Transposon
Name: Tn2424
Family: Tn3        Group: Tn21
Evidence of Transposition: yes
 Host     

Host Organism:Escherichia coli NCTC11186
Place of Origin:United Kingdom Date of Isolation:2018
Other Geographic Information:1983 PM ID: 6307980

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  26008 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGCACCT CAGAAAACGG AAAATAAAGC ACGCTAAGGC ATAGCTGACC TTGCCAGGCC TGCTTCGCCC TGTAGTGACG CGATCAACGG GCAGGAAACA 100
TTCCCCTTTC GTGCATGGCA GGCGCACACG AGTTCAGACA GCACGGTTTC CATGCGCGCC AAGTCGGCCA TCTTCTCGCG CACGTCCTTG AGCTTGTGTT 200
CGGCCAGGCT GCTGGCCTCC TCGCAGTGGG TGCCATCGTC GAGCCGCAAC AGCTCGGCAA TCTCGTCCAG ACTGAACCCC AGCCGCTGTG CCGATTTCAC 300
GAATTTCACC CGAACCACGT CCGCCTCCCC ATAGCGGCGG ATGCTGCCGT AAGGCTTGTC CGGTTCCCGC AACAGGCCCT TGCGCTGATA GAAGCGGATT 400
GTCTCCACGT TGACCCCGGC CGCCTTGGCA AAAACGCCAA TGGTCAGGTT TTCCAAATTA TTTTCCATAT CGCTTGACTC CGTACATGAG TACGGAAGTA 500
AGGTTACGCT ATCCAATCCA AATTCAAAAG GGCCAACGTA TGTCTGAACC ACAAAACGGG CGCGGTGCGC TCTTCGCCGG CGGGCTGGCC GCCATTCTTG 600
CATCGACCTG CTGCCTGGGG CCGCTAGTAC TGGTCGCCCT GGGCTTCTCC GGTGCTTGGA TCGGCAACCT GACGGTGCTG GAACCCTATC GACCGTTGTT 700
CATCGGCGCG GCGCTAGTGG CGCTGTTCTT CGCCTGGAAG CGGATTTACC GGCCCGTGCA GGCATGCAAG CCAGGTGAGG TCTGCGCGAT TCCGCAGGTG 800
CGCGCCACCT ACAAGCTGAT TTTCTGGATC GTGGCCGTGC TGGTCCTGGT CGCGCTTGGA TTTCCCTATG TCGTTCCATT TTTCTATTAA CCAGGAGTTC 900
ATCATGAAGA AACTGTTTGC CTCCCTTGCC CTCGCCGCCG CTGTTGCCCC GGTGTGGGCC GCTACCCAGA CCGTCACGCT AGCGGTTCCC GGCATGACTT 1000
GCGCCGCCTG CCCGATCACA GTCAAGAAAG CGCTCTCCAA GGTCGAAGGC GTGAGCAAGG TCGATGTGGG CTTCGAGAAG CGCGAGGCCG TCGTCACTTT 1100
TGACGACACC AAGGCCAGCG TACAGAAGCT GACCAAGGCC ACCGCAGACG CCGGCTATCC GTCCAGCGTC AAGCAGTGAG CCAGCAAGCC AACGACAACA 1200
GCGAGAGCCG CTTCATGGGA CTGATGACAC GCATTGCCGA TAAAACCGGC GCGCTCGGCA GCGTCGTTTC CGCGATGGGC TGCGCCGCCT GCTTTCCAGC 1300
CCTCGCCAGC TTCGGCGCGG CCATCGGGCT GGGCTTCTTG AGCCAGTACG AGGGACTGTT CATCAGCCGC CTGCTGCCGC TGTTTGCCGC GCTGGCCTTC 1400
CTGGCGAACG CGCTGGGTTG GTTCAGTCAT CGGCAATGGC TGCGCAGTCT GCTCGGCATG ATCGGCCCGG CCATCGTGTT TGCGGCCACG GTCTGGCTGC 1500
TCGGCAACTG GTGGACGGCG AACCTGATGT ACGTCGGCCT GGCCTTGATG ATTGGGGTGT CGATCTGGGA CTTCGTGTCG CCGGCGCATC GCCGTTGCGG 1600
