Transposon
Name: Tn4
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Salmonella enterica subsp. enterica serovar Paratyphi B Molecular Source:plasmid R1

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  23009 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGCACCT CAGAAAACGG AAAATAAAGC ACGCTAAGGC ATAGCTGACC TTGCCAGGCC TGCTTCGCCC TGTAGTGACG CGATCAACGG GCAGGAAACA 100
TTCCCCTTTC GTGCATGGCA GGCGCACACG AGTTCAGACA GCACGGTTTC CATGCGCGCC AAGTCGGCCA TCTTCTCGCG CACGTCCTTG AGCTTGTGTT 200
CGGCCAGGCT GCTGGCCTCC TCGCAGTGGG TGCCATCGTC GAGCCGCAAC AGCTCGGCAA TCTCGTCCAG ACTGAACCCC AGCCGCTGTG CCGATTTCAC 300
GAATTTCACC CGAACCACGT CCGCCTCCCC ATAGCGGCGG ATGCTGCCGT AAGGCTTGTC CGGTTCCCGC AACAGGCCCT TGCGCTGATA GAAGCGGATT 400
GTCTCCACGT TGACCCCGGC CGCCTTGGCA AAAACGCCAA TGGTCAGGTT TTCCAAATTA TTTTCCATAT CGCTTGACTC CGTACATGAG TACGGAAGTA 500
AGGTTACGCT ATCCAATCCA AATTCAAAAG GGCCAACGTA TGTCTGAACC ACAAAACGGG CGCGGTGCGC TCTTCGCCGG CGGGCTGGCC GCCATTCTTG 600
CATCGACCTG CTGCCTGGGG CCGCTAGTAC TGGTCGCCCT GGGCTTCTCC GGTGCTTGGA TCGGCAACCT GACGGTGCTG GAACCCTATC GACCGTTGTT 700
CATCGGCGCG GCGCTAGTGG CGCTGTTCTT CGCCTGGAAG CGGATTTACC GGCCCGTGCA GGCATGCAAG CCAGGTGAGG TCTGCGCGAT TCCGCAGGTG 800
CGCGCCACCT ACAAGCTGAT TTTCTGGATC GTGGCCGTGC TGGTCCTGGT CGCGCTTGGA TTTCCCTATG TCGTTCCATT TTTCTATTAA CCAGGAGTTC 900
ATCATGAAGA AACTGTTTGC CTCCCTTGCC CTCGCCGCCG CTGTTGCCCC GGTGTGGGCC GCTACCCAGA CCGTCACGCT AGCGGTTCCC GGCATGACTT 1000
GCGCCGCCTG CCCGATCAGG GGTCTGACGC TCAGTGGAAC GAAAACTCAC GTTAAGGGAT TTTGGTCATG AGATTATCAA AAAGGATCTT CACCTAGATC 1100
CTTTTAAATT AAAAATGAAG TTTTAAATCA ATCTAAAGTA TATATGAGTA AACTTGGTCT GACAGTTACC AATGCTTAAT CAGTGAGGCA CCTATCTCAG 1200
CGATCTGTCT ATTTCGTTCA TCCATAGTTG CCTGACTCCC CGTCGTGTAG ATAACTACGA TACGGGAGGG CTTACCATCT GGCCCCAGTG CTGCAATGAT 1300
ACCGCGAGAC CCACGCTCAC CGGCTCCAGA TTTATCAGCA ATAAACCAGC CAGCCGGAAG GGCCGAGCGC AGAAGTGGTC CTGCAACTTT ATCCGCCTCC 1400
ATCCAGTCTA TTAATTGTTG CCGGGAAGCT AGAGTAAGTA GTTCGCCAGT TAATAGTTTG CGCAACGTTG TTGCCATTGC TGCAGGCATC GTGGTGTCAC 1500
GCTCGTCGTT TGGTATGGCT TCATTCAGCT CCGGTTCCCA ACGATCAAGG CGAGTTACAT GATCCCCCAT GTTGTGCAAA AAAGCGGTTA GCTCCTTCGG 1600
TCCTCCGATC GTTGTCAGAA GTAAGTTGGC CGCAGTGTTA TCACTCATGG TTATGGCAGC ACTGCATAAT TCTCTTACTG TCATGCCATC CGTAAGATGC 1700
TTTTCTGTGA CTGGTGAGTA CTCAACCAAG TCATTCTGAG AATAGTGTAT GCGGCGACCG AGTTGCTCTT GCCCGGCGTC AACACGGGAT AATACCGCGC 1800
CACATAGCAG AACTTTAAAA GTGCTCATCA TTGGAAAACG TTCTTCGGGG CGAAAACTCT CAAGGATCTT ACCGCTGTTG AGATCCAGTT CGATGTAACC 1900
CACTCGTGCA CCCAACTGAT CTTCAGCATC TTTTACTTTC ACCAGCGTTT CTGGGTGAGC AAAAACAGGA AGGCAAAATG CCGCAAAAAA GGGAATAAGG 2000
GCGACACGGA AATGTTGAAT ACTCATACTC TTCCTTTTTC AATATTATTG AAGCATTTAT CAGGGTTATT GTCTCATGAG CGGATACATA TTTGAATGTA 2100
TTTAGAAAAA TAAACAAATA GGGGTTCCGC GCACATTTCC CCGAAAAGTG CCACCTGACG TCTAAGAAAC CATTATTATC ATGACATTAA CCTATAAAAA 2200
TAGGCGTATC ACGAGGCCCT TTCGTCTTCA AGAATTTTAT AAACCGTGGA GCGGGCAATA CTGAGCTGAT GAGCAATTTC CGTTGCACCA GTGCCCTTCT 2300
GATGAAGCGT CAGCACGACG TTCCTGTCCA CGGTACGCCT GCGGCCAAAT TTGATTCCTT TCAGCTTTGC TTCCTGTCGG CCCTCATTCG TGCGCTCTAG 2400
GATCCTCCGG CGTTCAGCCT GTGCCACAGC CGACAGGATG GTGACCACCA TTTGCCCCAT ATCACCGTCG GTACTGATCC CGTCGTCAAT AAACCGAACC 2500
GCTACACCCT GAGCATCAAA CTCTTTTATC AGTTGGATCA TGTCGGCGGT GTCGCGGCCA AGACGGTCGA GCTTCTTCAC CAGAATGACA TCACCTTCCT 2600
CCACCTTCAT CCTCAGCAAA TCCAGCCCTT CCCGATCTGT TGAACTGCCG GATGCCTTGT CGGTAAAGAT GCGGTTAGCT TTTACCCCTG CATCTTTGAG 2700
CGCTCTGATC TGAATATCGA GGGACTGCTG GCTGGTTGAG ACCCGCGCAT AACCAAAAAT TCGCATAAAA ATGTACCTTA AATCGAATAT CAGACACGAT 2800
GTGTCTATTA TGCCAAAATG ACGATTTAAT GGACACTCAA ACGAAGCCGT TTTACTATGT CTGATAATTT ATAATATTTC GAACGGTTGC AGTTGTGTTA 2900
AAAAAGCCGT CAGGCAGGGA GGCCGATATG CCCGTTGATT TTTTGACCAC TGAGCAGGTT GAGAGTTATG GCAGGTTCAC TGGCGAACCC GATGAACTTC 3000
AGCTGGCGCG TTATTTTCAT CTTGATGAAG CGGATAAAGA ATTTATCGGG AAAAGCCGGG GTGATCACAA TCGACTTGGT ATTGCCCTGC AAATCGGGTG 3100
TGTGCGTTTT CTGGGCACTT TTCTTACTGA CATGAATCAT ATTCCTTCCG GCGTCCGGCA TTTTACCGCC AGACAGCTCG GGATTCGTGA TATCACCGTT 3200
CTTGCAGAAT ACGGTCAGAG GGAAAATACC CGCCGTGAGC ATGCAGCGCT GATACGTCAG CACTATCAGT ATCGTGAATT TGCCTGGCCC TGGACATTTC 3300
GCCTTACCCG TCTTTTATAT ACCCGGAGCT GGATAAGCAA CGAACGTCCT GGCCTGCTTT TCGACCTGGC GACAGGGTGG CTTATGCAAC ATCGTATTAT 3400
TCTCCCCGGA GCCACCACGC TGACCCGGTT GATTTCAGAG GTAAGGGAAA AGGCGACGTT GCGCCTGTGG AACAAACTGG CACTGATACC GTCAGCCGAA 3500
CAGCGTTCAC AGCTGGAGAT GCTGCTGGGG CCAACTGATT GCAGCCGCCT GTCTTTACTG GAATCACTGA AAAAAGGCCC TGTGACCATC AGTGGTCCGG 3600
CGTTTAATGA AGCAATTGAA CGCTGGAAAA CTCTGAACGA TTTTGGCCTG CATGCTGAAA ACCTGAGTAC ACTCCCGGCT GTGCGCCTGA AAAATCTCGC 3700
ACGTTATGCT GGTATGACTT CGGTGTTCAA TATTGCCAGG ATGTCACCGC AGAAAAGGAT GGCGGTTCTG GTTGCCTTTG TCCTTGCATG GGAAACGCTG 3800
GCGCTGGATG ATGCACTGGA CGTTCTGGAC GCCATGCTGG CCGTTATCAT CCGTGACGCC AGAAAGATTG GGCAGAAAAA ACGGCTCCGC TCGCTGAAGG 3900
ATCTGGATAA ATCTGCATTG GCGCTCGCCA GCGCATGTTC GTACTTGCTG AAAGAAGAAA CACCGGACGA ATCGATTCGT GCTGAGGTGT TCAGCTACAT 4000
CCCTAGGCAA AAGCTGGCTG AAATCATCAC GCTTGTCCGT GAAATTGCCC GGCCCTCAGA CGATAATTTT CATGACGAAA TGGTGGAGCA GTACGGGCGC 4100
GTTCGTCGTT TCCTGCCCCA TCTGCTGAAT ACCGTTAAAT TTTCATCCGC ACCTGCCGGG GTTACCACTC TGAATGCCTG TGACTACCTC AGCCGGGAGT 4200
