Transposon
Name: Tn4001       (Synonyms: Tn4003| Tn3706| Tn5281)
Family: Compound Transposon        Group: IS256
Evidence of Transposition: yes
 Host     

Host Organism:Staphylococcus aureus strain SK529 Molecular Source:plasmid pSK1
Place of Origin:Melbourne, Australia Date of Isolation:1984
Other Geographic Information:metropolitan hospitals

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 26 bp)GATAAAGTCCGTATAATTGTGTAAAA
IRL (Length: 26 bp)GATAAAGTCCGTATAATTGTGTAAAA

 Sequence     
DNA SequenceLength  4554 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GATAAAGTCC GTATAATTGT GTAAAAGTAA AAAGGCCATA TAACAGTCCT TTTACGGTAC AATGTTTTTA ACGACAAAAA CATACCCAGG AGGACTTTTA 100
CATGACCCAA GTACATTTTA CACTGAAAAG CGAAGAGATT CAAAGCATTA TTGAATATTC TGTAAAGGAT GACGTTTCTA AAAATATTTT AACAACGGTA 200
TTTAATCAAC TAATGGAAAA TCAACGAACA GAATATATTC AAGCAAAAGA ATATGAACGA ACAGAAAACC GACAAAGTCA ACGAAATGGC TATTATGAGC 300
GCAGCTTTAC GACACGTGTA GGCACGCTAG AATTAAAAGT ACCCAGAACA CGTGATGGCC ATTTTTCACC CACAGTGTTT GAACGTTATC AACGAAACGA 400
AAAAGCCCTC ATGGCTTCAA TGTTGGAAAT GTATGTATCA GGCGTTTCAA CTCGTAAAGT ATCAAAAATT GTGGAAGAAC TTTGTGGTAA ATCCGTCTCT 500
AAGTCCTTCG TTTCTAGCTT AACAGAACAG CTAGAACCTA TGGTTAACGA GTGGCAGAAT CGTTTATTAT CAGAAAAAAA TTATCCTTAC TTAATGACCG 600
ATGTACTCTA TATAAAAGTA CGAGAAGAAA ATCGAGTACT CTCAAAAAGC TGTCATATAG CGATTGGAAT AACCAAAGAT GGCGACCGTG AAATTATCGG 700
CTTCATGATT CAAAGTGGCG AAAGCGAAGA GACCTGGACA ACATTTTTTG AATACCTAAA AGAACGCGGT TTACAAGGTA CGGAACTCGT TATTTCTGAT 800
GCGCACAAAG GATTAGTCTC TGCCATTAGA AAATCCTTCA CCAACGTAAG TTGGCAAAGA TGCCAAGTTC ACTTCCTAAG AAATATCTTT ACCACCATTC 900
CTAAAAAAAT TCAAAATCTT TCAGAGAAGC TGTTAAAGGA ATTTTTAAGT TCACAGATAT TAACTTAGCG CGTGAGGCTA AAAATCGATT GATTCATGAT 1000
TATATCGATC AACCAAAATA TTCAAAAGCT TGCGCATCAT TGGATGATGG ATTCGAAGAC GCCTTTCAAT ATACCGTACA AGGAAATTCC CACAATCGAC 1100
TAAAGAGTAC CAATCTAATT GAACGACTGA ATCAAGAAGT ACGCAGAAGA GAAAAGATTA TTCGCATCTT CCCCAATCAA ACATCAGCCA ATCGCTTAAT 1200
TGGAGCCGTT CTTATGGACC TACATGATGA ATGGATTTAT TCTTCAAGAA AATACATCAA TTTTGATAAG TAGAAATGGT AAAAACATTG TATAGCATTT 1300
TACACAGGAG TCTGGACTTG ACTAGAAGTT TTAATTGATG ATAATATGGT TTTTGATATT GATAATTTAA AAGGATTTCT TAATGATACC AGTTCATTTG 1400
GGTTTATAGC TAAAGAAAAT AATAAAATTA TAGGATTTGC ATATTGCTAT ACACTTTTAA GACCTGATGG AAAAACAATG TTTTATTTAC ACTCAATAGG 1500
AATGTTACCT AACTATCAAG ACAAAGGTTA TGGTTCAAAA TTATTATCTT TTATTAAGGA ATATTCTAAA GAGATTGGTT GTTCTGAAAT GTTTTTAATA 1600
ACTGATAAAG GTAATCCTAG AGCTTGCCAT GTATATGAAA AATTAGGTGG TAAAAATGAT TATAAAGATG AAATAGTATA TGTATATGAT TATGAAAAAG 1700
GTGATAAATA AATGAATATA GTTGAAAATG AAATATGTAT AAGAACTTTA ATAGATGATG ATTTTCCTTT GATGTTAAAA TGGTTAACTG ATGAAAGAGT 1800
ATTAGAATTT TATGATGGTA GAGATAAAAA ATATACATTA GAATCATTAA AAAAACATTA TACAGAGCCT TGGGAAGATG AAGTTTTTAG AGTAATTATT 1900
GAATATAACA ATGTTCCTAT TGGATATGGA CAAATATATA AAATGTATGA TGAGTTATAT ACTGATTATC ATTATCCAAA AACTGATGAG ATAGTCTATG 2000
GTATGGATCA ATTTATAGGA GAGCCAAATT ATTGGAGTAA AGGAATTGGT ACAAGATATA TTAAATTGAT TTTTGAATTT TTGAAAAAAG AAAGAAATGC 2100
TAATGCAGTT ATTTTAGACC CTCATAAAAA TAATCCAAGA GCAATAAGGG CATACCAAAA ATCTGGTTTT AGAATTATTG AAGATTTGCC AGAACATGAA 2200