ACCGGACGGC TGCGAACTCC CCGCCAAGCG CTTGTGAAAG ACGGCTGACC GTGCGACACG GCGGCCCACA CGAATAAGGA ACGATGGTAT GAGCACTCTC 1700
AAAATCACCG GCATGACTTG CGACTCGTGC GCAGTGCATG TCAAGGACGC CCTGGAGAAA GTGCCCGGCG TGCAATCAGC GGATGTCTCC TACGCCAAGG 1800
GCAGCGCCAA GCTCGCCATT GAGGTCGGCA CGTCACCCGA CGCGCTGACG GCCGCTGTAG CTGGACTCGG TTATCGGGCC ACGCTGGCCG ATGCCCCCTC 1900
AGTTTCGACG CCGGGCGGAT TGCTCGACAA GATGCGCGAT CTGCTGGGCA GAAACGACAA GACGGGTAGC AGCGGCGCAT TGCATATCGC CGTCATCGGC 2000
AGCGGCGGGG CCGCGATGGC AGCGGCGCTG AAGGCCGTCG AGCAAGGCGC ACGTGTCACG CTGATCGAGC GCGGCACCAT CGGCGGCACC TGCGTCAATG 2100
TCGGTTGTGT GCCGTCCAAG ATCATGATCC GCGCCGCCCA TATCGCCCAT CTGCGCCGGG AAAGCCCGTT CGATGGCGGC ATCGCCGCTA CCACGCCGAC 2200
CATCCAGCGC ACGGCGCTGC TGGCCCAGCA GCAGGCCCGC GTCGATGAAC TGCGCCACGC CAAGTACGAA GGCATCTTGG AGGGCAATCC GGCGATCACT 2300
GTGCTGCACG GCTCCGCCCG CTTTAAGGAC AATCGCAACC TGATCGTGCA ACTCAACGAC GGCGGCGAGC GCGTGGTGGC ATTCGACCGC TGCCTGATCG 2400
CCACCGGCGC GAGCCCGGCC GTGCCGCCGA TTCCCGGCCT GAAAGACACT CCGTACTGGA CTTCCACTGA AGCGCTGGTC AGCGAGACGA TTCCTAAGCG 2500
CCTGGCCGTG ATTGGCTCAT CAGTGGTGGC GCTGGAGCTG GCGCAGGCGT TCGCCCGACT CGGAGCGAAG GTGACGATCC TGGCTCGCAG CACGCTGTTC 2600
TTCCGCGAAG ACCCAGCTAT AGGCGAAGCC GTCACGGCCG CATTCCGCAT GGAGGGCATC GAGGTGAGGG AACACACCCA GGCCAGCCAG GTCGCGTATA 2700
TCAATGGTGA AGGGGACGGC GAATTCGTGC TCACCACGGC GCACGGCGAA CTGCGCGCCG ACAAGCTGCT GGTCGCCACC GGCCGCGCGC CCAACACACG 2800
CAAGCTGGCA CTGGATGCGA CGGGCGTCAC GCTCACCCCG CAAGGCGCTA TCGTCATCGA CCCCGGCATG CGTACAAGCG TGGAACACAT CTACGCCGCA 2900
GGCGACTGCA CCGACCAGCC GCAGTTCGTC TATGTGGCGG CAGCGGCCGG CACTCGCGCC GCGATCAACA TGACCGGCGG TGACGCGGCC CTGAACCTGA 3000
CCGCGATGCC GGCCGTGGTG TTCACCGACC CGCAAGTGGC GACCGTAGGC TACAGCGAGG CGGAAGCGCA CCATGACGGC ATCAAAACTG ATAGTCGCAC 3100
GCTAACGCTG GACAACGTGC CGCGCGCGCT CGCCAACTTC GACACGCGCG GCTTCATCAA ACTGGTGGTT GAAGAAGGCA GCGGACGACT GATCGGCGTG 3200
CAGGCAGTGG CCCCGGAAGC GGGCGAACTG ATCCAGACGG CCGCACTGGC GATTCGCAAC CGGATGACGG TGCAGGAACT GGCCGACCAG TTGTTCCCCT 3300
ACCTGACGAT GGTCGAAGGG TTGAAGCTCG CGGCGCAGAC CTTCAACAAG GATGTGAAGC AGCTTTCCTG CTGCGCCGGG TGAGGACAAG GAGGTGTGCG 3400
