TGGGACGAAT CGAGAAAACC CTCTTTACGC 3700
TGGATTACAT ATCTAATAAA GCCGTAAGGA GACGGGTTCA AAAAGGTTTA AATAAAGGAG AAGCAATCAA TGCATTAGCT AGAACTATAT TTTTTGGACA 3800
ACGTGGAGAA TTTAGAGAAC GTGCTCTCCA AGACCAGTTA CAAAGAGCTA GTGCACTAAA CATAATTATT AACGCTATAA GTGTGTGGAA CACTGTATAT 3900
ATGGAAAAAG CCGTAGAAGA ATTAAAAGCA AGAGGAGAAT TTAGAGAAGA TTTAATGCCA TATGCGTGGC CGTTAGGATG GGAACATATC AATTTTCTTG 4000
GAGAATACAA ATTTGAAGGA TTACATGACA CTGGGCAAAT GAATTTACGT CCTTTACGTA TAAAAGAGCC GTTTTATTCT TAATATAACG GCTCTTTTTA 4100
TAGAAAAAAT CCTTAGCGTG GTTTTTTTCC GAAATGCTGG CGGTACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 113-228 116 TAATACAACA CAATATTAAT TGTGTTGTAT TAGGTGTTAT AATAAATATA AATCTAGGGG
TTTAACGCAA CACAATTTAT CGATAAATAA ATACTTTTAG ACGCAACACA ATTTAT
res_site_IR1 113-126 14 TAATACAACA CAAT
res_site_IR2 131-144 14 ATTGTGTTGT ATTA
res_site_DR1 177-192 16 ACGCAACACA ATTTAT
res_site_DR2 213-228 16 ACGCAACACA ATTTAT

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnpI Tn4430 247-1101 Accessory Gene Resolvase +
tnpA Tn4430 1120-4083 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpI TnpI Tn4430 855 247-1101 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase
Transpoase Chemistry:   Tyrosine
Sequence Family:  Tyrosine Site-Specific Recombinase
Protein Sequence:  
MDVAKQFSSY LKQENKTENT VQGYTSGIRQ YIKWFEGSYD RKLTKLYRQN ILEYISYLKN VKMLNAKSIN HKISSLAKFN EFLIQKGSQQ DQVILKTDMI
KVQTVYASPT QIVELDVKKF LQSVLEDNNK RNYAIATLLA YTGVRISEAL SIKMNDFNLQ TGECIIRSGK GGKQRIVLLN SKVLSAIKDY LIDRKTYSTA
HESPYLFISK KREKLDRTVV NRIFKSYSNV ITPHQLRHFF CTNAIEKGFS IHEVANQAGH SNIHTTLLYT NPNQLQLKNK MELL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn4430 2964 1120-4083 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MGVKQLLSEA QRNELMDLSR LTEWDLVTFR TFSKHDLHLI LKHRRGYNRL GFALRLVLIR YPGWSLTEYK DIPQYVVAYV TSRLRIPPEE FLVYAKRGNT
LWEHLGEIRT EYGYQNFSSE YKETLLQFLV QQAMDNNNTL YLIEITISTL RKTKVILPAM YVIEDIVWEA KQQADQKVYS ILHDGLVQEQ KDQLDALLLP
TINGKSPLAW LKDVPAQPSP ESFLKVIDRL QFVQKIGLTI DTTKINTNRL RQLARLGSKY EPYAFRRFNE VKRYSMLVSF LLEITQDLID YAIEIHDRLM
MNLQTKGKKE QDEIQQANGK KLNEKILQFI TVCGTLIEAK ETGKDAFAAL DEVMSWNEMV ESVEEAKQLS RPLNYDYLDL LNTRYSYVRR YAPTLLRSLH
FRATKSGEPV LQALDTIHEL NETGKRKVPH GAPLHFVSNR WQKHVYDDDG NINRHYYELA ALTELRNHIR SGDIFVSGSR HHKAFDDYLI PYDEWNEVSN
IPNGLTAPLK AEDYITDRIN RLNEHLEWLS KNSEKLEGVD ISQGKLHVER LDRGTPEEAK AFSKLLHSML PRIKLTDLLI EVASWTGFHD QFIHASTNQS
PDQEEQNIVL ATLMAMGTNI GLTKMAEATP GISYRQMANA SQWRMYDDAM VRAQSILVNF QKEQKLSSYW GDGTTSSSDG MRLSIAVRSL HADSNPHYGT
GKGGTIYRFV SDQLSAYHVK VITTNARDAL HVLDGLLHHE TDLKIEEHYT DTAGYTDQVF ALTHLLGFRF APRIRDLADT KLFSIPGGEE YENVQALLKG
KINVKLIKEN YEDIRRLAYS VQTGKVSSAL IMGKLGSYAR QNKLATALGE MGRIEKTLFT LDYISNKAVR RRVQKGLNKG EAINALARTI FFGQRGEFRE
RALQDQLQRA SALNIIINAI SVWNTVYMEK AVEELKARGE FREDLMPYAW PLGWEHINFL GEYKFEGLHD TGQMNLRPLR IKEPFYS

 References     

1.Mahillon J, Lereclus D. Structural and functional analysis of Tn4430: identification of an integrase-like protein involved in the co-integrate-resolution process. EMBO J. 1988 May;7(5):1515-26. PubMed ID: 2842151
2.Lereclus D, Menou G, Lecadet MM. Isolation of a DNA sequence related to several plasmids from Bacillus thuringiensis after a mating involving the Streptococcus faecalis plasmid pAM beta 1. Mol Gen Genet. 1983;191(2):307-13. PubMed ID: 6413823