Transposon
Name: Tn3.1
Family: Tn3        Group: Tn3
Evidence of Transposition: no
 Host     

Host Organism:Salmonella enterica subsp. enterica serovar Paratyphi B Molecular Source:plasmid R1

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG
IRR (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG

 Sequence     
DNA SequenceLength  4948 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCTGAC GCTCAGTGGA ACGAAAACTC ACGTTAAGGG ATTTTGGTCA TGAGATTATC AAAAAGGATC TTCACCTAGA TCCTTTTAAA TTAAAAATGA 100
AGTTTTAAAT CAATCTAAAG TATATATGAG TAAACTTGGT CTGACAGTTA CCAATGCTTA ATCAGTGAGG CACCTATCTC AGCGATCTGT CTATTTCGTT 200
CATCCATAGT TGCCTGACTC CCCGTCGTGT AGATAACTAC GATACGGGAG GGCTTACCAT CTGGCCCCAG TGCTGCAATG ATACCGCGAG ACCCACGCTC 300
ACCGGCTCCA GATTTATCAG CAATAAACCA GCCAGCCGGA AGGGCCGAGC GCAGAAGTGG TCCTGCAACT TTATCCGCCT CCATCCAGTC TATTAATTGT 400
TGCCGGGAAG CTAGAGTAAG TAGTTCGCCA GTTAATAGTT TGCGCAACGT TGTTGCCATT GCTGCAGGCA TCGTGGTGTC ACGCTCGTCG TTTGGTATGG 500
CTTCATTCAG CTCCGGTTCC CAACGATCAA GGCGAGTTAC ATGATCCCCC ATGTTGTGCA AAAAAGCGGT TAGCTCCTTC GGTCCTCCGA TCGTTGTCAG 600
AAGTAAGTTG GCCGCAGTGT TATCACTCAT GGTTATGGCA GCACTGCATA ATTCTCTTAC TGTCATGCCA TCCGTAAGAT GCTTTTCTGT GACTGGTGAG 700
TACTCAACCA AGTCATTCTG AGAATAGTGT ATGCGGCGAC CGAGTTGCTC TTGCCCGGCG TCAACACGGG ATAATACCGC GCCACATAGC AGAACTTTAA 800
AAGTGCTCAT CATTGGAAAA CGTTCTTCGG GGCGAAAACT CTCAAGGATC TTACCGCTGT TGAGATCCAG TTCGATGTAA CCCACTCGTG CACCCAACTG 900
ATCTTCAGCA TCTTTTACTT TCACCAGCGT TTCTGGGTGA GCAAAAACAG GAAGGCAAAA TGCCGCAAAA AAGGGAATAA GGGCGACACG GAAATGTTGA 1000
ATACTCATAC TCTTCCTTTT TCAATATTAT TGAAGCATTT ATCAGGGTTA TTGTCTCATG AGCGGATACA TATTTGAATG TATTTAGAAA AATAAACAAA 1100
TAGGGGTTCC GCGCACATTT CCCCGAAAAG TGCCACCTGA CGTCTAAGAA ACCATTATTA TCATGACATT AACCTATAAA AATAGGCGTA TCACGAGGCC 1200
CTTTCGTCTT CAAGAATTTT ATAAACCGTG GAGCGGGCAA TACTGAGCTG ATGAGCAATT TCCGTTGCAC CAGTGCCCTT CTGATGAAGC GTCAGCACGA 1300
CGTTCCTGTC CACGGTACGC CTGCGGCCAA ATTTGATTCC TTTCAGCTTT GCTTCCTGTC GGCCCTCATT CGTGCGCTCT AGGATCCTCC GGCGTTCAGC 1400
CTGTGCCACA GCCGACAGGA TGGTGACCAC CATTTGCCCC ATATCACCGT CGGTACTGAT CCCGTCGTCA ATAAACCGAA CCGCTACACC CTGAGCATCA 1500
AACTCTTTTA TCAGTTGGAT CATGTCGGCG GTGTCGCGGC CAAGACGGTC GAGCTTCTTC ACCAGAATGA CATCACCTTC CTCCACCTTC ATCCTCAGCA 1600