TCAGCTCACG GCGGCAGTTT TTTGACGACG CACCAACGGA AATCATCAGT CAGTCATGGA AACGGCTGGT GATTAACAAG GAAAAACATA TCACCCGAAG 4300
GGGATACACG CTCTGCTTTC TCAGTAAACT GCAGGATAGT CTGAGACGGA GGGATGTCTA CGTTACCGGC AGTAACCGGT GGGGAGATCC TCGTGCAAGA 4400
TTACTACAGG GTGCTGACTG GCAGGCAAAT CGGATTAAGG TTTATCGTTC TTTGGGGCAC CCGACAGACC CGCAGGAAGC AATAAAATCT CTGGGCCATC 4500
AGCTTGATAG TCGTTACAGA CAGGTTGCTG CACGTCTTGG CGAAAATGAG GCTGTCGAAC TCGATGTTTC TGGCCCGAAG CCCCGGTTGA CAATTTCTCC 4600
CCTCGCCAGT CTTGATGAGC CGGACAGTCT GAAACGACTG AGCAAAATGA TCAGTGATCT GCTCCCTCCG GTGGATTTAA CGGAGTTGCT GCTCGAAATT 4700
AACGCCCATA CCGGATTTGC TGATGAGTTT TTCCATGCCA GTGAAGCCAG TGCCAGAGTT GATGATCTGC CCGTCAGCAT CAGCGCCGTG CTGATGGCTG 4800
AAGCCTGCAA TATCGGTCTG GAACCACTGA TCAGATCAAA TGTTCCTGCA CTGACCCGAC ACCGGCTGAA CTGGACAAAA GCGAACTATC TGCGGGCTGA 4900
AACTATCACC AGCGCTAATG CCAGACTGGT TGATTTTCAG GCAACGCTGC CACTGGCACA GATATGGGGT GGAGGAGAAG TGGCATCTGC AGATGGAATG 5000
CGCTTTGTTA CGCCAGTCAG AACAATCAAT GCCGGACCGA ACCGCAAATA CTTTGGTAAT AACAGAGGGA TCACCTGGTA CAACTTTGTG TCCGATCAGT 5100
ATTCCGGCTT TCATGGCATC GTTATACCGG GGACGCTGAG GGACTCTATC TTTGTGCTGG AAGGCCTTCT GGAACAGGAG ACCGGGCTGA ATCCAACCGA 5200
AATTATGACC GATACGGCAG GTGCCAGCGA TCTTGTCTTT GGCCTTTTCT GGCTGCTGGG ATACCAGTTT TCTCCACGCC TGGCTGATGC CGGTGCTTCG 5300
GTTTTCTGGC GAATGGACCA TGATGCCGAC TATGGCGTGC TGAATGATAT TGCCAGAGGG CAATCAGATC CCCGAAAAAT AGTCCTTCAG TGGGACGAAA 5400
TGATCCGGAC CGCAGGCTCC CTGAAGCTGG GCAAAGTACA GGCCTCAGTG CTGGTCCGTT CATTGCTGAA AAGTGAACGT CCCTCCGGAC TGACTCAGGC 5500
AATCATTGAA GTGGGGCGCA TCAACAAAAC GCTGTATCTG CTTAATTATA TTGATGATGA AGATTACCGC CGGCGCATTC TGACCCAGCT TAATCGGGGA 5600
GAAAGCCGTC ATGCAGTTGC CAGAGCCATC TGTCACGGTC AAAAAGGTGA GATAAGAAAA CGATATACCG ACGGTCAGGA AGATCAGTTG GGAGCTCTGG 5700
GGCTGGTCAC TAACGCCGTC GTGTTATGGA ACACTATTTA TATGCAGGCA GCTCTGGATC ATCTCCGGGC GCAGGGTGAA ACACTGAATG ATGAAGATAT 5800
CGCACGCCTC TCCCCGCTTT GCCACGGACA TATCAATATG CTCGGCCATT ATTCCTTCAC GCTGGCAGAA CTGGTGACCA AAGGTCATCT GAGACCATTA 5900
AAAGAGGCGT CAGAGGCAGA AAACGTTGCT TAACGTGAGT TTTCGTTCCA CTGAGCGTCA GACCCCGATC ACAGTCAAGA AAGCGCTCTC CAAGGTCGAA 6000
GGCGTGAGCA AGGTCGATGT GGGCTTCGAG AAGCGCGAGG CCGTCGTCAC TTTTGACGAC ACCAAGGCCA GCGTACAGAA GCTGACCAAG GCCACCGCAG 6100
ACGCCGGCTA TCCGTCCAGC GTCAAGCAGT GAGCCAGCAA GCCAACGACA ACAGCGAGAG CCGCTTCATG GGACTGATGA CACGCATTGC CGATAAAACC 6200
GGCGCGCTCG GCAGCGTCGT TTCCGCGATG GGCTGCGCCG CCTGCTTTCC AGCCCTCGCC AGCTTCGGCG CGGCCATCGG GCTGGGCTTC TTGAGCCAGT 6300
ACGAGGGACT GTTCATCAGC CGCCTGCTGC CGCTGTTTGC CGCGCTGGCC TTCCTGGCGA ACGCGCTGGG TTGGTTCAGT CATCGGCAAT GGCTGCGCAG 6400
TCTGCTCGGC ATGATCGGCC CGGCCATCGT GTTTGCGGCC ACGGTCTGGC TGCTCGGCAA CTGGTGGACG GCGAACCTGA TGTACGTCGG CCTGGCCTTG 6500
ATGATTGGGG TGTCGATCTG GGACTTCGTG TCGCCGGCGC ATCGCCGTTG CGGACCGGAC GGCTGCGAAC TCCCCGCCAA GCGCTTGTGA AAGACGGCTG 6600
ACCGTGCGAC ACGGCGGCCC ACACGAATAA GGAACGATGG TATGAGCACT CTCAAAATCA CCGGCATGAC TTGCGACTCG TGCGCAGTGC ATGTCAAGGA 6700
CGCCCTGGAG AAAGTGCCCG GCGTGCAATC AGCGGATGTC TCCTACGCCA AGGGCAGCGC CAAGCTCGCC ATTGAGGTCG GCACGTCACC CGACGCGCTG 6800
ACGGCCGCTG TAGCTGGACT CGGTTATCGG GCCACGCTGG CCGATGCCCC CTCAGTTTCG ACGCCGGGCG GATTGCTCGA CAAGATGCGC GATCTGCTGG 6900
GCAGAAACGA CAAGACGGGT AGCAGCGGCG CATTGCATAT CGCCGTCATC GGCAGCGGCG GGGCCGCGAT GGCAGCGGCG CTGAAGGCCG TCGAGCAAGG 7000
CGCACGTGTC ACGCTGATCG AGCGCGGCAC CATCGGCGGC ACCTGCGTCA ATGTCGGTTG TGTGCCGTCC AAGATCATGA TCCGCGCCGC CCATATCGCC 7100
CATCTGCGCC GGGAAAGCCC GTTCGATGGC GGCATCGCCG CTACCACGCC GACCATCCAG CGCACGGCGC TGCTGGCCCA GCAGCAGGCC CGCGTCGATG 7200
AACTGCGCCA CGCCAAGTAC GAAGGCATCT TGGAGGGCAA TCCGGCGATC ACTGTGCTGC ACGGCTCCGC CCGCTTTAAG GACAATCGCA ACCTGATCGT 7300
GCAACTCAAC GACGGCGGCG AGCGCGTGGT GGCATTCGAC CGCTGCCTGA TCGCCACCGG CGCGAGCCCG GCCGTGCCGC CGATTCCCGG CCTGAAAGAC 7400
ACTCCGTACT GGACTTCCAC TGAAGCGCTG GTCAGCGAGA CGATTCCTAA GCGCCTGGCC GTGATTGGCT CATCAGTGGT GGCGCTGGAG CTGGCGCAGG 7500
CGTTCGCCCG ACTCGGAGCG AAGGTGACGA TCCTGGCTCG CAGCACGCTG TTCTTCCGCG AAGACCCAGC TATAGGCGAA GCCGTCACGG CCGCATTCCG 7600
CATGGAGGGC ATCGAGGTGA GGGAACACAC CCAGGCCAGC CAGGTCGCGT ATATCAATGG TGAAGGGGAC GGCGAATTCG TGCTCACCAC GGCGCACGGC 7700
GAACTGCGCG CCGACAAGCT GCTGGTCGCC ACCGGCCGCG CGCCCAACAC ACGCAAGCTG GCACTGGATG CGACGGGCGT CACGCTCACC CCGCAAGGCG 7800
CTATCGTCAT CGACCCCGGC ATGCGTACAA GCGTGGAACA CATCTACGCC GCAGGCGACT GCACCGACCA GCCGCAGTTC GTCTATGTGG CGGCAGCGGC 7900
CGGCACTCGC GCCGCGATCA ACATGACCGG CGGTGACGCG GCCCTGAACC TGACCGCGAT GCCGGCCGTG GTGTTCACCG ACCCGCAAGT GGCGACCGTA 8000
GGCTACAGCG AGGCGGAAGC GCACCATGAC GGCATCAAAA CTGATAGTCG CACGCTAACG CTGGACAACG TGCCGCGCGC GCTCGCCAAC TTCGACACGC 8100
GCGGCTTCAT CAAACTGGTG GTTGAAGAAG GCAGCGGACG ACTGATCGGC GTGCAGGCAG TGGCCCCGGA AGCGGGCGAA CTGATCCAGA CGGCCGCACT 8200
GGCGATTCGC AACCGGATGA CGGTGCAGGA ACTGGCCGAC CAGTTGTTCC CCTACCTGAC GATGGTCGAA GGGTTGAAGC TCGCGGCGCA GACCTTCAAC 8300
AAGGATGTGA AGCAGCTTTC CTGCTGCGCC GGGTGAGGAC AAGGAGGTGT GCGATGAGCG CCTACACGGT ATCGCAACTG GCCCATAACG CTGGGGTGAG 8400
CGTACATATC GTGCGCGACT ACCTGGTGCG CGGCTTGTTA CGGCCGGTGG CCTGCACCAC GGGCGGCTAC GGCGTGTTCG ACGATGCGGC CTTGCAACGG 8500
CTGTGCTTCG TGCGCGCGGC CTTCGAGGCG GGTATCGGCC TGGATGCCCT GGCGCGGCTG TGCCGTGCGC TCGACGCAGC GGACGGCGCA CAAGCCGCAG 8600
CGCAGCTTGC CGTGCTGCGC CAGTTGGTCG AGCGGCGGCG CGCGGCGTTG GCCCATCTGG ACGCGCAACT GGCCTCCATG CCAGCCGAGC GGGCGCACGA 8700