ATGAGCGCCT ACACGGTATC GCAACTGGCC CATAACGCTG GGGTGAGCGT ACATATCGTG CGCGACTACC TGGTGCGCGG CTTGTTACGG CCGGTGGCCT 3500
GCACCACGGG CGGCTACGGC GTGTTCGACG ATGCGGCCTT GCAACGGCTG TGCTTCGTGC GCGCGGCCTT CGAGGCGGGT ATCGGCCTGG ATGCCCTGGC 3600
GCGGCTGTGC CGTGCGCTCG ACGCAGCGGA CGGCGCACAA GCCGCAGCGC AGCTTGCCGT GCTGCGCCAG TTGGTCGAGC GGCGGCGCGC GGCGTTGGCC 3700
CATCTGGACG CGCAACTGGC CTCCATGCCA GCCGAGCGGG CGCACGAGGA GGCATTGCCG TGAACGCCCC TGACAAACTG CCGCCCGAGA CGCGCCAACC 3800
CGTTTCCGGC TACCTGTGGG GTGCGCTGGC CGTGTTGACC TGCCCCTGCC ATCTGCCGAT TCTCGCCGCC GTGCTGGCCG GGACGACCGC CGGTGCCTTC 3900
CTTGGCGAGC ATTGGGGTGT TGCCGCGCTC GCGCTGACCG GCTTGTTCGT TCTGGCCGTA ACGCGGCTGC TGCGCGCCTT CCGGGGCGGA TCATGACGAG 4000
TTCGCAGCCC GCCGGATGGA CGGCGGCCGA GTTGGCGCAG GCGGCGGCGC GCGGACAGCT TGACCTGCAT TACCAGCCGC TGGTCGATCT GCGCGATCAC 4100
CGGATCGCTG GCGCGGAAGC GTTGATGCGC TGGCGGCATC CGAGGCTTGG CCTGTTGCCG CCCGGCCAGT TCCTGCCGCT GGCCGAGTCG TTCGGCCTGA 4200
TGCCGGAAAT AGGCGCGTGG GTGCTGGGCG AGGCCTGTCG CCAGATGCAC AAGTGGCAAG GACCGGCATG GCAACCGTTC CGTCTTGCCA TCAATGTGTC 4300
CGCCAGCCAG GTTGGGCCAA CGTTCGACGA CGAGGTAAAG CGGGTGCTGG CCGATATGGC CCTGCCCGCC GAGCTTCTGG AGATCGAACT GACCGAATCG 4400
GTCGCATTCG GCAATCCAGC CCTGTTCGCC AGTTTCGACG CCTTGCGCGC CATCGGCGTG CGCTTCGCCG CCGACGACTT CGGCACCGGC TATTCCTGCC 4500
TGCAACATCT GAAATGCTGC CCCATCACCA CATTGAAAAT CGACCAATCC TTTGTCGCCA GGCTCCCGGA TGATGCCCGT GACCAAACTA TCGTGCGGGC 4600
GGTGATCCAG CTCGCGCACG GGCTGGGCAT GGATGTCATT TTCAGAAGAC GACTGCACCA GTTGATTGGG CGTAATGGCT GTTGTGCAGC CAGCTCCTGA 4700
CAGTTCAATA TCAGAAGTGA TCTGCACCAA TCTCGACTAT GCTCAATACT CGTGTGCACC AAAGCGAGGT GAGCATGGCG ACGGACACCC CACGGATTCC 4800
AGAACAAGGC GTGGCCACTC TGCCTGATGA GGCTTGGGAG CGTGCGCGCC GTCGTGCGGA GATCATCAGT CCGTTGGCGC AGTCGGAGAC GGTCGGGCAC 4900
GAAGCGGCCG ATATGGCGGC TCAGGCGCTG GGCTTGTCTC GGCGCCAGGT ATACGTTCTG ATCCGGCGTG CCCGGCAAGG CAGCGGCCTC GTGACGGATC 5000
TGGTGCCCGG CCAGTCCGGT GGAGGTAAAG GTAAGGGGCG CTTGCCGGAA CCGGTCGAGC GCGTCATCCA CGAGCTACTG CAAAAGCGGT TCCTGACCAA 5100
GCAGAAGCGC AGCCTAGCGG CCTTTCACCG CGAAGTCACT CAGGTGTGCA AGGCTCAAAA ACTGCGAGTG CCGGCGCGCA ATACCGTGGC CTTACGGATC 5200
GCTAGCCTTG ACCCGCGCAA GGTCATCCGC CGGCGGGAAG GCCAGGATGC CGCTCGTGAC CTACAAGGTG TGGGCGGCGA GCCTCCTGCC GTGACCGCGC 5300