AATCCAGCCC TTCCCGATCT GTTGAACTGC CGGATGCCTT GTCGGTAAAG ATGCGGTTAG CTTTTACCCC TGCATCTTTG AGCGCTCTGA TCTGAATATC 1700
GAGGGACTGC TGGCTGGTTG AGACCCGCGC ATAACCAAAA ATTCGCATAA AAATGTACCT TAAATCGAAT ATCAGACACG ATGTGTCTAT TATGCCAAAA 1800
TGACGATTTA ATGGACACTC AAACGAAGCC GTTTTACTAT GTCTGATAAT TTATAATATT TCGAACGGTT GCAGTTGTGT TAAAAAAGCC GTCAGGCAGG 1900
GAGGCCGATA TGCCCGTTGA TTTTTTGACC ACTGAGCAGG TTGAGAGTTA TGGCAGGTTC ACTGGCGAAC CCGATGAACT TCAGCTGGCG CGTTATTTTC 2000
ATCTTGATGA AGCGGATAAA GAATTTATCG GGAAAAGCCG GGGTGATCAC AATCGACTTG GTATTGCCCT GCAAATCGGG TGTGTGCGTT TTCTGGGCAC 2100
TTTTCTTACT GACATGAATC ATATTCCTTC CGGCGTCCGG CATTTTACCG CCAGACAGCT CGGGATTCGT GATATCACCG TTCTTGCAGA ATACGGTCAG 2200
AGGGAAAATA CCCGCCGTGA GCATGCAGCG CTGATACGTC AGCACTATCA GTATCGTGAA TTTGCCTGGC CCTGGACATT TCGCCTTACC CGTCTTTTAT 2300
ATACCCGGAG CTGGATAAGC AACGAACGTC CTGGCCTGCT TTTCGACCTG GCGACAGGGT GGCTTATGCA ACATCGTATT ATTCTCCCCG GAGCCACCAC 2400
GCTGACCCGG TTGATTTCAG AGGTAAGGGA AAAGGCGACG TTGCGCCTGT GGAACAAACT GGCACTGATA CCGTCAGCCG AACAGCGTTC ACAGCTGGAG 2500
ATGCTGCTGG GGCCAACTGA TTGCAGCCGC CTGTCTTTAC TGGAATCACT GAAAAAAGGC CCTGTGACCA TCAGTGGTCC GGCGTTTAAT GAAGCAATTG 2600
AACGCTGGAA AACTCTGAAC GATTTTGGCC TGCATGCTGA AAACCTGAGT ACACTCCCGG CTGTGCGCCT GAAAAATCTC GCACGTTATG CTGGTATGAC 2700
TTCGGTGTTC AATATTGCCA GGATGTCACC GCAGAAAAGG ATGGCGGTTC TGGTTGCCTT TGTCCTTGCA TGGGAAACGC TGGCGCTGGA TGATGCACTG 2800
GACGTTCTGG ACGCCATGCT GGCCGTTATC ATCCGTGACG CCAGAAAGAT TGGGCAGAAA AAACGGCTCC GCTCGCTGAA GGATCTGGAT AAATCTGCAT 2900
TGGCGCTCGC CAGCGCATGT TCGTACTTGC TGAAAGAAGA AACACCGGAC GAATCGATTC GTGCTGAGGT GTTCAGCTAC ATCCCTAGGC AAAAGCTGGC 3000
TGAAATCATC ACGCTTGTCC GTGAAATTGC CCGGCCCTCA GACGATAATT TTCATGACGA AATGGTGGAG CAGTACGGGC GCGTTCGTCG TTTCCTGCCC 3100
CATCTGCTGA ATACCGTTAA ATTTTCATCC GCACCTGCCG GGGTTACCAC TCTGAATGCC TGTGACTACC TCAGCCGGGA GTTCAGCTCA CGGCGGCAGT 3200
TTTTTGACGA CGCACCAACG GAAATCATCA GTCAGTCATG GAAACGGCTG GTGATTAACA AGGAAAAACA TATCACCCGA AGGGGATACA CGCTCTGCTT 3300
TCTCAGTAAA CTGCAGGATA GTCTGAGACG GAGGGATGTC TACGTTACCG GCAGTAACCG GTGGGGAGAT CCTCGTGCAA GATTACTACA GGGTGCTGAC 3400
TGGCAGGCAA ATCGGATTAA GGTTTATCGT TCTTTGGGGC ACCCGACAGA CCCGCAGGAA GCAATAAAAT CTCTGGGCCA TCAGCTTGAT AGTCGTTACA 3500
GACAGGTTGC TGCACGTCTT GGCGAAAATG AGGCTGTCGA ACTCGATGTT TCTGGCCCGA AGCCCCGGTT GACAATTTCT CCCCTCGCCA GTCTTGATGA 3600
