Transposon
Name: Tn4380
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Cupriavidus metallidurans CH34 Molecular Source:plasmid pMOL30
Place of Origin:Belgium Date of Isolation:2007

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTCGTCTCAGAAAACGGAAAATAAAGCACGCTAAG
IRR (Length: 38 bp)GGGGTCGCCTCAGAAAACGGAAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  8026 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCGTCT CAGAAAACGG AAAATAAAGC ACGCTAAGGC ATAGCCGAAC CTGCCAAGCT TGCTCCACCC TGTAGTGACG CGATCAGCGG GCAGGAAACG 100
TTCCCCCTTC GCGCATGGCA GGCGCACACC AACTCAGACA GCACGGCCTC CATGCGCGCC AGGTCAGCCA TTTTCTCGCG CACGTCCTTG AGCTTGTGCT 200
CGGCCAGACT GCTGGCTTCC TCGCAATGGG TGCCATCCTC CAGCCGCAGC AGCTCGGCGA TCTCATCCAG GCTGAAGCCC AGCCGCTGGG CTGATTTCAC 300
GAAGCGCACC CGCGTTACAT CCGCCTCGCC ATAGCGGCGG ATGCTGCCAT AGGGCTTGTC AGGCTCCAGC AACAAGCCCT TGCGCTGATA GAAACGGATG 400
GTCTCCACAT TGACCCCGGC CGCCTTGGCG AAAACGCCAA TGGTCAGGTT CTCCAAATTG TTTTCCATAT CGCTTGACTC CGTACATGAG TACGGAAGTA 500
AGGTTACGCT ATCCAATTTC AATTCGAAAG GACAAGCGCA TGTCTGAACC AAAAACCGGG CGCGGCGCGC TCTTCACTGG AGGGCTTGCC GCCATCCTCG 600
CCTCGGCTTG CTGCCTCGGG CCGTTGGTTC TGATCGCCTT GGGGTTCAGC GGCGCTTGGA TCGGCAACTT GGCGGTGTTG GATCCCTATC GCCCCATCTT 700
TATCGGCGTG GCGCTGGTGG CGTTGTTCTT CGCCTGGCGG CGCATCTACC GGCAGGCAGC GGCCTGCAAA CCGGGTGAGG TCTGCGCGAT TCCCCAAGTG 800
CGAGCTACTT ACAAGCTCAT TTTCTGGATC GTGGCCGCGC TGGTTCTGGT CGCGCTCGGA TTTCCCTACG TCATGCCATT TTTCTACTGA TCGGAGTTCA 900
CCATGAAGAA ACTGTTTGCC TCCCTCGCCC TCGCCGCCGT TGTTGCCCCC GTCTGGGCCG CCACCCAGAC CGTCACGCTG TCCGTACCGG GCATGACCTG 1000
CTCCGCCTGC CCGATCACTG TCAAGAAGGC GATTTCCAAG GTCGAAGGCG TCAGCAAAGT TGACGTGACT TTCGAGACAC GCCAAGCGGT CGTCACCTTC 1100
GACGATGCCA AGACCAGCGT GCAGAAGCTG ACCAAGGCAA CCGCAGACGC GGGCTATCCG TCCAGCGTCA AGCAGTGAGT CACTGAAAAC GGCACCGCAG 1200
CACAACGGAC GTCATTGTCT GGCGCCACAA ACGATAAAGG ATCTGTTGCA TGACCCATCT AAAAATCACC GGCATGACTT GCGACTCGTG CGCGGCGCAC 1300
GTCAAGGAAG CGCTGGAAAA AGTGCCAGGC GTGCAGTCGG CGCTGGTGTC CTATCCGAAG GGCACAGCGC AACTCGCCAT CGTGCCGGGC ACATCGCCGG 1400
ACGCGCTGAC TGCCGCCGTG GCCGGACTGG GCTACAAGGC AACGCTAGCC GATGCGCCAC TGGCGGACAA CCGCGTCGGA CTGCTCGACA AGGTGCGGGG 1500