TTACACGAGG GCAAAAAAGA AGATTGTTAT TTAATGGAAT ATAGATATGA TGATAATGCC ACAAATGTTA AGGCAATGAA ATATTTAATT GAGCATTACT 2300
TTGATAATTT CAAAGTAGAT AGTATTGAAA TAATCGGTAG TGGTTATGAT AGTGTGGCAT ATTTAGTTAA TAATGAATAC ATTTTTAAAA CAAAATTTAG 2400
TACTAATAAG AAAAAAGGTT ATGCAAAAGA AAAAGCAATA TATAATTTTT TAAATACAAA TTTAGAAACT AATGTAAAAA TTCCTAATAT TGAATATTCG 2500
TATATTAGTG ATGAATTATC TATACTAGGT TATAAAGAAA TTAAAGGAAC TTTTTTAACA CCAGAAATTT ATTCTACTAT GTCAGAAGAA GAACAAAATT 2600
TGTTAAAACG AGATATTGCC AGTTTTTTAA GACAAATGCA CGGTTTAGAT TATACAGATA TTAGTGAATG TACTATTGAT AATAAACAAA ATGTATTAGA 2700
AGAGTATATA TTGTTGCGTG AAACTATTTA TAATGATTTA ACTGATATAG AAAAAGATTA TATAGAAAGT TTTATGGAAA GACTAAATGC AACAACAGTT 2800
TTTGAGGGTA AAAAGTGTTT ATGCCATAAT GATTTTAGTT GTAATCATCT ATTGTTAGAT GGCAATAATA GATTAACTGG AATAATTGAT TTTGGAGATT 2900
CTGGAATTAT AGATGAATAT TGTGATTTTA TATACTTACT TGAAGATAGT GAAGAAGAAA TAGGAACAAA TTTTGGAGAA GATATATTAA GAATGTATGG 3000
AAATATAGAT ATTGAGAAAG CAAAAGAATA TCAAGATATA GTTGAAGAAT ATTATCCTAT TGAAACTATT GTTTATGGAA TTAAAAATAT TAAACAGGAA 3100
TTTATCGAAA ATGGTAGAAA AGAAATTTAT AAAAGGACTT ATAAAGATTG ATTATATAAT ATATGAAAAG CTATTATAAA AGACATTAGT ATTAAATAGT 3200
TTAAAAAAAT GAAAAATAAT AAAGGAAGTG AGTCAAGTCC AGACTCCTGT GTAAAATGCT ATACAATGTT TTTACCATTT CTACTTATCA AAATTGATGT 3300
ATTTTCTTGA AGAATAAATC CATTCATCAT GTAGGTCCAT AAGAACGGCT CCAATTAAGC GATTGGCTGA TGTTTGATTG GGGAAGATGC GAATAATCTT 3400
TTCTCTTCTG CGTACTTCTT GATTCAGTCG TTCAATTAGA TTGGTACTCT TTAGTCGATT GTGGGAATTT CCTTGTACGG TATATTGAAA GGCGTCTTCG 3500
AATCCATCAT CCAATGATGC GCAAGCTTTT GAATATTTTG GTTGATCGAT ATAATCATGA ATCAATCGAT TTTTAGCCTC ACGCGCTAAG TTAATATCTG 3600
TGAACTTAAA AATTCCTTTA ACAGCTTCTC TGAAAGATTT TGAATTTTTT TTAGGAATGG TGGTAAAGAT ATTTCTTAGG AAGTGAACTT GGCATCTTTG 3700
CCAACTTACG TTGGTGAAGG ATTTTCTAAT GGCAGAGACT AATCCTTTGT GCGCATCAGA AATAACGAGT TCCGTACCTT GTAAACCGCG TTCTTTTAGG 3800
TATTCAAAAA ATGTTGTCCA GGTCTCTTCG CTTTCGCCAC TTTGAATCAT GAAGCCGATA ATTTCACGGT CGCCATCTTT GGTTATTCCA ATCGCTATAT 3900
GACAGCTTTT TGAGAGTACT CGATTTTCTT CTCGTACTTT TATATAGAGT ACATCGGTCA TTAAGTAAGG ATAATTTTTT TCTGATAATA AACGATTCTG 4000
CCACTCGTTA ACCATAGGTT CTAGCTGTTC TGTTAAGCTA GAAACGAAGG ACTTAGAGAC GGATTTACCA CAAAGTTCTT CCACAATTTT TGATACTTTA 4100
CGAGTTGAAA CGCCTGATAC ATACATTTCC AACATTGAAG CCATGAGGGC TTTTTCGTTT CGTTGATAAC GTTCAAACAC TGTGGGTGAA AAATGGCCAT 4200
CACGTGTTCT GGGTACTTTT AATTCTAGCG TGCCTACACG TGTCGTAAAG CTGCGCTCAT AATAGCCATT TCGTTGACTT TGTCGGTTTT CTGTTCGTTC 4300
ATATTCTTTT GCTTGAATAT ATTCTGTTCG TTGATTTTCC ATTAGTTGAT TAAATACCGT TGTTAAAATA TTTTTAGAAA CGTCATCCTT TACAGAATAT 4400
TCAATAATGC TTTGAATCTC TTCGCTTTTC AGTGTAAAAT GTACTTGGGT CATGTAAAAG TCCTCCTGGG TATGTTTTTG TCGTTAAAAA CATTGTACCG 4500
TAAAAGGACT GTTATATGGC CTTTTTACTT TTACACAATT ATACGGACTT TATC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnp_truncated IS256.var1 102-968 Transposase   +
GNAT_fam Tn4001 1346-1711 Passenger Gene Antibiotic Resistance +
AAC(6')-Ie-APH(2'')-Ia (ARO:3002597) Tn4001 1712-3151 Passenger Gene Antibiotic Resistance +
tnp IS256 3281-4453 Transposase   -