CGCTGGAGCA GGTGCAGATA GACCATACGG TCATCGACCT GATCGTGGTC GATGACCGCG ACCGGCAACC TATTGGCCGC CCGTACCTGA CCCTCGCCAT 5400
CGACGTGTTC ACCCGCTGCG TGCTCGGCAT GGTCGTCACG CTGGAAGCGC CGTCTGCCGT TTCGGTTGGC CTGTGCCTCG TGCATGTCGC CTGCGACAAG 5500
CGCCCTTGGC TGGAAGGACT GAACGTGGAA ATGGATTGGC AGATGAGCGG CAAGCCCTTG CTGCTCTACC TAGACAACGC GGCCGAGTTC AAGAGCGAGG 5600
CCCTGCGCCG GGGTTGCGAG CAGCATGGCA TCCGGCTGGA CTATCGCCCG CTGGGACAGC CGCACTATGG CGGCATCGTG GAACGGATCA TCGGCACGGC 5700
GATGCAGATG ATTCACGACG AACTGCCGGG AACGACCTTC TCCAACCCTG ACCAGCGCGG CGACTACGAT TCCGAAAACA AGGCCGCCCT GACGCTGCGC 5800
GAGCTAGAGC GCTGGCTCAC ATTGGCGGTC GGCACCTACC ACGGTTCGGT GCACAACGGC CTGCTCCAAC CGCCGGCCGC GCGCTGGGCC GAGGCCGTGG 5900
CGCGTGTCGG CGTACCGGCC GTCGTCACAC GCGCTACTTC GTTCCTGGTC GATTTTCTGC CGATCCTCCG GCGCACGCTG ACCCGCACCG GCTTTGTCAT 6000
CGACCACATC CACTACTACG CCGATGCGCT CAAGCCGTGG ATTGCGCGGC GTGAACGCTG GCCGTCCTTT CTGATCCGGC GCGATCCGCG CGACATCAGC 6100
CGTATCTGGG TCCTGGAACC GGAGGGACAG CATTACCTGG AAATTCCCTA CCGTACCTTG TCGCATCCGG CTGTCACCCT CTGGGAACAA CGGCAGGCGC 6200
TGGCGAAACT GCGGCAGCAA GGGCGCGAAC AGGTGGATGA GTCGGCGCTG TTCCGCATGA TCGGCCAGAT GCGTGAGATT GTGACCAGCG CGCAGAAGGC 6300
CACACGCAAG GCGCGGCGTG ACGCGGATCG CCGCCAGCAC CTCAAGACAT CAGCTCGGCC GGACAAGCCC GTTCCGCCGG ATACGGATAT TGCCGACCCG 6400
CAGGCAGACA ACTTGCCACC CGCCAAACCG TTCGACCAGA TTGAGGAGTG GTAGCCGTGG ACGAATATCC CATCATCGAC CTGTCCCACC TGCTGCCGGC 6500
GGCCCAGGGC TTGGCCCGTC TTCCGGCGGA CGAGCGCATC CAGCGCCTTC GCGCCGACCG CTGGATCGGC TATCCGCGCG CAGTCGAGGC GCTGAACCGG 6600
CTGGAAGCCC TTTATGCGTG GCCAAACAAG CAACGCATGC CCAACCTGCT GCTGGTTGGC CCGACCAACA ATGGCAAGTC GATGATCGTC GAGAAGTTCC 6700
GCCGCACCCA CCCGGCCAGC TCCGACGCCG ACCAGGAGCA CATCCCGGTG TTGGTCGTGC AGATGCCGTC CGAGCCGTCC GTGATCCGCT TCTACGTCGC 6800
GCTGCTCGCC GCGATGGGCG CGCCGCTGCG CCCACGCCCA CGGTTGCCGG AAATGGAGCA ACTGGCTCTG GCACTGCTGC GCAAGGTCGG CGTGCGCATG 6900
CTGGTGATCG ACGAGCTGCA CAACGTGCTG GCCGGCAACA GCGTCAACCG CCGGGAATTC CTCAACCTGC TGCGCTTCCT CGGCAACGAA CTGCGCATCC 7000
CGTTGGTTGG GGTAGGCACG CGCGACGCCT ACCTAGCCAT CCGCTCCGAT GACCAGTTGG AAAATCGCTT CGAGCCGATG ATGCTGCCGG TATGGGAGGC 7100
CAACGACGAT TGCTGCTCAC TGCTGGCCAG CTTCGCCGCT TCGCTCCCGC TGCGCCGGCC TTCCCCAATT GCCACGCTGG ACATGGCTCG CTACCTGCTC 7200