ATGGATGGCC GCCGCCGAAA AGCACAGTGG CAACGAGCCC CCGGTGCAGG TAGCGGTCAT TGGCAGCGGT GGAGCCGCGA TGGCGGCGGC GCTGAAGGCC 1600
GTCGAGCAAG GCGCGCAGGT CACGCTGATC GAGCGCGGCA CCATCGGCGG CACCTGCGTC AATGTCGGCT GTGTGCCGTC CAAGATCATG ATCCGCGCCG 1700
CCCACATCGC CCATCTGCGC CGGGAAAGCC CGTTCGATGG CGGTATTGCG GCAACTGTGC CTACGATTGA CCGCAGTAAG CTGCTGGCCC AGCAGCAGGC 1800
CCGCGTCGAC GAACTGCGGC ACGCCAAGTA CGAAGGCATC CTGGGCGGTA ATCCGGCCAT CACCGTTGTG CACGGTGAGG CGCGCTTCAA GGACGACCAG 1900
AGCCTTACCG TCCGTTTGAA CGAGGGTGGC GAGCGCGTCG TGATGTTCGA CCGCTGCCTG GTCGCCGCGG GTGCCAGCCC GGCGGTCCCG CCGATTCCGG 2000
GCTTGAAAGA GTCACCCTAC TGGACTTCCA CCGAGGCCCT GGCGAGCGAC ACCATTCCCG AACGCCTTGC CGTAATCGGC TCGTCGGTGG TGGCGCTGGA 2100
GCTGGCGCAA GCCTTTGCCC GGCTGGGCAG CAAGGTCACG GTCCTGGCGC GCAATACCTT GTTCTTCCGT GAAGACCCGG CCATCGGCGA GGCGGTGACA 2200
GCCGCTTTCC GTGCCGAGGG CATCGAGGTG CTGGAGCACA CGCAAGCCAG CCAGGTCGCC CATATGGACG GTGAATTCGT GCTGACCACC ACGCACGGTG 2300
AATTGCGCGC CGACAAACTG CTGGTTGCCA CCGGTCGGAC ACCGAACACG CGCAGCCTCG CGCTGGACGC AGCGGGGGTC ACTGTCAATG CGCAAGGTGC 2400
CATCGTCATC GACCAAGGCA TGCGCACGAG CAACCCGAAC ATCTACGCGG CCGGCGACTG CACCGACCAG CCGCAGTTCG TCTATGTGGC GGCAGCGGCC 2500
GGCACCCGTG CCGCGATCAA CATGACCGGC GGCGATGCGG CGCTCGACCT GACCGCAATG CCGGCCGTGG TGTTCACCGA TCCGCAAGTG GCGACCGTGG 2600
GCTACAGCGA GGCGGAAGCC CACCACGACG GGATCGAGAC CGACAGCCGC ACCTTGACCT TGGACAACGT GCCGCGTGCG CTCGCCAACT TCGACACACG 2700
CGGCTTCATC AAGTTGGTTA TCGAGGAAGG CAGCCATCGG CTGATCGGCG TACAAGCGGT CGCGCCGGAA GCGGGTGAAC TGATCCAGAC GGCGGCTCTG 2800
GCCATTCGCA ACCGCATGAC GGTGCAGGAA CTGGCCGACC AGTTGTTCCC CTACCTGACG ATGGTCGAGG GGTTGAAGCT CGCGGCGCAG ACCTTCAACA 2900
AGGATGTGAA GCAGCTTTCC TGCTGCGCCG GGTGAGAAAA AGGAGGTGTT CAATGAACGC CTACACGGTG TCCCGGCTGG CTCTTGATGC CGGGGTGAGC 3000
GTGCATATCG TGCGCGACTA CCTGCTGCGC GGATTGCTGC GCCCGGTGGC GTGCACACCA GGCGGCTACG GCTTGTTCGA TGACGCCGCC TTGCAACGGC 3100
TGTGCTTCGT GCGGGCGGCC TTCGAGGCGG GCATCGGCCT CGACGCGCTG GCGCGGCTGT GCCGGGCGCT GGATGCGGCG GACGGCGACG AAGCGGCCGC 3200
GCAGCTTGCC CTGCTGCGTC AGTTCGTCGA GCGTCGGCGC GAAGCGTTGG CCGATCTGGA AGTGCAGTTG GCCACCCTGC CGACCGAGCC GGCACAGCAC 3300