GGAGGCATTG CCGTGAACGC CCCTGACAAA CTGCCGCCCG AGACGCGCCA ACCCGTTTCC GGCTACCTGT GGGGTGCGCT GGCCGTGTTG ACCTGCCCCT 8800
GCCATCTGCC GATTCTCGCC GCCGTGCTGG CCGGGACGAC CGCCGGTGCC TTCCTTGGCG AGCATTGGGG TGTTGCCGCG CTCGCGCTGA CCGGCTTGTT 8900
CGTTCTGGCC GTAACGCGGC TGCTGCGCGC CTTCCGGGGC GGATCATGAC GAGTTCGCAG CCCGCCGGAT GGACGGCGGC CGAGTTGGCG CAGGCGGCGG 9000
CGCGCGGACA GCTTGACCTG CATTACCAGC CGCTGGTCGA TCTGCGCGAT CACCGGATCG CTGGCGCGGA AGCGTTGATG CGCTGGCGGC ATCCGAGGCT 9100
TGGCCTGTTG CCGCCCGGCC AGTTCCTGCC GCTGGCCGAG TCGTTCGGCC TGATGCCGGA AATAGGCGCG TGGGTGCTGG GCGAGGCCTG TCGCCAGATG 9200
CACAAGTGGC AAGGACCGGC ATGGCAACCG TTCCGTCTTG CCATCAATGT GTCCGCCAGC CAGGTTGGGC CAACGTTCGA CGACGAGGTA AAGCGGGTGC 9300
TGGCCGATAT GGCCCTGCCC GCCGAGCTTC TGGAGATCGA ACTGACCGAA TCGGTCGCAT TCGGCAATCC AGCCCTGTTC GCCAGTTTCG ACGCCTTGCG 9400
CGCCATCGGC GTGCGCTTCG CCGCCGACGA CTTCGGCACC GGCTATTCCT GCCTGCAACA TCTGAAATGC TGCCCCATCA CCACATTGAA AATCGACCAA 9500
TCCTTTGTCG CCAGGCTCCC GGATGATGCC CGTGACCAAA CTATCGTGCG GGCGGTGATC CAGCTCGCGC ACGGGCTGGG CATGGATGTC ATTTTCAGAA 9600
GACGACTGCA CCAGTTGATT GGGCGTAATG GCTGTTGTGC AGCCAGCTCC TGACAGTTCA ATATCAGAAG TGATCTGCAC CAATCTCGAC TATGCTCAAT 9700
ACTCGTGTGC ACCAAAGCGA GGTGAGCATG GCGACGGACA CCCCACGGAT TCCAGAACAA GGCGTGGCCA CTCTGCCTGA TGAGGCTTGG GAGCGTGCGC 9800
GCCGTCGTGC GGAGATCATC AGTCCGTTGG CGCAGTCGGA GACGGTCGGG CACGAAGCGG CCGATATGGC GGCTCAGGCG CTGGGCTTGT CTCGGCGCCA 9900
GGTATACGTT CTGATCCGGC GTGCCCGGCA AGGCAGCGGC CTCGTGACGG ATCTGGTGCC CGGCCAGTCC GGTGGAGGTA AAGGTAAGGG GCGCTTGCCG 10000
GAACCGGTCG AGCGCGTCAT CCACGAGCTA CTGCAAAAGC GGTTCCTGAC CAAGCAGAAG CGCAGCCTAG CGGCCTTTCA CCGCGAAGTC ACTCAGGTGT 10100
GCAAGGCTCA AAAACTGCGA GTGCCGGCGC GCAATACCGT GGCCTTACGG ATCGCTAGCC TTGACCCGCG CAAGGTCATC CGCCGGCGGG AAGGCCAGGA 10200
TGCCGCTCGT GACCTACAAG GTGTGGGCGG CGAGCCTCCT GCCGTGACCG CGCCGCTGGA GCAGGTGCAG ATAGACCATA CGGTCATCGA CCTGATCGTG 10300
GTCGATGACC GCGACCGGCA ACCTATTGGC CGCCCGTACC TGACCCTCGC CATCGACGTG TTCACCCGCT GCGTGCTCGG CATGGTCGTC ACGCTGGAAG 10400
CGCCGTCTGC CGTTTCGGTT GGCCTGTGCC TCGTGCATGT CGCCTGCGAC AAGCGCCCTT GGCTGGAAGG ACTGAACGTG GAAATGGATT GGCAGATGAG 10500
CGGCAAGCCC TTGCTGCTCT ACCTAGACAA CGCGGCCGAG TTCAAGAGCG AGGCCCTGCG CCGGGGTTGC GAGCAGCATG GCATCCGGCT GGACTATCGC 10600
CCGCTGGGAC AGCCGCACTA TGGCGGCATC GTGGAACGGA TCATCGGCAC GGCGATGCAG ATGATTCACG ACGAACTGCC GGGAACGACC TTCTCCAACC 10700
CTGACCAGCG CGGCGACTAC GATTCCGAAA ACAAGGCCGC CCTGACGCTG CGCGAGCTAG AGCGCTGGCT CACATTGGCG GTCGGCACCT ACCACGGTTC 10800
GGTGCACAAC GGCCTGCTCC AACCGCCGGC CGCGCGCTGG GCCGAGGCCG TGGCGCGTGT CGGCGTACCG GCCGTCGTCA CACGCGCTAC TTCGTTCCTG 10900
GTCGATTTTC TGCCGATCCT CCGGCGCACG CTGACCCGCA CCGGCTTTGT CATCGACCAC ATCCACTACT ACGCCGATGC GCTCAAGCCG TGGATTGCGC 11000
GGCGTGAACG CTGGCCGTCC TTTCTGATCC GGCGCGATCC GCGCGACATC AGCCGTATCT GGGTCCTGGA ACCGGAGGGA CAGCATTACC TGGAAATTCC 11100
CTACCGTACC TTGTCGCATC CGGCTGTCAC CCTCTGGGAA CAACGGCAGG CGCTGGCGAA ACTGCGGCAG CAAGGGCGCG AACAGGTGGA TGAGTCGGCG 11200
CTGTTCCGCA TGATCGGCCA GATGCGTGAG ATTGTGACCA GCGCGCAGAA GGCCACACGC AAGGCGCGGC GTGACGCGGA TCGCCGCCAG CACCTCAAGA 11300
CATCAGCTCG GCCGGACAAG CCCGTTCCGC CGGATACGGA TATTGCCGAC CCGCAGGCAG ACAACTTGCC ACCCGCCAAA CCGTTCGACC AGATTGAGGA 11400
GTGGTAGCCG TGGACGAATA TCCCATCATC GACCTGTCCC ACCTGCTGCC GGCGGCCCAG GGCTTGGCCC GTCTTCCGGC GGACGAGCGC ATCCAGCGCC 11500
TTCGCGCCGA CCGCTGGATC GGCTATCCGC GCGCAGTCGA GGCGCTGAAC CGGCTGGAAG CCCTTTATGC GTGGCCAAAC AAGCAACGCA TGCCCAACCT 11600
GCTGCTGGTT GGCCCGACCA ACAATGGCAA GTCGATGATC GTCGAGAAGT TCCGCCGCAC CCACCCGGCC AGCTCCGACG CCGACCAGGA GCACATCCCG 11700
GTGTTGGTCG TGCAGATGCC GTCCGAGCCG TCCGTGATCC GCTTCTACGT CGCGCTGCTC GCCGCGATGG GCGCGCCGCT GCGCCCACGC CCACGGTTGC 11800
CGGAAATGGA GCAACTGGCT CTGGCACTGC TGCGCAAGGT CGGCGTGCGC ATGCTGGTGA TCGACGAGCT GCACAACGTG CTGGCCGGCA ACAGCGTCAA 11900
CCGCCGGGAA TTCCTCAACC TGCTGCGCTT CCTCGGCAAC GAACTGCGCA TCCCGTTGGT TGGGGTAGGC ACGCGCGACG CCTACCTAGC CATCCGCTCC 12000
GATGACCAGT TGGAAAATCG CTTCGAGCCG ATGATGCTGC CGGTATGGGA GGCCAACGAC GATTGCTGCT CACTGCTGGC CAGCTTCGCC GCTTCGCTCC 12100
CGCTGCGCCG GCCTTCCCCA ATTGCCACGC TGGACATGGC TCGCTACCTG CTCACACGCA GCGAGGGCAC CATAGGGGAA CTGGCGCACT TGCTGATGGC 12200
GGCGGCCATC GTCGCCGTGG AGAGCGGCGA GGAAGCGATC AACCATCGCA CACTCAGCAT GGCCTGTTGA GTTGCATCTA AAATTGACCC ACTTAGGGTA 12300
AAGATTTGCG TCGAAATTTG ACCCACGTAT GACACTGTTT CCCGTCTGGA TATGGCGGGA GAAATCAAGG AGTGATAAAC GTGGCGATAT TGAGCGCAAT 12400
TCGACGCTGG CATTTTCGCG ATGGTGCGTC GATTCGGGAA ATAGCCCGAC GAAGCGGCCT GTCCAGGAAC ACCGTTCGCA AGTATTTGCA AAGCAAGGTG 12500
GTTGAACCGC AGTACCCAGC GCGAGACAGC GTTGGCAAGT TAAGTCCTTT TGAGCCCAAG TTAAGGCAGT GGCTCTCCAC CGAGCACAAA AAGACAAAGA 12600
AGCTGCGCAG AAACCTGCGC AGCATGTACC GGGATTTGGT CGCTTTGGGC TTTACCGGGT CTTATGACCG AGTGTGTGCC TTTGCCCGAC AGTGGAAAGA 12700
TTCCGAACAG TTCAAGGCGC AAACCTCGGG CAAGGGTTGT TTCATCCCCT TGCGCTTTGC TTGTGGCGAA GCCTTCCAAT TCGATTGGAG TGAGGACTTT 12800
GCCCGCATAG CGGGCAAACA GGTCAAACTT CAGATTGCCC AGTTTAAGTT GGCCCACAGC CGGGCCTTTG TGCTTCGGGC TTACTACCAG CAAAAACATG 12900
AAATGCTGTT TGATGCCCAC TGGCATGCCT TTCAAATCTT CGGTGGCATT CCCAAGCGCG GCATCTACGA CAACATGAAG ACCGCTGTGG ATTCGGTGGG 13000
GCGTGGCAAA GAGCGCAGGG TCAATCAGCG GTTCACTGCC ATGGTCAGCC ACTACCTGTT TGATGCGCAG TTCTGTAATC CAGCATCGGG TTGGGAGAAA 13100