ACACGCAGCG AGGGCACCAT AGGGGAACTG GCGCACTTGC TGATGGCGGC GGCCATCGTC GCCGTGGAGA GCGGCGAGGA AGCGATCAAC CATCGCACAC 7300
TCAGCATGGC CTGTTGAGTT GCATCTAAAA TTGACCCACT GGGGGTGCGG ACGATTTCTT GGACGGTTTA TACGGACATC AATCCGACCG CATGACGATA 7400
CTCGATGGGA CTACGCCCGC CAAGCGACAC TTTGATGCGG CGCTCGTTGT ACCAGTGGAT ATAGGCATCG ATTCGCGTCA TGAGGTCTTT CAGCGTCACG 7500
TGCTGCCAAT TCCTCGGGTA GATTAGTTCG GTCTTCAATC GTCCGAAAAA GCCCTCGCAT GCAGCATTGT CTGGCGAGCA GCCCTTTTTG GACATCGACC 7600
GCGTTAATTG GGCATTTTCA GTGCGGCGGA TCCACGCAGG CCAGCGATAA TGCGAGCCCC TGTCCGAATG GATAACCGGA TGCTCACCGG GTCGCAGTGT 7700
CCGTACCGCG TGATCCAGCA TGGTATTGAC CAGGTTCGCA TCCGGGCTGG TGCCGATATT CCAGGCCACC ACCAGCCCAT CGAAGCAATC GACGATCGGC 7800
GAGACGTAGA CCTTCCCTGC CGGAATGTGT ATTTCCGTCA GATCGGTCAA CCATTTCGTA TTCGGCGCCG ACGCGTGAAA GTCGCGATTC AGCAGATTCG 7900
GGACCGCTGG TGTCGGGTCG CCAGCATACG CCGAGAAGCG CCGGCGGCGC GGTGTTCTCA CGACCAGACG CTCTTGCGCC ATCAAGCGAC GCACGACCTT 8000
CTCGGACACA CGCATGCCAC CAAGGCGCAA GGCACTATCA ATGCGTCGAT AGCCATAGCA GCGGTAGTTG TCCTCGAAGA TAGTCCGAAT GACCTCACGC 8100
ACCTGCGTGT ACTTGTCGGG CCGCGTCTGC CGCAGGCGTT GATAGAAGTA TGTGCTGCGC GCCAGCTTCA GGCCGCACAA CAGATTGGCT AATGGAAACG 8200
TGACTCTGAG GGCATCAACC ACCTTCGTTT TTTCTCGGCT TGTCAGTTCG AGGGGGTTGA TGCCCATGTC TTTTTTTATC AATTCACTCG CCTTCTCCAG 8300
AATTGCATTC TCCATGCGAA GCCGCTGGTT CTGGCTCTCC AGTTCGGCCA GTTCCCTGAG TAGTGCCTCA TGCCGCTGCT CGAGCGAGGT GTCACCTTTC 8400
TTCTTTGTCA TGGGTTTTAG GGGCACTTTG CCAAGTAATC GATGCTGCCA GTTATACAAC GTTGGTCGCG ATACACCGAC AGTGTCGGCC ACATCCTTTG 8500
CCGAACCTAC GCGCAGGTTC AGTGCAATGA CGGCTTGCTG CTTCTCGAGG CGAGAGCGGG CGACTGTGGG AGCGCTGCTG CCGACGACCG TCCTAGCGAA 8600
TTCAGGGCGT AAATCACGGA TCCAGGCACG CAAGGCCTCG CGGCTTGGGT AGCCCAGGCT TCGGATTGTG TGACTCAGGC AGTAGCCTTG TTCGATATAG 8700
TGATCTACTG CCCGTTGCTT TTGCTCATCG GTGTACTGCC GTTTTATCCG TTGATAGCCT CGGCGAAGAT CCTGATTCCG TTCGAATTCT GCCAACCAGG 8800
CCTTCAGCGA GTTCTTGGTG GGGTATCCCA GCTGCCGTAG TGTGGCGCTC ATCCGGCGCC CAAGCTTCAG GTACAACCTC ACGGCTCGAA GGCGATCTTC 8900
ATACGAATAC ATGAACTACT CCTAAAGTAG TCCAAGATTT TGTCCGCACC CCAACTTAGG GTAAAGATTT GCGTCGAAAT TTGACCCACG TATGACACTG 9000