GCGGAGAGTC TGCCATGAAC AACCCCGAGC GCTTGCCGTC CGAGACGCAC AAACCGATCA CCGGCTACCT GTGGGGCGGA CTGGCTGTGC TGACTTGCCC 3400
CTGCCACCTG CCCATCCTCG CTGTCGTGCT GGCCGGCACA ACCGCCGGTG CTTTCCTCGG CGAGCATTGG GTCATCGCGG CGCTCGGTTT GACCGGCCTG 3500
TTCCTTCTGT CCCTGTCGCG GGCGTTGCGG GCATTCAGGG AAAGAGAATG AGCGCTTTCC GGCCGGATGG ATGGACGACG CCGGAACTGG CCCAAGCGGT 3600
CGAGCGCGGG CAGCTTGAAC TGCACTACCA GCCCGTCGTC GATCTGCGCA GTGGTGGGAT TGTCGGCGCG GAAGCCCTGT TGCGCTGGCG TCATCCGACG 3700
CTTGGACTAT TGCCACCGGG CCAGTTCCTG CCCGTGGTCG AATCGTCCGG CCTGATGCCT GAAATCGGCG CTTGGGTGCT GGGCGAAGCC TGCCGCCAGA 3800
TGCGTGACTG GCGAATGCTG GCATGGCGAC CGTTCCGGCT GGCCGTCAAT GTTTCGGCGA GCCAAGTGGG ACCGGACTTC GACGGGTGGG TAAAGGGCGT 3900
GCTGGCTGAT GCCGAGTTGC CCGCCGAGTA TCTCGAAATC GAGCTGACCG AATCGGTCGC GTTTGGTGAT CCGGCGATCT TCCCCGCCCT GGACGCCTTG 4000
CGGCAGATCG GTGTGCGCTT CGCCGCCGAT GACTTCGGGA CGGGGTATTC CTGTCTGCAA CATCTGAAGT GCTGCCCAAT CAGCACGCTC AAGATCGACC 4100
AATCGTTTGT CGCCGGGCTC GCCAACGACC GCCGCGACCA AACCATCGTG CACACCGTGA TTCAGCTTGC GCACGGGCTG GGCATGGATG TGGTGGCTGA 4200
AGGCGTGGAA ACATCGGCGA GTCTTGATCT ATTGCGACAA GCGGACTGCG ACACAGGACA AGGCTTCCTG TTCGCGAAGC CAATGCCGGC GGCGGCATTC 4300
GCCGTCTTCG TCAGTCAATG GAGGGGTGCC ACCATGAATG CAAGTGACTC GACCACCACC AGTTGCTGCG TGTGCTGCAA GGAAATCCCG CTCGATGCCG 4400
CCTTCACCCC GGAAGGCGCG GAATACGTCG AGCACTTCTG CGGGTTGGAG TGTTATCAAC GCTTCGAAGC GCAAGCGCAT CGGTTACGTC CGCGTCAGCA 4500
GCTTCGACCA GAACCCAGAA CGGCAGCTCG AACAGATCCA GGTGGATAAA GTGTTCACCG ACAAGGCGTC GGGCAAGGAC ACACGGCGGC CCGAACTGGA 4600
ACGGCTGCTC GCCTTCGTGC GCGAAGGCGA CACGGTCGTG GTGCACAGCA TGGATCGTCT GGCGCGCAAC CTCGACGACC TGCGCCGCCT GGTGCAGGGC 4700
CTCACCCAGC GCGGCGTACG CATCGAGTTC CTTAAGGAGC ATTTGACCTT CACCGGCGAG GACTCGCCGA TGGCGAACCT GATGCTGTCG GTAATGGGCG 4800
CGTTCGCCGA GTTCGAACGC GCCTTGATCC GCGAGCGGCA GCGCGAGGGC ATCGCGCTCG CCAAGCAGCG CGGGGCCTAC CGTGGCAGGA AGAAATCCCT 4900
GTCGTCTGAG CGTATTGCCG AACTGCGCCA ACGTGTCGAG GCTGGCGAGC AAAAGACCAA GCTGGCTCGT GAATTCGGAA TCAGTCGCGA AACCCTGTAT 5000
CAATACTTGA GAACGGATCA GTAAATATGC CACGTCGTTC AATCCTGTCC GCCGCCGAGC GCGAAAGCCT GCTGGCGTTG CCGGACACCA AGGATGAGTT 5100
GATCCGTCAC TACACGTTCA GCGAAACCGA CCTCTCCATC ATCCGGCAGC GGCGCGGCCC GGCCAACCGG CTGGGCTTCG CCGTGCAGCT CTGTTACCTG 5200