GGCCAGATTG AGAAGAACGT GCAGGATTCC CGCCAACGCC TGTGGCAAGG GGCACCAGAC TTTCAAAGCC TTGCTGATTT GAATGTGTGG CTTGAGCATC 13200
GCTGCAAAGC GCTGTGGTCT GAGCTGCGCC ACCCCGAATT GGACCAAACC GTGCAAGAGG CCTTTGCCGA TGAACAAGGC GAGTTGATGG CGCTACCCAA 13300
TGCCTTTGAT GCATTCGTGG AGCAAACCAA GCGAGTCACT TCAACCTGCC TTGTTCACCA CGAGGGCAAT CGCTACAGCG TTCCTGCCAG TTACGCCAAC 13400
AGGGCCATCA GCCTTCGGAT TTATGCAGAC AAGCTGGTGA TGGCTGCCGA AGGCCAACAC ATTGCCGAGC ATCCAAGATT GTTTGGCAGT GGCCACGCTC 13500
GGCGTGGCCA CACACAATAC GACTGGCACC ATTACTTGTC TGTGCTTCAG AAGAAACCTG GGGCGTTGCG CAATGGTGCG CCATTTGCTG AATTGCCACC 13600
CGCGTTCAAG AAGCTTCAAT CCATCTTGCT GCAACGCCCC GGCGGTGACC GTGACATGGT GGAAATTCTG GCCCTTGTAT TGCACCACGA TGAAGGTGCG 13700
GTACTCAGTG CTGTGGAATT GGCATTGGAG TGTGGCAAGC CATCGAAGGA GCATGTGCTT AATCTGTTGG GACGTTTGAC CGAAGAACCT CCACCCAAAC 13800
CGATTCCAAT TCCCAAGGGG TTAAGGCTGA CATTGGAACC ACAGGCCAAC GTGAACCGCT ATGACAGTTT AAGGAGAGCC CATGATGCAG CATGAAGGCC 13900
ATGTGAGAAT CCTCAAATCC TTGAAACTCT TTGGCATGGC ACACGCCATT GAGGAGTTGG GCAATCAGAA TTCACCAGCA TTTAATCAAG CCTTGCCCAT 14000
GCTGGACAGC TTGATTAAAG CTGAAGTGGC AGAGCGTGAA GTACGTTCGG TGAACTATCA ATTGCGGGTG GCCAAGTTCC CCGTGTATCG GGACTTGGTG 14100
GGCTTTGACT TCAGTCAAAG CCTGGTTAAT GAGGCCACGG TCAAACAATT GCACCGGTGC GACTTCATGG AACAAGCCCA GAACGTGGTG CTGATTGGTG 14200
GGCCAGGCAC AGGCAAGACT CACCTGGCCA CAGCCATTGG TACACAAGCA GTGATGCACT TGAACCGACG GGTGCGTTTC TTCTCCACCG TGGATTTGGT 14300
CAATGCACTG GAGCAAGAGA AATCATCTGG GCGTCAGGGA CAAATCGCAA ACCGTCTGTT GTATGCCGAT TTGGTGATTC TGGATGAGCT GGGATATTTG 14400
CCTTTTAGCC AAACCGGTGG GGCACTGCTG TTTCACCTGC TCTCAAAGCT GTACGAAAAA ACCAGCGTGA TACTGACCAC CAACTTGAGC TTCTCGGAAT 14500
GGAGCCGAGT GTTTGGCGAT GAAAAGATGA CAACAGCGTT GTTGGACCGA CTAACCCACC ACTGCCACAT CCTGGAAACC GGCAATGAAA GTTACCGCTT 14600
CAAACACAGT TCAACTCAGA ATAAGCAGGA GGAAAAACAG ACCCGCAAAC TGAAAATCGA GACATAATTC TGACAACAAG GGGTGGGTCA AAATTCAATG 14700
CAAATCCCGG GTCAAATTTG GGTGCAAATC AACAGATATC GACAACCTCT CGCGCAACCA AGACATCGCG GTCGGACTGC AAGTGATCTT GAAGCCACGG 14800
GCCCGTCCCA CCCCGACATG GACCTCGATG CCCGAACGGA CGTTAGATTT CGAGTTCTAG GCGTTCTGCG ATGAAGGTTG GATCCCAGCC GGGATTGAAA 14900
GTGTCGACGT GGGTGAATCC GAGCCGCTCG TATAGGCCAC GCAGGTTCGG GTGGCAGTCG AGCCGCAGCT TGGCGCACCC CTGCGTTCGC GCGGCATGGC 15000
GGCAAGCCTC GATCAGCGCG GAGCTGACAC CCCGGCCCGC ATGTGTCCGT CGCACCGCGA GCTTGTGCAG ATATGCGGCC TCCCCCTTGA GGGCGTCGGG 15100
CCAGAACTCG GGATCCTCGG CCGACAAGGT GCAACAGCCG ACGATGCCGT CGCTGCAACT CGCGACTAGG AGCTCGGATC TCAGGACGAA GGTCTCCGCG 15200
AATGTCCGGT CGATCCGCGC GACGTCCCAG GCGGGCGTTC CCTTGGCGGA CATCCACGCC GCAGCGTCGT GCATCAGCCG CACAACCTCG TCGATATCAC 15300
CCGAGCAGGC GACCCGAACG TTCGGAGGCT CCTCGCTGTC CATTCGCTCC CCTGGCGCGG TATGAACCGC CGCCTCATAG TGCAGTTTGA TCCTGACGAG 15400
CCCAGCATGT CTGCGCCCAC CTTCGCGGAA CCTGACCAGG GTCCGCTAGC GGGCGGCCGG AAGGTGAATG CTAGGCATGA TCTAACCCTC GGTCTCTGGC 15500
GTCGCGACTG CGAAATTTCG CGAGGGTTTC CGAGAAGGTG ATTGCGCTTC GCAGATCTCC AGGCGCGTGG GTGCGGACGT AGTCAGCGCC ATTGCCGATC 15600
GCGTGAAGTT CCGCCGCAAG GCTCGCTGGA CCCAGATCCT TTACAGGAAG GCCAACGGTG GCGCCCAAGA AGGATTTCCG CGACACCGAG ACCAATAGCG 15700
GAAGCCCCAA CGCCGACTTC AGCTTTTGAA GGTTCGACAG CACGTGCAGC GATGTTTCCG GTGCGGGGCT CAAGAAAAAT CCCATCCCCG GATCGAGGAT 15800
GAGCCGGTCG GCAGCGACCC CGCTCCGTCG CAAGGCGGAA ACCCGCGCCT CGAAGAACCG CACAATCTCG TCGAGCGCGT CTTCGGGTCG AAGGTGACCG 15900
GTGCGGGTGG CGATGCCATC CCGCTGCGCT GAGTGCATAA CCACCAGCCT GCAGTCCGCC TCAGCAATAT CGGGATAGAG CGCAGGGTCA GGAAATCCTT 16000
GGATATCGTT CAGGTAGCCC ACGCCGCGCT TGAGCGCATA GCGCTGGGTT TCCGGTTGGA AGCTGTCGAT TGAAACACGG TGCATCTGAT CGGACAGGGC 16100
GTCTAAGAGC GGCGCAATAC GTCTGATCTC ATCGGCCGGC GATACAGGCC TCGCGTCCGG ATGGCTGGCG GCCGGTCCGA CATCCACGAC GTCTGATCCG 16200
ACTCGCAGCA TTTCGATCGC CGCGGTGACA GCGCCGGCGG GGTCTAGCCG CCGGCTCTCA TCGAAGAAGG AGTCCTCGGT GAGATTCAGA ATGCCGAACA 16300
CCGTCACCAT GGCGTCGGCC TCCGCAGCGA CTTCCACGAT GGGGATCGGG CGAGCAAAAA GGCAGCAATT ATGAGCCCCA TACCTACAAA GCCCCACGCA 16400
TCAAGCTTTT GCCCATGAAG CAACCAGGCA ATGGCTGTAA TTATGACGAC GCCGAGTCCC GACCAGACTG CATAAGCAAC ACCGACAGGG ATGGATTTCA 16500
GAACCAGAGA AAGAAAATAA AATGCGATGC CATAACCGAT TATGACAACG GCGGAAGGGG CAAGCTTAGT AAAGCCCTCG CTAGATTTTA ATGCGGATGT 16600
TGCGATTACT TCGCCAACTA TTGCGATAAC AAGAAAAAGC CAGCCTTTCA TGATATATCT CCCAATTTGT GTAGGGCTTA TTATGCACGC TTAAAAATAA 16700
TAAAAGCAGA CTTGACCTGA TAGTTTGGCT GTGAGCAATT ATGTGCTTAG TGCATCTAAC GCTTGAGTTA AGCCGCGCCG CGAAGCGGCG TCGGCTTGAA 16800
CGAATTGTTA GACATTATTT GCCGACTACC TTGGTGATCT CGCCTTTCAC GTAGTGGACA AATTCTTCCA ACTGATCTGC GCGCGAGGCC AAGCGATCTT 16900
CTTCTTGTCC AAGATAAGCC TGTCTAGCTT CAAGTATGAC GGGCTGATAC TGGGCCGGCA GGCGCTCCAT TGCCCAGTCG GCAGCGACAT CCTTCGGCGC 17000
GATTTTGCCG GTTACTGCGC TGTACCAAAT GCGGGACAAC GTAAGCACTA CATTTCGCTC ATCGCCAGCC CAGTCGGGCG GCGAGTTCCA TAGCGTTAAG 17100
GTTTCATTTA GCGCCTCAAA TAGATCCTGT TCAGGAACCG GATCAAAGAG TTCCTCCGCC GCTGGACCTA CCAAGGCAAC GCTATGTTCT CTTGCTTTTG 17200
TCAGCAAGAT AGCCAGATCA ATGTCGATCG TGGCTGGCTC GAAGATACCT GCAAGAATGT CATTGCGCTG CCATTCTCCA AATTGCAGTT CGCGCTTAGC 17300
TGGATAACGC CACGGAATGA TGTCGTCGTG CACAACAATG GTGACTTCTA CAGCGCGGAG AATCTCGCTC TCTCCAGGGG AAGCCGAAGT TTCCAAAAGG 17400
TCGTTGATCA AAGCTCGCCG CGTTGTTTCA TCAAGCCTTA CGGTCACCGT AACCAGCAAA TCAATATCAC TGTGTGGCTT CAGGCCGCCA TCCACTGCGG 17500
AGCCGTACAA ATGTACGGCC AGCAACGTCG GTTCGAGATG GCGCTCGATG ACGCCAACTA CCTCTGATAG TTGAGTCGAT ACTTCGGCGA TCACCGCTTC 17600