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp_truncated Tnp_truncated IS256.var1 867 102-968 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   1bp deletion relative to tnp (IS256) causes frameshift and premature termination
Protein Sequence:  
MTQVHFTLKS EEIQSIIEYS VKDDVSKNIL TTVFNQLMEN QRTEYIQAKE YERTENRQSQ RNGYYERSFT TRVGTLELKV PRTRDGHFSP TVFERYQRNE
KALMASMLEM YVSGVSTRKV SKIVEELCGK SVSKSFVSSL TEQLEPMVNE WQNRLLSEKN YPYLMTDVLY IKVREENRVL SKSCHIAIGI TKDGDREIIG
FMIQSGESEE TWTTFFEYLK ERGLQGTELV ISDAHKGLVS AIRKSFTNVS WQRCQVHFLR NIFTTIPKKI QNLSEKLLKE FLSSQILT

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
GNAT_fam GNAT_fam Tn4001 366 1346-1711 +
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  Acetyltransf_1 (Pfam:PF00583)
Comment:   putative acetyltransferase
Protein Sequence:  
MVFDIDNLKG FLNDTSSFGF IAKENNKIIG FAYCYTLLRP DGKTMFYLHS IGMLPNYQDK GYGSKLLSFI KEYSKEIGCS EMFLITDKGN PRACHVYEKL
GGKNDYKDEI VYVYDYEKGD K

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
AAC(6')-Ie-APH(2'')-Ia (ARO:3002597) AAC(6')-Ie-APH(2'')-Ia Tn4001 1440 1712-3151 +
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  APH(2'') (ARO:3000128)||AAC(6') (ARO:3000345)
Comment:   strict match to reference sequence for ARO:3002597 (bitscore: 966)||Synonyms: aac(6')-bifunctional aacA-aphD APH(2''), aph(2'')-bifunctional, AAC(6')-APH(2'')
Protein Sequence:  
MNIVENEICI RTLIDDDFPL MLKWLTDERV LEFYDGRDKK YTLESLKKHY TEPWEDEVFR VIIEYNNVPI GYGQIYKMYD ELYTDYHYPK TDEIVYGMDQ
FIGEPNYWSK GIGTRYIKLI FEFLKKERNA NAVILDPHKN NPRAIRAYQK SGFRIIEDLP EHELHEGKKE DCYLMEYRYD DNATNVKAMK YLIEHYFDNF
KVDSIEIIGS GYDSVAYLVN NEYIFKTKFS TNKKKGYAKE KAIYNFLNTN LETNVKIPNI EYSYISDELS ILGYKEIKGT FLTPEIYSTM SEEEQNLLKR
DIASFLRQMH GLDYTDISEC TIDNKQNVLE EYILLRETIY NDLTDIEKDY IESFMERLNA TTVFEGKKCL CHNDFSCNHL LLDGNNRLTG IIDFGDSGII
DEYCDFIYLL EDSEEEIGTN FGEDILRMYG NIDIEKAKEY QDIVEEYYPI ETIVYGIKNI KQEFIENGRK EIYKRTYKD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp Tnp IS256 1173 3281-4453 -
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MTQVHFTLKS EEIQSIIEYS VKDDVSKNIL TTVFNQLMEN QRTEYIQAKE YERTENRQSQ RNGYYERSFT TRVGTLELKV PRTRDGHFSP TVFERYQRNE
KALMASMLEM YVSGVSTRKV SKIVEELCGK SVSKSFVSSL TEQLEPMVNE WQNRLLSEKN YPYLMTDVLY IKVREENRVL SKSCHIAIGI TKDGDREIIG
FMIQSGESEE TWTTFFEYLK ERGLQGTELV ISDAHKGLVS AIRKSFTNVS WQRCQVHFLR NIFTTIPKKN SKSFREAVKG IFKFTDINLA REAKNRLIHD
YIDQPKYSKA CASLDDGFED AFQYTVQGNS HNRLKSTNLI ERLNQEVRRR EKIIRIFPNQ TSANRLIGAV LMDLHDEWIY SSRKYINFDK