CGCTTTCCTG GTGTCATCCT GGGCGTCGAT GAGCCGCCGT TTCCGCCCTT GTTGAAACTG GTCGCCGACC AGCTCAAGGT CAGCGTCGAA AGCTGGGACG 5300
AATACGGGCA GCGGGAGCAG ACCCGGCGCG AGCACCTGGT CGAACTGCAA ACGGTGTTCG GCTTCCAGCC CTTTACCATG GGCCACTACC GGCAGGCCGT 5400
CCAGTTGCTG ACCGAGATGG CCTTGCAGAC CGACAAGGGC ATCGTGCTGG CCAGCACCTT GATCGAGCAC CTGCGGCAGC AGTCGGTCAT TCTGCCTGCC 5500
CTCAACGCCG TCGAGCGGGC GAGCGCCGAA GCAATCACCC GCGCCAACCG GCGCATCTAC GATGCCTTGG CCGAACCGCT GTCGGACGCG CATCGCCGCC 5600
GCCTCGACGA TCTGCTCAAG CGTCGGGACA ACGGCAAAAC GACCTGGCTG GCCTGGCTGC GCCAATCGCC CGTCAAACCG AATTCGCGGC ACATGCTGGA 5700
ACACATCGAA CGCCTCAAAG CGTGGCAGGC GCTCGACCTG CCTTCTGGCA TCGAGCGGTC GGTGCACCAG AACCGCCTGC TCAAGATCGC CCGTGAGGGT 5800
GGCCAGATGA CGCCCGCCGA CCTGGCCAAG TTCGAGGCGC AGCGACGCTA TGCCACCCTG GTGGCGCTTG CCATCGAGGG CATGGCCACC GTCACCGACG 5900
AAATCATCGA CCTGCACGAC CGCATCCTGG GCAAGCTGTT CAACGCCGCC AAGAACAAGC ATCAGCAGCA ATTCCAGGCG TCCGGCAAGG CGATCAACGC 6000
CAAGGTGCGG CTGTTCGGCC GCATCGGCCA GGCGCTGATC GAGGCCAAGC AGGCGGGCCG CGATCCGTTC GCCGCCATCG AGGCCGTCAT GTCCTGGGAT 6100
GCCTTCGCCG AGAGCGTCAC CGAAGCGCAG AAGCTTGCGC AGCCCGAGGA CTTCGATTTC CTGCACCGCA TCGGCGAAAG CTACGCCACG CTGCGCCGCT 6200
ACGCGCCGGA ATTCCTTGCC GTGCTCAAGC TGCGGGCCGC TCCCGCCGCG AAGGACGTGC TCGACGCCAT CGAGGTGCTG CGCGGCATGA ACAGCGACAA 6300
CGCCCGCAAG GTGCCCGCCG ACGCGCCGAC CGAGTTCATC AAGCCGCGCT GGCAGAAGCT GGTCATGACC GACACCGGCA TCGACCGGCG CTACTACGAA 6400
CTGTGCGCGC TGTCGGAGAT GAAGAACGCG TTGCGTTCCG GCGACATCTG GGTGCAGGGG TCGCGCCAGT TCAAGGACTT CGAGGACTAC CTGGTGCCGC 6500
CCGCGAAATT CGCCAGCCTC AAGCAGGCCA GCGAATTGCC GCTGGCCGTG GCCACCGACT GCAACCGGTA CCTGAACGAC CGGCTGACGC TGCTGGAAAC 6600
ACAGCTTGCC ACCGTCAACC GTATGGCGAC GGCCAACGAG CTGCCGGACG CCATCATCAC CGAGTCAGGC TTGAAGATCA CGCCGCTCGA CGCGGCGGTA 6700
CCCGACACCG CCCAAGCGCT GATCGACCAG ACGGCAATGA TCCTGCCGCA CGTCAAGATC ACCGAACTGC TGCTGGAGGT GGACGAATGG ACGGGCTTCA 6800
CTCGGCATTT CGCGCATCTG AAATCGGGCG ACCCGGCCAA AGACAAGAAC CTGTTGCTGA CCACGATCCT CGCCGACGCG ATCAACCTGG GCCTGACCAA 6900
GATGGCGGAG TCTTGCCCCG GCACGACCTA CGCCAAGCTG GCTTGGCTGC AAGCCTGGCA CATCCGCGAC GAAACCTACG GGGCGGCGCT GGCCGATCTG 7000