GCCGGACAGT CTGAAACGAC TGAGCAAAAT GATCAGTGAT CTGCTCCCTC CGGTGGATTT AACGGAGTTG CTGCTCGAAA TTAACGCCCA TACCGGATTT 3700
GCTGATGAGT TTTTCCATGC CAGTGAAGCC AGTGCCAGAG TTGATGATCT GCCCGTCAGC ATCAGCGCCG TGCTGATGGC TGAAGCCTGC AATATCGGTC 3800
TGGAACCACT GATCAGATCA AATGTTCCTG CACTGACCCG ACACCGGCTG AACTGGACAA AAGCGAACTA TCTGCGGGCT GAAACTATCA CCAGCGCTAA 3900
TGCCAGACTG GTTGATTTTC AGGCAACGCT GCCACTGGCA CAGATATGGG GTGGAGGAGA AGTGGCATCT GCAGATGGAA TGCGCTTTGT TACGCCAGTC 4000
AGAACAATCA ATGCCGGACC GAACCGCAAA TACTTTGGTA ATAACAGAGG GATCACCTGG TACAACTTTG TGTCCGATCA GTATTCCGGC TTTCATGGCA 4100
TCGTTATACC GGGGACGCTG AGGGACTCTA TCTTTGTGCT GGAAGGCCTT CTGGAACAGG AGACCGGGCT GAATCCAACC GAAATTATGA CCGATACGGC 4200
AGGTGCCAGC GATCTTGTCT TTGGCCTTTT CTGGCTGCTG GGATACCAGT TTTCTCCACG CCTGGCTGAT GCCGGTGCTT CGGTTTTCTG GCGAATGGAC 4300
CATGATGCCG ACTATGGCGT GCTGAATGAT ATTGCCAGAG GGCAATCAGA TCCCCGAAAA ATAGTCCTTC AGTGGGACGA AATGATCCGG ACCGCAGGCT 4400
CCCTGAAGCT GGGCAAAGTA CAGGCCTCAG TGCTGGTCCG TTCATTGCTG AAAAGTGAAC GTCCCTCCGG ACTGACTCAG GCAATCATTG AAGTGGGGCG 4500
CATCAACAAA ACGCTGTATC TGCTTAATTA TATTGATGAT GAAGATTACC GCCGGCGCAT TCTGACCCAG CTTAATCGGG GAGAAAGCCG TCATGCAGTT 4600
GCCAGAGCCA TCTGTCACGG TCAAAAAGGT GAGATAAGAA AACGATATAC CGACGGTCAG GAAGATCAGT TGGGAGCTCT GGGGCTGGTC ACTAACGCCG 4700
TCGTGTTATG GAACACTATT TATATGCAGG CAGCTCTGGA TCATCTCCGG GCGCAGGGTG AAACACTGAA TGATGAAGAT ATCGCACGCC TCTCCCCGCT 4800
TTGCCACGGA CATATCAATA TGCTCGGCCA TTATTCCTTC ACGCTGGCAG AACTGGTGAC CAAAGGTCAT CTGAGACCAT TAAAAGAGGC GTCAGAGGCA 4900
GAAAACGTTG CTTAACGTGA GTTTTCGTTC CACTGAGCGT CAGACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 1751-1871 121 AAATGTACCT TAAATCGAAT ATCAGACACG ATGTGTCTAT TATGCCAAAA TGACGATTTA
ATGGACACTC AAACGAAGCC GTTTTACTAT GTCTGATAAT TTATAATATT TCGAACGGTT
G
res_site_III_a 1754-1776 23 TGTACCTTAA ATCGAATATC AGA
res_site_II_a 1782-1817 36 TGTGTCTATT ATGCCAAAAT GACGATTTAA TGGACA
res_site_I 1840-1868 29 TGTCTGATAA TTTATAATAT TTCGAACGG
res_minus_35 3569-3574 6 TTGACA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
bla TEM-1 (ARO:3000873) Tn3.1 148-1008 Passenger Gene Antibiotic Resistance -
tnpR Tn3.1 1191-1748 Accessory Gene Resolvase -
tnpA Tn3.1 1877-4915 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla TEM-1 (ARO:3000873) Bla TEM-1 Tn3.1 861 148-1008 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   penem (ARO:3003706)||cephalosporin (ARO:0000032)||monobactam (ARO:0000004)||penam (ARO:3000008)