CCTCATGATG TTTAACTTTG TTTTAGGGCG ACTGCCCTGC TGCGTAACAT CGTTGCTGCT CCATAACATC AAACATCGAC CCACGGCGTA ACGCGCTTGC 17700
TGCTTGGATG CCCGAGGCAT AGACTGTACC CCAAAAAAAC AGTCATAACA AGCCATGAAA ACCGCCACTG CGCCGTTACC ACCGCTGCGT TCGGTCAAGG 17800
TTCTGGACCA GTTGCGTGAG CGCATACGCT ACTTGCATTA CAGCTTACGA ACCGAACAGG CTTATGTCCA CTGGGTTCGT GCCTTCATCC GTTTCCACGG 17900
TGTGCGTCAC CCGGCAACCT TGGGCAGCAG CGAAGTCGAG GCATTTCTGT CCTGGCTGGC GAACGAGCGC AAGGTTTCGG TCTCCACGCA TCGTCAGGCA 18000
TTGGCGGCCT TGCTGTTCTT CTACGGCAAG GTGCTGTGCA CGGATCTGCC CTGGCTTCAG GAGATCGGAA GACCTCGGCC GTCGCGGCGC TTGCCGGTGG 18100
TGCTGACCCC GGATGAAGTG GTTCGCATCC TCGGTTTTCT GGAAGGCGAG CATCGTTTGT TCGCCCAGCT TCTGTATGGA ACGGGCATGC GGATCAGTGA 18200
GGGTTTGCAA CTGCGGGTCA AGGATCTGGA TTTCGATCAC GGCACGATCA TCGTGCGGGA GGGCAAGGGC TCCAAGGATC GGGCCTTGAT GTTACCCGAG 18300
AGCTTGGCAC CCAGCCTGCG CGAGCAGCTG TCGCGTGCAC GGGCATGGTG GCTGAAGGAC CAGGCCGAGG GCCGCAGCGG CGTTGCGCTT CCCGACGCCC 18400
TTGAGCGGAA GTATCCGCGC GCCGGGCATT CCTGGCCGTG GTTCTGGGTT TTTGCGCAGC ACACGCATTC GACCGATCCA CGGAGCGGTG TCGTGCGTCG 18500
CCATCACATG TATGACCAGA CCTTTCAGCG CGCCTTCAAA CGTGCCGTAG AACAAGCAGG CATCACGAAG CCCGCCACAC CGCACACCCT CCGCCACTCG 18600
TTCGCGACGG CCTTGCTCCG CAGCGGTTAC GACATTCGAA CCGTGCAGGA TCTGCTCGGC CATTCCGACG TCTCTACGAC GATGATTTAC ACGCATGTGC 18700
TGAAAGTTGG CGGTGCCGGA GTGCGCTCAC CGCTTGATGC GCTGCCGCCC CTCACTAGTG AGAGGTAGGG CAGCGCAAGT CAATCCTGGC GGATTCACTA 18800
CCCCTGCGCG AAGGCCATCG GTGCCGCATC GAACGGCCGG TTGCGGAAAG TCCTCCCTGC GTCCGCTGAT GGCCGGCAGC AGCCCGTCGT TGCCTGATGG 18900
ATCCAACCCC TCCGCTGCTA TAGTGCAGTC GGCTTCTGAC GTTCAGTGCA GCCGTCTTCT GAAAACGACA ATGGAGGTGG TAGCCGAGGG TGTGGAAACA 19000
CCCGACTGCC TTGCGTGGTT GCGGCAGGCG GGTTGCGACA CGGTGCAGGG TTTCCTGTTC GCCAGGCCGA TGCCGGCGGC GGCCTTCGTC GGCTTCGTCA 19100
ACCAATGGAG GAACACCACC ATGAACGCCA ATGAACCGAG CACCAGTTGC TGCGTGTGCT GCAAGGAAAT CCCGCTCGAT GCCGCCTTCA CGCCGGAAGG 19200
GGCCGAGTAC GTGGAGCATT TCTGCGGGCT GGAGTGCTAT CAGCGCTTCC AGGCGCGGGC CAGCACTGCG ACCGAAACCA GCGTCAAACC GGACGCTTGT 19300
GATTCGCCGC CGTCAGGTTG AGGCATACCC TAACCTGATG TCAGATGCCA TGTGTAAATT GCGTCAGGAT AGGATTGAAT TTTGAATTTA TTGACATATC 19400
TCGTTGAAGG TCATAGAGTC TTCCCTGACA TTTTGCAGGG AATTCCATGA CTGGACAGCG CATTGGGTAT ATCAGGGTCA GCACCTTCGA CCAGAACCCG 19500
GAACGGCAAC TGGAAGGCGT CAAGGTTGAT CGCGCTTTTA GCGACAAGGC ATCCGGCAAG GATGTCAAGC GTCCGCAACT GGAAGCGCTG ATAAGCTTCG 19600
CCCGCACCGG CGACACCGTG GTGGTGCATA GCATGGATCG CCTGGCGCGC AATCTCGATG ATTTGCGCCG GATCGTGCAA ACGCTGACAC AACGCGGCGT 19700
GCATATCGAA TTCGTCAAGG AACACCTCAG TTTTACTGGC GAAGACTCTC CGATGGCGAA CCTGATGCTC TCGGTGATGG GCGCGTTCGC CGAGTTCGAG 19800
CGCGCCCTGA TCCGCGAGCG TCAGCGCGAG GGTATTGCGC TCGCCAAGCA ACGCGGGGCT TACCGTGGCA GGAAGAAATC CCTGTCGTCT GAGCGTATTG 19900
CCGAACTGCG CCAACGTGTC GAGGCTGGCG AGCAAAAGAC CAAGCTTGCT CGTGAATTCG GAATCAGTCG CGAAACCCTG TATCAATACT TGAGAACGGA 20000
TCAGTAAATA TGCCACGTCG TTCCATCCTG TCCGCCGCCG AGCGGGAAAG CCTGCTGGCG TTGCCGGACT CCAAGGACGA CCTGATCCGA CATTACACAT 20100
TCAACGATAC CGACCTCTCG ATCATCCGAC AGCGGCGCGG GCCAGCCAAT CGGCTGGGCT TCGCGGTGCA GCTCTGTTAC CTGCGCTTTC CCGGCGTCAT 20200
CCTGGGCGTC GATGAACTAC CGTTCCCGCC CTTGTTGAAG CTGGTCGCCG ACCAGCTCAA GGTCGGCGTC GAAAGCTGGA ACGAGTACGG CCAGCGGGAG 20300
CAGACCCGGC GCGAGCACCT GAGCGAGCTG CAAACCGTGT TCGGTTTCCG GCCCTTCACC ATGAGCCATT ACCGGCAGGC CGTCCAGATG CTGACCGAGC 20400
TGGCGATGCA AACCGACAAA GGCATCGTGC TGGCCAGCGC CTTGATCGGG CACCTGCGGC GGCAGTCGGT CATTCTGCCC GCCCTCAACG CCGTCGAGCG 20500
GGCGAGTGCC GAGGCGATCA CCCGTGCTAA CCGGCGCATC TACGACGCCT TGGCCGAACC ACTGGCGGAC GCGCATCGCC GCCGCCTCGA CGATCTGCTC 20600
AAGCGCCGGG ACAACGGCAA GACGACCTGG TTGGCTTGGT TGCGCCAGTC TCCGGCCAAG CCAAATTCGC GGCATATGCT GGAACACATC GAACGCCTCA 20700
AGGCATGGCA GGCACTCGAT CTGCCTACCG GCATCGAGCG GCTGGTTCAC CAGAACCGCC TGCTCAAGAT TGCCCGCGAG GGCGGCCAGA TGACACCCGC 20800
CGACCTGGCC AAATTCGAGC CGCAACGGCG CTACGCCACT CTCGTGGCGC TGGCCACCGA GGGCATGGCC ACCGTCACCG ACGAAATCAT CGACCTGCAC 20900
GACCGCATCC TGGGTAAGCT GTTTAACGCT GCCAAGAATA AGCATCAGCA GCAGTTCCAG GCGTCAGGCA AGGCCATCAA CGCCAAGGTA CGTCTGTACG 21000
GGCGCATCGG TCAGGCGCTG ATCGACGCCA AGCAATCAGG CCGCGATGCG TTTGCCGCCA TCGAGGCCGT CATGTCCTGG GATTCCTTTG CCGAGAGCGT 21100
CACCGAGGCG CAGAAGCTCG CGCAACCCGA TGACTTCGAT TTCCTGCATC GCATCGGCGA GAGCTACGCC ACCCTGCGCC GCTATGCACC GGAATTCCTT 21200
GCCGTGCTCA AGCTGCGGGC CGCGCCCGCC GCCAAAAACG TGCTTGATGC CATTGAGGTG CTGCGCGGCA TGAACACCGA CAACGCCCGC AAGCTGCCAG 21300
CCGATGCACC GACCGGCTTC ATCAAGCCGC GCTGGCAGAA ACTGGTGATG ACCGACGCCG GCATCGACCG GCGCTACTAC GAACTGTGCG CGCTGTCCGA 21400
GTTGAAGAAC TCCCTGCGCT CGGGCGACAT CTGGGTGCAG GGTTCACGCC AGTTCAAGGA CTTCGAGGAC TACCTGGTAC CGCCCGAGAA GTTCACCAGC 21500
CTCAAGCAGT CCAGCGAATT GCCGCTGGCC GTGGCCACCG ACTGCGAACA ATATCTGCAT GAGCGGCTGA CGCTGCTGGA AGCACAACTT GCCACCGTCA 21600
ACCGCATGGC GGCAGCCAAC GACCTGCCGG ATGCCATCAT CACCGAGTCG GGCTTGAAGA TCACGCCGCT GGATGCGGCG GTGCCCGACA CCGCGCAGGC 21700
GCTGATAGAC CAGACAGCCA TGGTCCTGCC GCACGTCAAG ATCACCGAAC TGCTGCTCGA AGTCGATGAG TGGACGGGCT TCACCCGGCA CTTCACGCAC 21800
TTGAAATCGG GCGATCTGGC CAAGGACAAG AACCTGTTGT TGACCACGAT CCTGGCCGAC GCGATCAACC TGGGCCTGAC CAAGATGGCC GAGTCCTGCC 21900
CCGGCACGAC CTACGCGAAG CTCGCTTGGC TGCAAGCCTG GCATACCCGC GACGAAACGT ACTCGACAGC GTTGGCTGAA CTGGTCAACG CTCAGTTTCG 22000