GTCAACGCAC AGTTCCGCCA TCCCTTCGCC GAGCACTGGG GCGACGGCAC CACCTCATCG TCGGACGGCC AGAACTTCCG CACCGGCAGC AAGGCCGAGA 7100
GCACCGGCCA CATCAACCCG AAATACGGGA GCAGCCCAGG GCGGACGTTC TACACCCACA TTTCTGACCA GTACGCGCCA TTTCACACCA AGGTCGTGAA 7200
CGTCGGCGTG CGCGATTCGA CCTACGTGCT CGACGGCCTG CTGTACCACG AGTCCGACTT GCGGATCGAG GAGCATTACA CCGACACGGC GGGCTTCACC 7300
GATCACGTCT TCGCCCTGAT GCACCTCCTG GGCTTCCGCT TCGCGCCGCG CATCCGCGAC CTGGGCGACA CCAAGCTCTA CATCCCGAAG GGCGACGCCG 7400
CCTATGACGC GCTGAAACCC ATGATCGGCG GCACGCTCAA CATCAAGCAC GTCCGCGCCC ATTGGGACGA AATCCTGCGG CTGGCCACCT CGATCAAGCA 7500
GGGCACGGTG ACGGCCTCCC TGATGCTCCG AAAGCTCGGC AGCTACCCAC GCCAGAACGG CCTGGCCGTG GCGCTCCGCG AGCTGGGCCG CATCGAGCGC 7600
ACGCTGTTCA TCCTGGACTG GCTGCAAAGC GTGGAACTGC GCCGCCGCGT GCATGCCGGC CTGAACAAGG GCGAGGCGCG CAATGCGCTG GCCAGGGCAG 7700
TGTTTTTCAA CCGCCTGGGT GAAATCCGCG ACCGCAGTTT CGAGCAGCAG CGCTACCGGG CTAGCGGCCT CAATCTGGTA ACGGCTGCCG TCGTGTTGTG 7800
GAACACGGTC TATCTGGAAC GGGCTGCGCA CGCGCTGCGT GGCAACGGCC ATGCCGTTGA TGACGCGCTG TTGCAGTACC TGTCGCCGCT CGGTTGGGAG 7900
CACATCAACC TCACCGGCGA TTACCTCTGG CGCAGCAGCG CCAAGATCGG CGCGGGCAAG TTCAGGCCGC TACGACCGCT GCAACCGGCT TAGCGTGCTT 8000
TATTTTCCGT TTTCTGAGGC GACCCC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn4380 34-468 Passenger Gene Heavy Metal Resistance -
merT Tn4380 540-890 Passenger Gene Heavy Metal Resistance +
merP Tn4380 903-1178 Passenger Gene Heavy Metal Resistance +
merA Tn4380 1250-2935 Passenger Gene Heavy Metal Resistance +
merD Tn4380 2953-3318 Passenger Gene Heavy Metal Resistance +
merE Tn4380 3315-3551 Passenger Gene Heavy Metal Resistance +
urfM Tn4380 3548-4549 Passenger Gene Other +
tnpR Tn4380 4542-5024 Accessory Gene Resolvase +
tnpA Tn4380 5027-7993 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn4380 435 34-468 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLLEPDKPY GSIRRYGEAD VTRVRFVKSA QRLGFSLDEI AELLRLEDGT HCEEASSLAE HKLKDVREKM
ADLARMEAVL SELVCACHAR RGNVSCPLIA SLQGGASLAG SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn4380 351 540-890 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPKTGRGA LFTGGLAAIL ASACCLGPLV LIALGFSGAW IGNLAVLDPY RPIFIGVALV ALFFAWRRIY RQAAACKPGE VCAIPQVRAT YKLIFWIVAA