Sequence Family:  TEM beta-lactamase (ARO:3000014)
Comment:   perfect match to reference sequence for ARO:3000873||Synonyms: TEM-98, RTEM-1
Protein Sequence:  
MSIQHFRVAL IPFFAAFCLP VFAHPETLVK VKDAEDQLGA RVGYIELDLN SGKILESFRP EERFPMMSTF KVLLCGAVLS RVDAGQEQLG RRIHYSQNDL
VEYSPVTEKH LTDGMTVREL CSAAITMSDN TAANLLLTTI GGPKELTAFL HNMGDHVTRL DRWEPELNEA IPNDERDTTM PAAMATTLRK LLTGELLTLA
SRQQLIDWME ADKVAGPLLR SALPAGWFIA DKSGAGERGS RGIIAALGPD GKPSRIVVIY TTGSQATMDE RNRQIAEIGA SLIKHW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn3.1 558 1191-1748 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   first defined as a repressor
Protein Sequence:  
MRIFGYARVS TSQQSLDIQI RALKDAGVKA NRIFTDKASG SSTDREGLDL LRMKVEEGDV ILVKKLDRLG RDTADMIQLI KEFDAQGVAV RFIDDGISTD
GDMGQMVVTI LSAVAQAERR RILERTNEGR QEAKLKGIKF GRRRTVDRNV VLTLHQKGTG ATEIAHQLSI ARSTVYKILE DERAS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn3.1 3039 1877-4915 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Comment:   In frame three amino acid deletion relative to tnpA (Tn3)
Protein Sequence:  
VLKKPSGREA DMPVDFLTTE QVESYGRFTG EPDELQLARY FHLDEADKEF IGKSRGDHNR LGIALQIGCV RFLGTFLTDM NHIPSGVRHF TARQLGIRDI
TVLAEYGQRE NTRREHAALI RQHYQYREFA WPWTFRLTRL LYTRSWISNE RPGLLFDLAT GWLMQHRIIL PGATTLTRLI SEVREKATLR LWNKLALIPS
AEQRSQLEML LGPTDCSRLS LLESLKKGPV TISGPAFNEA IERWKTLNDF GLHAENLSTL PAVRLKNLAR YAGMTSVFNI ARMSPQKRMA VLVAFVLAWE
TLALDDALDV LDAMLAVIIR DARKIGQKKR LRSLKDLDKS ALALASACSY LLKEETPDES IRAEVFSYIP RQKLAEIITL VREIARPSDD NFHDEMVEQY
GRVRRFLPHL LNTVKFSSAP AGVTTLNACD YLSREFSSRR QFFDDAPTEI ISQSWKRLVI NKEKHITRRG YTLCFLSKLQ DSLRRRDVYV TGSNRWGDPR
ARLLQGADWQ ANRIKVYRSL GHPTDPQEAI KSLGHQLDSR YRQVAARLGE NEAVELDVSG PKPRLTISPL ASLDEPDSLK RLSKMISDLL PPVDLTELLL
EINAHTGFAD EFFHASEASA RVDDLPVSIS AVLMAEACNI GLEPLIRSNV PALTRHRLNW TKANYLRAET ITSANARLVD FQATLPLAQI WGGGEVASAD
GMRFVTPVRT INAGPNRKYF GNNRGITWYN FVSDQYSGFH GIVIPGTLRD SIFVLEGLLE QETGLNPTEI MTDTAGASDL VFGLFWLLGY QFSPRLADAG
ASVFWRMDHD ADYGVLNDIA RGQSDPRKIV LQWDEMIRTA GSLKLGKVQA SVLVRSLLKS ERPSGLTQAI IEVGRINKTL YLLNYIDDED YRRRILTQLN
RGESRHAVAR AICHGQKGEI RKRYTDGQED QLGALGLVTN AVVLWNTIYM QAALDHLRAQ GETLNDEDIA RLSPLCHGHI NMLGHYSFTL AELVTKGHLR
PLKEASEAEN VA

 References