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
IS256.var1-GU235985 IS256.var1 Insertion Sequence 1-1323 1323
IS256-M18086 IS256 Insertion Sequence 3231-4554 1324

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRR IS256.var1 1298-1323 AAAATGTGTC CTCAGACCTG AACTGA
IRR IS256 3231-3256 AGTCAAGTCC AGACTCCTGT GTAAAA

 References     

1.Lyon BR, May JW, Skurray RA. Tn4001: a gentamicin and kanamycin resistance transposon in Staphylococcus aureus. Mol Gen Genet. 1984;193(3):554-6. PubMed ID: 6323927
2.Lyon BR, Gillespie MT, Byrne ME, May JW, Skurray RA. Plasmid-mediated resistance to gentamicin in Staphylococcus aureus: the involvement of a transposon. J Med Microbiol. 1987 Mar;23(2):101-10. doi: 10.1099/00222615-23-2-101. PubMed ID: 3031300
3.Gillespie MT, Lyon BR, Messerotti LJ, Skurray RA. Chromosome. J Med Microbiol. 1987 Sep;24(2):139-44. doi: 10.1099/00222615-24-2-139. PubMed ID: 2821261
4.Rouch DA, Byrne ME, Kong YC, Skurray RA. The aacA-aphD gentamicin and kanamycin resistance determinant of Tn4001 from Staphylococcus aureus: expression and nucleotide sequence analysis. J Gen Microbiol. 1987 Nov;133(11):3039-52. doi: 10.1099/00221287-133-11-3039. PubMed ID: 2833561
5.Mahairas GG, Minion FC. Random insertion of the gentamicin resistance transposon Tn4001 in Mycoplasma pulmonis. Plasmid. 1989 Jan;21(1):43-7. PubMed ID: 2543007
6.Mahairas GG, Lyon BR, Skurray RA, Pattee PA. Genetic analysis of Staphylococcus aureus with Tn4001. J Bacteriol. 1989 Jul;171(7):3968-72. doi: 10.1128/jb.171.7.3968-3972.1989. PubMed ID: 2544565
7.Prudhomme M, Turlan C, Claverys JP, Chandler M. Diversity of Tn4001 transposition products: the flanking IS256 elements can form tandem dimers and IS circles. J Bacteriol. 2002 Jan;184(2):433-43. doi: 10.1128/jb.184.2.433-443.2002. PubMed ID: 11751820
8.Hodel-Christian SL, Murray BE. Characterization of the gentamicin resistance transposon Tn5281 from Enterococcus faecalis and comparison to staphylococcal transposons Tn4001 and Tn4031. Antimicrob Agents Chemother. 1991 Jun;35(6):1147-52. doi: 10.1128/aac.35.6.1147. PubMed ID: 1656854
9.Horaud T, de Cespedes G, Trieu-Cuot P. Chromosomal gentamicin resistance transposon Tn3706 in Streptococcus agalactiae B128. Antimicrob Agents Chemother. 1996 May;40(5):1085-90. PubMed ID: 8723445
10.Chen L, Mediavilla JR, Smyth DS, Chavda KD, Ionescu R, Roberts RB, Robinson DA, Kreiswirth BN. Identification of a novel transposon (Tn6072) and a truncated staphylococcal cassette chromosome mec element in methicillin-resistant Staphylococcus aureus ST239. Antimicrob Agents Chemother. 2010 Aug;54(8):3347-54. doi: 10.1128/AAC.00001-10. Epub 2010 May 17. PubMed ID: 20479198