GCATCCCTTT GCCGGGCACT GGGGCGATGG CACCACATCA TCATCGGACG GACAGAATTT CCGAACCGCT AGCAAGGCAA AGAGCACGGG GCACATCAAC 22100
CCAAAATATG GCAGCAGCCC AGGACGGACT TTCTACACCC ACATCTCCGA CCAATACGCG CCATTCCACA CCAAGGTGGT CAATGTCGGC CTGCGCGACT 22200
CAACCTACGT GCTCGACGGC CTGCTGTACC ACGAATCCGA CCTGCGGATC GAGGAGCACT ACACCGACAC GGCGGGCTTC ACCGATCACG TCTTCGCCCT 22300
GATGCACCTC TTGGGCTTCC GCTTCGCGCC GCGCATCCGC GACCTGGGCG ACACCAAGCT CTACATCCCG AAGGGCGATG CCGCCTATGA CGCGCTCAAG 22400
CCGATGATCG GCGGCACGCT CAACATCAAG CACGTCCGCG CCCATTGGGA CGAAATCCTG CGGCTGGCCA CCTCGATCAA GCAGGGCACG GTGACGGCCT 22500
CGCTGATGCT CAGGAAACTC GGCAGCTACC CGCGCCAGAA CGGCTTGGCC GTCGCGCTGC GCGAGTTGGG CCGCATCGAG CGCACGCTGT TCATCCTCGA 22600
CTGGCTGCAA AGCGTCGAGC TACGCCGCCG CGTGCATGCC GGGCTGAACA AGGGCGAGGC GCGCAATGCG CTGGCCCGTG CCGTGTTCTT CAACCGCCTT 22700
GGTGAAATCC GTGACCGCAG TTTCGAGCAG CAGCGCTACC GGGCCAGCGG CCTCAACCTG GTGACGGCGG CCATCGTGCT GTGGAACACG GTCTACCTGG 22800
AGCGTGCGGC GCATGCGTTG CGCGGCAATG GTCATGCCGT CGATGACTCG CTATTGCAGT ACCTGTCGCC ACTCGGCTGG GAGCACATCA ACCTGACCGG 22900
TGATTACCTA TGGCGCAGCA GCGCCAAGAT CGGCGCGGGG AAGTTCAGGC CGCTACGGCC TCTGCAACCG GCTTAGCGTG CTTTATTTTC CGTTTTCTGA 23000
GACGACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 2769-2889 121 AAATGTACCT TAAATCGAAT ATCAGACACG ATGTGTCTAT TATGCCAAAA TGACGATTTA
ATGGACACTC AAACGAAGCC GTTTTACTAT GTCTGATAAT TTATAATATT TCGAACGGTT
G
res_site_III_a 2772-2794 23 TGTACCTTAA ATCGAATATC AGA
res_site_II_a 2800-2835 36 TGTGTCTATT ATGCCAAAAT GACGATTTAA TGGACA
res_site_I 2858-2886 29 TGTCTGATAA TTTATAATAT TTCGAACGG
res_minus_35 4587-4592 6 TTGACA
attC qacEdelta1_sul1 core 15443-15476 34 CCGCTAGCGG GCGGCCGGAA GGTGAATGCT AGGC
attI 17616-17671 56 CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCA
res 19306-19436 131 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAGA TGCCATGTGT AAATTGCGTC
AGGATAGGAT TGAATTTTGA ATTTATTGAC ATATCTCGTT GAAGGTCATA GAGTCTTCCC
TGACATTTTG C
res_site_I 19306-19344 39 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAG
res_site_II 19358-19401 44 ATTGCGTCAG GATAGGATTG AATTTTGAAT TTATTGACAT ATCT
res_minus_35 19391-19396 6 TTGACA
res_site_III 19405-19436 32 TGAAGGTCAT AGAGTCTTCC CTGACATTTT GC
res_minus_35 19563-19568 6 TGTCAA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn4 34-468 Passenger Gene Heavy Metal Resistance -
merT Tn4 540-890 Passenger Gene Heavy Metal Resistance +
merP 5'-end Tn4 904-1019 Passenger Gene Heavy Metal Resistance +
bla TEM-1 (ARO:3000873) Tn3.1 1166-2026 Passenger Gene Antibiotic Resistance -
tnpR Tn3.1 2209-2766 Accessory Gene Resolvase -
tnpA Tn3.1 2895-5933 Transposase   +
merP 3'-end Tn4 5966-6132 Passenger Gene Heavy Metal Resistance +
merC Tn4 6168-6590 Passenger Gene Heavy Metal Resistance +
merA Tn4 6642-8336 Passenger Gene Heavy Metal Resistance +
merD Tn4 8354-8716 Passenger Gene Heavy Metal Resistance +
merE Tn4 8713-8949 Passenger Gene Heavy Metal Resistance +
urfM 5'-end Tn4 8946-9616 Passenger Gene Other +
tniA In_Tn4 9692-11407 Transposase   +
tniB delta1 In_Tn4 11410-12270 Accessory Gene   +
istA IS1326 12372-13895 Transposase   +
istB IS1326 13882-14667 Accessory Gene ATPase Transposition Helper +
GNAT_fam In_Tn4 14843-15343 Passenger Gene Antibiotic Resistance -
sul1 (ARO:3000410) In_Tn4 15471-16310 Passenger Gene Antibiotic Resistance -
qacEdelta1 (ARO:3005010) In_Tn4 16304-16651 Passenger Gene Antibiotic Resistance -
aadA (ARO:3002601) In_Tn4 16815-17606 Passenger Gene Antibiotic Resistance -
intI1 In_Tn4 17755-18768 Integron Integrase Class 1 +
tnpM Tn4 18971-19321 Accessory Gene Inhibitor +
tnpR Tn4 19447-20007 Accessory Gene Resolvase +
tnpA Tn4 20010-22976 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn4 435 34-468 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLREPDKPY GSIRRYGEAD VVRVKFVKSA QRLGFSLDEI AELLRLDDGT HCEEASSLAE HKLKDVREKM
ADLARMETVL SELVCACHAR KGNVSCPLIA SLQGEAGLAR SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn4 351 540-890 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPQNGRGA LFAGGLAAIL ASTCCLGPLV LVALGFSGAW IGNLTVLEPY RPLFIGAALV ALFFAWKRIY RPVQACKPGE VCAIPQVRAT YKLIFWIVAV
LVLVALGFPY VVPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP 5'-end N Tn4 116 904-1019 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Comment:   merP interrupted by insertion of Tn3.1
Protein Sequence:  
MKKLFASLAL AAAVAPVWAA TQTVTLAVPG MTCAACPI

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla TEM-1 (ARO:3000873) Bla TEM-1 Tn3.1 861 1166-2026 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   penem (ARO:3003706)||cephalosporin (ARO:0000032)||monobactam (ARO:0000004)||penam (ARO:3000008)
Sequence Family:  TEM beta-lactamase (ARO:3000014)
Comment:   perfect match to reference sequence for ARO:3000873||Synonyms: TEM-98, RTEM-1
Protein Sequence:  
MSIQHFRVAL IPFFAAFCLP VFAHPETLVK VKDAEDQLGA RVGYIELDLN SGKILESFRP EERFPMMSTF KVLLCGAVLS RVDAGQEQLG RRIHYSQNDL
VEYSPVTEKH LTDGMTVREL CSAAITMSDN TAANLLLTTI GGPKELTAFL HNMGDHVTRL DRWEPELNEA IPNDERDTTM PAAMATTLRK LLTGELLTLA
SRQQLIDWME ADKVAGPLLR SALPAGWFIA DKSGAGERGS RGIIAALGPD GKPSRIVVIY TTGSQATMDE RNRQIAEIGA SLIKHW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn3.1 558 2209-2766 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   first defined as a repressor