LVLVALGFPY VMPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn4380 276 903-1178 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFASLAL AAVVAPVWAA TQTVTLSVPG MTCSACPITV KKAISKVEGV SKVDVTFETR QAVVTFDDAK TSVQKLTKAT ADAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn4380 1686 1250-2935 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MTHLKITGMT CDSCAAHVKE ALEKVPGVQS ALVSYPKGTA QLAIVPGTSP DALTAAVAGL GYKATLADAP LADNRVGLLD KVRGWMAAAE KHSGNEPPVQ
VAVIGSGGAA MAAALKAVEQ GAQVTLIERG TIGGTCVNVG CVPSKIMIRA AHIAHLRRES PFDGGIAATV PTIDRSKLLA QQQARVDELR HAKYEGILGG
NPAITVVHGE ARFKDDQSLT VRLNEGGERV VMFDRCLVAA GASPAVPPIP GLKESPYWTS TEALASDTIP ERLAVIGSSV VALELAQAFA RLGSKVTVLA
RNTLFFREDP AIGEAVTAAF RAEGIEVLEH TQASQVAHMD GEFVLTTTHG ELRADKLLVA TGRTPNTRSL ALDAAGVTVN AQGAIVIDQG MRTSNPNIYA
AGDCTDQPQF VYVAAAAGTR AAINMTGGDA ALDLTAMPAV VFTDPQVATV GYSEAEAHHD GIETDSRTLT LDNVPRALAN FDTRGFIKLV IEEGSHRLIG
VQAVAPEAGE LIQTAALAIR NRMTVQELAD QLFPYLTMVE GLKLAAQTFN KDVKQLSCCA G

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn4380 366 2953-3318 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MNAYTVSRLA LDAGVSVHIV RDYLLRGLLR PVACTPGGYG LFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGDE AAAQLALLRQ FVERRREALA
DLEVQLATLP TEPAQHAESL P

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn4380 237 3315-3551 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MNNPERLPSE THKPITGYLW GGLAVLTCPC HLPILAVVLA GTTAGAFLGE HWVIAALGLT GLFLLSLSRA LRAFRERE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM UrfM Tn4380 1002 3548-4549 +
Class:   Passenger Gene
Sub Class:   Other
Function:   possible diguanylate phosphodiesterase
Sequence Family:  EAL (Pfam:PF00563)||DUF3330 (Pfam:PF11809)
Comment:   similar to urfM from E.coli
Protein Sequence:  
MSAFRPDGWT TPELAQAVER GQLELHYQPV VDLRSGGIVG AEALLRWRHP TLGLLPPGQF LPVVESSGLM PEIGAWVLGE ACRQMRDWRM LAWRPFRLAV
NVSASQVGPD FDGWVKGVLA DAELPAEYLE IELTESVAFG DPAIFPALDA LRQIGVRFAA DDFGTGYSCL QHLKCCPIST LKIDQSFVAG LANDRRDQTI
VHTVIQLAHG LGMDVVAEGV ETSASLDLLR QADCDTGQGF LFAKPMPAAA FAVFVSQWRG ATMNASDSTT TSCCVCCKEI PLDAAFTPEG AEYVEHFCGL