Protein Sequence:  
MRIFGYARVS TSQQSLDIQI RALKDAGVKA NRIFTDKASG SSTDREGLDL LRMKVEEGDV ILVKKLDRLG RDTADMIQLI KEFDAQGVAV RFIDDGISTD
GDMGQMVVTI LSAVAQAERR RILERTNEGR QEAKLKGIKF GRRRTVDRNV VLTLHQKGTG ATEIAHQLSI ARSTVYKILE DERAS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn3.1 3039 2895-5933 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Comment:   In frame three amino acid deletion relative to tnpA (Tn3)
Protein Sequence:  
VLKKPSGREA DMPVDFLTTE QVESYGRFTG EPDELQLARY FHLDEADKEF IGKSRGDHNR LGIALQIGCV RFLGTFLTDM NHIPSGVRHF TARQLGIRDI
TVLAEYGQRE NTRREHAALI RQHYQYREFA WPWTFRLTRL LYTRSWISNE RPGLLFDLAT GWLMQHRIIL PGATTLTRLI SEVREKATLR LWNKLALIPS
AEQRSQLEML LGPTDCSRLS LLESLKKGPV TISGPAFNEA IERWKTLNDF GLHAENLSTL PAVRLKNLAR YAGMTSVFNI ARMSPQKRMA VLVAFVLAWE
TLALDDALDV LDAMLAVIIR DARKIGQKKR LRSLKDLDKS ALALASACSY LLKEETPDES IRAEVFSYIP RQKLAEIITL VREIARPSDD NFHDEMVEQY
GRVRRFLPHL LNTVKFSSAP AGVTTLNACD YLSREFSSRR QFFDDAPTEI ISQSWKRLVI NKEKHITRRG YTLCFLSKLQ DSLRRRDVYV TGSNRWGDPR
ARLLQGADWQ ANRIKVYRSL GHPTDPQEAI KSLGHQLDSR YRQVAARLGE NEAVELDVSG PKPRLTISPL ASLDEPDSLK RLSKMISDLL PPVDLTELLL
EINAHTGFAD EFFHASEASA RVDDLPVSIS AVLMAEACNI GLEPLIRSNV PALTRHRLNW TKANYLRAET ITSANARLVD FQATLPLAQI WGGGEVASAD
GMRFVTPVRT INAGPNRKYF GNNRGITWYN FVSDQYSGFH GIVIPGTLRD SIFVLEGLLE QETGLNPTEI MTDTAGASDL VFGLFWLLGY QFSPRLADAG
ASVFWRMDHD ADYGVLNDIA RGQSDPRKIV LQWDEMIRTA GSLKLGKVQA SVLVRSLLKS ERPSGLTQAI IEVGRINKTL YLLNYIDDED YRRRILTQLN
RGESRHAVAR AICHGQKGEI RKRYTDGQED QLGALGLVTN AVVLWNTIYM QAALDHLRAQ GETLNDEDIA RLSPLCHGHI NMLGHYSFTL AELVTKGHLR
PLKEASEAEN VA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP 3'-end N Tn4 167 5966-6132 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Target:   Mercury
Comment:   merP interrupted by insertion of Tn3.1
Protein Sequence:  
RSQSRKRSPR SKA*ARSMWA SRSARPSSLL TTPRPAYRS* PRPPQTPAIR PASSS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn4 423 6168-6590 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   transmembrane protein mercury transport
Target:   Mercury
Protein Sequence:  
MGLMTRIADK TGALGSVVSA MGCAACFPAL ASFGAAIGLG FLSQYEGLFI SRLLPLFAAL AFLANALGWF SHRQWLRSLL GMIGPAIVFA ATVWLLGNWW
TANLMYVGLA LMIGVSIWDF VSPAHRRCGP DGCELPAKRL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn4 1695 6642-8336 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MSTLKITGMT CDSCAVHVKD ALEKVPGVQS ADVSYAKGSA KLAIEVGTSP DALTAAVAGL GYRATLADAP SVSTPGGLLD KMRDLLGRND KTGSSGALHI
AVIGSGGAAM AAALKAVEQG ARVTLIERGT IGGTCVNVGC VPSKIMIRAA HIAHLRRESP FDGGIAATTP TIQRTALLAQ QQARVDELRH AKYEGILEGN
PAITVLHGSA RFKDNRNLIV QLNDGGERVV AFDRCLIATG ASPAVPPIPG LKDTPYWTST EALVSETIPK RLAVIGSSVV ALELAQAFAR LGAKVTILAR
STLFFREDPA IGEAVTAAFR MEGIEVREHT QASQVAYING EGDGEFVLTT AHGELRADKL LVATGRAPNT RKLALDATGV TLTPQGAIVI DPGMRTSVEH
IYAAGDCTDQ PQFVYVAAAA GTRAAINMTG GDAALNLTAM PAVVFTDPQV ATVGYSEAEA HHDGIKTDSR TLTLDNVPRA LANFDTRGFI KLVVEEGSGR
LIGVQAVAPE AGELIQTAAL AIRNRMTVQE LADQLFPYLT MVEGLKLAAQ TFNKDVKQLS CCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn4 363 8354-8716 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MSAYTVSQLA HNAGVSVHIV RDYLVRGLLR PVACTTGGYG VFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGAQ AAAQLAVLRQ LVERRRAALA
HLDAQLASMP AERAHEEALP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn4 237 8713-8949 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Comment:   similar to urf-1 in pKLH2 (GenBank AF213017), pKLH272 (Genbank Y08992), pMER610 (GenBank Y08993), pKLH210 (GenBank Y10102), Tn5036 (Genbank Y09025), orf1 in Tn501 (GenBank Z00027), and urf-1 in Tn5041 (GenBank X98999)
Protein Sequence:  
MNAPDKLPPE TRQPVSGYLW GALAVLTCPC HLPILAAVLA GTTAGAFLGE HWGVAALALT GLFVLAVTRL LRAFRGGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM 5'-end N Tn4 671 8946-9616 +
Class:   Passenger Gene
Sub Class:   Other
Comment:   urfM ORF interrupted by insertion of In2
Protein Sequence:  
MTSSQPAGWT AAELAQAAAR GQLDLHYQPL VDLRDHRIAG AEALMRWRHP RLGLLPPGQF LPLAESFGLM PEIGAWVLGE ACRQMHKWQG PAWQPFRLAI
NVSASQVGPT FDDEVKRVLA DMALPAELLE IELTESVAFG NPALFASFDA LRAIGVRFAA DDFGTGYSCL QHLKCCPITT LKIDQSFVAR LPDDARDQTI
VRAVIQLAHG LGMDVIFRRR LHQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA In_Tn4 1716 9692-11407 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MLNTRVHQSE VSMATDTPRI PEQGVATLPD EAWERARRRA EIISPLAQSE TVGHEAADMA AQALGLSRRQ VYVLIRRARQ GSGLVTDLVP GQSGGGKGKG
RLPEPVERVI HELLQKRFLT KQKRSLAAFH REVTQVCKAQ KLRVPARNTV ALRIASLDPR KVIRRREGQD AARDLQGVGG EPPAVTAPLE QVQIDHTVID
LIVVDDRDRQ PIGRPYLTLA IDVFTRCVLG MVVTLEAPSA VSVGLCLVHV ACDKRPWLEG LNVEMDWQMS GKPLLLYLDN AAEFKSEALR RGCEQHGIRL
DYRPLGQPHY GGIVERIIGT AMQMIHDELP GTTFSNPDQR GDYDSENKAA LTLRELERWL TLAVGTYHGS VHNGLLQPPA ARWAEAVARV GVPAVVTRAT
SFLVDFLPIL RRTLTRTGFV IDHIHYYADA LKPWIARRER WPSFLIRRDP RDISRIWVLE PEGQHYLEIP YRTLSHPAVT LWEQRQALAK LRQQGREQVD
ESALFRMIGQ MREIVTSAQK ATRKARRDAD RRQHLKTSAR PDKPVPPDTD IADPQADNLP PAKPFDQIEE W

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB delta1 TniB delta1 In_Tn4 861 11410-12270 +
Class:   Accessory Gene
Function:   probable ATP-binding protein.