ECYQRFEAQA HRLRPRQQLR PEPRTAARTD PGG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn4380 483 4542-5024 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
VDKVFTDKAS GKDTRRPELE RLLAFVREGD TVVVHSMDRL ARNLDDLRRL VQGLTQRGVR IEFLKEHLTF TGEDSPMANL MLSVMGAFAE FERALIRERQ
REGIALAKQR GAYRGRKKSL SSERIAELRQ RVEAGEQKTK LAREFGISRE TLYQYLRTDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn4380 2967 5027-7993 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRSILSAA ERESLLALPD TKDELIRHYT FSETDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEP PFPPLLKLVA DQLKVSVESW DEYGQREQTR
REHLVELQTV FGFQPFTMGH YRQAVQLLTE MALQTDKGIV LASTLIEHLR QQSVILPALN AVERASAEAI TRANRRIYDA LAEPLSDAHR RRLDDLLKRR
DNGKTTWLAW LRQSPVKPNS RHMLEHIERL KAWQALDLPS GIERSVHQNR LLKIAREGGQ MTPADLAKFE AQRRYATLVA LAIEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLF GRIGQALIEA KQAGRDPFAA IEAVMSWDAF AESVTEAQKL AQPEDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKD VLDAIEVLRG MNSDNARKVP ADAPTEFIKP RWQKLVMTDT GIDRRYYELC ALSEMKNALR SGDIWVQGSR QFKDFEDYLV PPAKFASLKQ
ASELPLAVAT DCNRYLNDRL TLLETQLATV NRMATANELP DAIITESGLK ITPLDAAVPD TAQALIDQTA MILPHVKITE LLLEVDEWTG FTRHFAHLKS
GDPAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHIRDET YGAALADLVN AQFRHPFAEH WGDGTTSSSD GQNFRTGSKA ESTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AVVLWNTVYL ERAAHALRGN GHAVDDALLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA

 References     

1.Monchy S, Benotmane MA, Janssen P, Vallaeys T, Taghavi S, van der Lelie D, Mergeay M. Plasmids pMOL28 and pMOL30 of Cupriavidus metallidurans are specialized in the maximal viable response to heavy metals. J Bacteriol. 2007 Oct;189(20):7417-25. doi: 10.1128/JB.00375-07. Epub 2007 Aug 3. PubMed ID: 17675385
2.Monchy S, Benotmane MA, Wattiez R, van Aelst S, Auquier V, Borremans B, Mergeay M, Taghavi S, van der Lelie D, Vallaeys T. Transcriptomic and proteomic analyses of the pMOL30-encoded copper resistance in Cupriavidus metallidurans strain CH34. Microbiology. 2006 Jun;152(Pt 6):1765-76. doi: 10.1099/mic.0.28593-0. PubMed ID: 16735739