Comment:   probably truncated by insertion of IS1326::IS1353
Protein Sequence:  
MDEYPIIDLS HLLPAAQGLA RLPADERIQR LRADRWIGYP RAVEALNRLE ALYAWPNKQR MPNLLLVGPT NNGKSMIVEK FRRTHPASSD ADQEHIPVLV
VQMPSEPSVI RFYVALLAAM GAPLRPRPRL PEMEQLALAL LRKVGVRMLV IDELHNVLAG NSVNRREFLN LLRFLGNELR IPLVGVGTRD AYLAIRSDDQ
LENRFEPMML PVWEANDDCC SLLASFAASL PLRRPSPIAT LDMARYLLTR SEGTIGELAH LLMAAAIVAV ESGEEAINHR TLSMAC

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istA IstA IS1326 1524 12372-13895 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MINVAILSAI RRWHFRDGAS IREIARRSGL SRNTVRKYLQ SKVVEPQYPA RDSVGKLSPF EPKLRQWLST EHKKTKKLRR NLRSMYRDLV ALGFTGSYDR
VCAFARQWKD SEQFKAQTSG KGCFIPLRFA CGEAFQFDWS EDFARIAGKQ VKLQIAQFKL AHSRAFVLRA YYQQKHEMLF DAHWHAFQIF GGIPKRGIYD
NMKTAVDSVG RGKERRVNQR FTAMVSHYLF DAQFCNPASG WEKGQIEKNV QDSRQRLWQG APDFQSLADL NVWLEHRCKA LWSELRHPEL DQTVQEAFAD
EQGELMALPN AFDAFVEQTK RVTSTCLVHH EGNRYSVPAS YANRAISLRI YADKLVMAAE GQHIAEHPRL FGSGHARRGH TQYDWHHYLS VLQKKPGALR
NGAPFAELPP AFKKLQSILL QRPGGDRDMV EILALVLHHD EGAVLSAVEL ALECGKPSKE HVLNLLGRLT EEPPPKPIPI PKGLRLTLEP QANVNRYDSL
RRAHDAA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istB IstB IS1326 786 13882-14667 +
Class:   Accessory Gene
Sub Class:   ATPase Transposition Helper
Function:   stimulates transposition
Protein Sequence:  
MMQHEGHVRI LKSLKLFGMA HAIEELGNQN SPAFNQALPM LDSLIKAEVA EREVRSVNYQ LRVAKFPVYR DLVGFDFSQS LVNEATVKQL HRCDFMEQAQ
NVVLIGGPGT GKTHLATAIG TQAVMHLNRR VRFFSTVDLV NALEQEKSSG RQGQIANRLL YADLVILDEL GYLPFSQTGG ALLFHLLSKL YEKTSVILTT
NLSFSEWSRV FGDEKMTTAL LDRLTHHCHI LETGNESYRF KHSSTQNKQE EKQTRKLKIE T

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
GNAT_fam GNAT_fam In_Tn4 501 14843-15343 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  Acetyltransf_1 (Pfam:PF00583)
Comment:   putative acetyltransferase ADU64769.1
Protein Sequence:  
MDSEEPPNVR VACSGDIDEV VRLMHDAAAW MSAKGTPAWD VARIDRTFAE TFVLRSELLV ASCSDGIVGC CTLSAEDPEF WPDALKGEAA YLHKLAVRRT
HAGRGVSSAL IEACRHAART QGCAKLRLDC HPNLRGLYER LGFTHVDTFN PGWDPTFIAE RLELEI

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
sul1 (ARO:3000410) Sul1 In_Tn4 840 15471-16310 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Transpoase Chemistry:   dihydropteroate synthase
Target:   sulfonamide antibiotic (ARO:3000282)||sulfone antibiotic (ARO:3003401)
Sequence Family:  sulfonamide resistant sul (ARO:3004238)
Comment:   perfect match to reference sequence for ARO:3000410
Protein Sequence:  
MVTVFGILNL TEDSFFDESR RLDPAGAVTA AIEMLRVGSD VVDVGPAASH PDARPVSPAD EIRRIAPLLD ALSDQMHRVS IDSFQPETQR YALKRGVGYL
NDIQGFPDPA LYPDIAEADC RLVVMHSAQR DGIATRTGHL RPEDALDEIV RFFEARVSAL RRSGVAADRL ILDPGMGFFL SPAPETSLHV LSNLQKLKSA
LGLPLLVSVS RKSFLGATVG LPVKDLGPAS LAAELHAIGN GADYVRTHAP GDLRSAITFS ETLAKFRSRD ARDRGLDHA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacEdelta1 (ARO:3005010) QacEdelta1 In_Tn4 348 16304-16651 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   acridine dye (ARO:3000054)||quaternary ammonium salts
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Comment:   subunit of the qac multidrug efflux pump||perfect match to reference sequence for ARO:3005010 (bitscore:219)
Protein Sequence:  
MKGWLFLVIA IVGEVIATSA LKSSEGFTKL APSAVVIIGY GIAFYFLSLV LKSIPVGVAY AVWSGLGVVI ITAIAWLLHG QKLDAWGFVG MGLIIAAFLL
ARSPSWKSLR RPTPW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aadA (ARO:3002601) AadA In_Tn4 792 16815-17606 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Transpoase Chemistry:   aminoglycoside nucleotidyltransferase
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  ANT(3'') (ARO:3004275)
Comment:   perfect match to reference sequence for ARO:3002601||Synonyms: aadA1-pm, aadA, aadA1, aad(3'')(9)
Protein Sequence:  
MREAVIAEVS TQLSEVVGVI ERHLEPTLLA VHLYGSAVDG GLKPHSDIDL LVTVTVRLDE TTRRALINDL LETSASPGES EILRAVEVTI VVHDDIIPWR
YPAKRELQFG EWQRNDILAG IFEPATIDID LAILLTKARE HSVALVGPAA EELFDPVPEQ DLFEALNETL TLWNSPPDWA GDERNVVLTL SRIWYSAVTG
KIAPKDVAAD WAMERLPAQY QPVILEARQA YLGQEEDRLA SRADQLEEFV HYVKGEITKV VGK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 In_Tn4 1014 17755-18768 +
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LRTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpM TnpM Tn4 351 18971-19321 +
Class:   Accessory Gene
Sub Class:   Inhibitor
Function:   transposition regulator; reported to enhance Tn21 transposition and suppress resolution of cointegrate replicons in vivo
Comment:   3'-end of urfM ORF, which is interrupted by insertion of In2||inhibits tranposition probably by inhibiting resolution
Protein Sequence:  
MEVVAEGVET PDCLAWLRQA GCDTVQGFLF ARPMPAAAFV GFVNQWRNTT MNANEPSTSC CVCCKEIPLD AAFTPEGAEY VEHFCGLECY QRFQARASTA
TETSVKPDAC DSPPSG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn4 561 19447-20007 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   identical to tnpR (TnAs3)
Protein Sequence:  
MTGQRIGYIR VSTFDQNPER QLEGVKVDRA FSDKASGKDV KRPQLEALIS FARTGDTVVV HSMDRLARNL DDLRRIVQTL TQRGVHIEFV KEHLSFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKSLSSER IAELRQRVEA GEQKTKLARE FGISRETLYQ YLRTDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn4 2967 20010-22976 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Comment:   identical to TnAs3 tnpA
Protein Sequence:  
MPRRSILSAA ERESLLALPD SKDDLIRHYT FNDTDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEL PFPPLLKLVA DQLKVGVESW NEYGQREQTR
REHLSELQTV FGFRPFTMSH YRQAVQMLTE LAMQTDKGIV LASALIGHLR RQSVILPALN AVERASAEAI TRANRRIYDA LAEPLADAHR RRLDDLLKRR
DNGKTTWLAW LRQSPAKPNS RHMLEHIERL KAWQALDLPT GIERLVHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LATEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLY GRIGQALIDA KQSGRDAFAA IEAVMSWDSF AESVTEAQKL AQPDDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKN VLDAIEVLRG MNTDNARKLP ADAPTGFIKP RWQKLVMTDA GIDRRYYELC ALSELKNSLR SGDIWVQGSR QFKDFEDYLV PPEKFTSLKQ
SSELPLAVAT DCEQYLHERL TLLEAQLATV NRMAAANDLP DAIITESGLK ITPLDAAVPD TAQALIDQTA MVLPHVKITE LLLEVDEWTG FTRHFTHLKS
GDLAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHTRDET YSTALAELVN AQFRHPFAGH WGDGTTSSSD GQNFRTASKA KSTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGLRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERAAHALRGN GHAVDDSLLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
Tn3.1-KY749247.1 Tn3.1 Transposon 1019-5966 4948
In_Tn4-KY749247.1 In Integron 9587-18970 9384
IS1326-KY749247.1 IS1326 Insertion Sequence 12265-14734 2470

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
repeat i4 Tn4 10-28 TCAGAAAACG GAAAATAAA
IRL Tn3.1 1019-1056 GGGGTCTGAC GCTCAGTGGA ACGAAAACTC ACGTTAAG
IRR Tn3.1 5929-5966 GAATTGCACT CAAAAGCAAG GTGACTCGCA GTCTGGGG
IRt In_Tn4 9587-9619 TGTCATTTTC AGAAGACGAC TGCACCAGTT GAT
repeat t1 In_Tn4 9595-9613 TCAGAAGACG ACTGCACCA
repeat t2 In_Tn4 9635-9653 AACACGTCGG TCGAGGACT
repeat t3 In_Tn4 9664-9683 TCAGAAGTGA TCTGCACCAA
repeat t4 In_Tn4 9696-9714 TCAATACTCG TGTGCACCA
IRL IS1326 12265-12290 TGTTGAGTTG CATCTAAAAT TGACCC
IRR IS1326 14709-14734 CCCAGTTTAA ACCCACGTTT AGTTGT
repeat i4 In_Tn4 18851-18869 AGGAGGGACG CAGGCGACT
repeat i3 In_Tn4 18879-18897 CGTCGGGCAG CAACGGACT
repeat i2 In_Tn4 18921-18939 ATCACGTCAG CCGAAGACT
IRi In_Tn4 18938-18970 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 In_Tn4 18944-18962 GTCACGTCGG CAGAAGACT
IRR Tn4 22972-23009 GAATCGCACG AAATAAAAGG CAAAAGACTC TGCTGGGG

 References