TTTCCCGTCT GGATATGGCG GGAGAAATCA AGGAGTGATA AACGTGGCGA TATTGAGCGC AATTCGACGC TGGCATTTTC GCGATGGTGC GTCGATTCGG 9100
GAAATAGCCC GACGAAGCGG CCTGTCCAGG AACACCGTTC GCAAGTATTT GCAAAGCAAG GTGGTTGAAC CGCAGTACCC AGCGCGAGAC AGCGTTGGCA 9200
AGTTAAGTCC TTTTGAGCCC AAGTTAAGGC AGTGGCTCTC CACCGAGCAC AAAAAGACAA AGAAGCTGCG CAGAAACCTG CGCAGCATGT ACCGGGATTT 9300
GGTCGCTTTG GGCTTTACCG GGTCTTATGA CCGAGTGTGT GCCTTTGCCC GACAGTGGAA AGATTCCGAA CAGTTCAAGG CGCAAACCTC GGGCAAGGGT 9400
TGTTTCATCC CCTTGCGCTT TGCTTGTGGC GAAGCCTTCC AATTCGATTG GAGTGAGGAC TTTGCCCGCA TAGCGGGCAA ACAGGTCAAA CTTCAGATTG 9500
CCCAGTTTAA GTTGGCCCAC AGCCGGGCCT TTGTGCTTCG GGCTTACTAC CAGCAAAAAC ATGAAATGCT GTTTGATGCC CACTGGCATG CCTTTCAAAT 9600
CTTCGGTGGC ATTCCCAAGC GCGGCATCTA CGACAACATG AAGACCGCTG TGGATTCGGT GGGGCGTGGC AAAGAGCGCA GGGTCAATCA GCGGTTCACT 9700
GCCATGGTCA GCCACTACCT GTTTGATGCG CAGTTCTGTA ATCCAGCATC GGGTTGGGAG AAAGGCCAGA TTGAGAAGAA CGTGCAGGAT TCCCGCCAAC 9800
GCCTGTGGCA AGGGGCACCA GACTTTCAAA GCCTTGCTGA TTTGAATGTG TGGCTTGATC GATAGGAATT AAAACCCCAA AAAGATTAAA AAAACACCAC 9900
AAAACGGATG TTTCTTCAAC ACCACTTTTG CTCCATATGA ACGGAACCGA CGATTAAACT GGATGGCTCT GATTGATTCA GGGTATGAAT GGCGGTTTTT 10000
TGCTCCGTTT CCCTCAAAAT GGACGCAACT TCCCCTCTGC GGCTCTCAGC CGCACCACCG CATCCGGGCC AGCAGCTCAT GCATCAGGAC CTGCTCTGCC 10100
AGACGGTAGC CCCGCTTCAG CCCCGTAAAA CGCATCTGAC TCCCGCACAG CACGCACTTC AGCGGGTCAA CCTTCAGTAA CCTCTGATAC ATCCCTCTCC 10200
AGGTGATTTG CATCGCCGTT TTTCTCACTG TCTCCGTTAT GATGTACACC ACTTCTTCCA GTAACCGCCG TTTCGCCGGA CTCAAAAAAC CGTAGTACCT 10300
CACCATACGG AACCCCTTAT CCGCCACATG CCAGGAGAAC CTTTCCATGA ACTCATCTCC ACTCATCAAC AGGTATTCTT CCCGTTTTGT TCGGTGACTG 10400
TTGTAACGCA GACCGATTTC ATCCTGACCG GCATAATGCT CCAGACGACT CATCGGCACT GGTGGCTTTT TCAGGTAAGA GCCAAAGTAC ACCGCCACAT 10500
GGGTGGCATT ATCCATCACC CGGGATACGT TGACATTCCA GCCACGGCGG TAATGCGTGT CCAGGAAGCG ATTCCATTCC CGTTTACTGC TTCCTTCTGC 10600
TGCCAGCGCA TCCGGCATCA CCAGGTCAGG GTATTTCCGT GACAGCAACC GTGTTATCCG GTAGCGCCAC ATGCTCATCA CCTTACGGGC GTAAAAATGA 10700
AGATTTTTCC AGGTGTGGCC CGACGTCACA CCACCGGCAG TTGTCGATAA ATGGATATGC GGATGCCACT GCTGGTCACG CCCCCATGTG TGGATCACCG 10800
TGAATATCCC CGGCTCCACA TCTGCCTGAT GGCAGATTTC CAGTATCACA TCCGCTGCAA TGCGGCTCAT CTCTGTCAGT AACCACCGGT TGTGGAACAC 10900
CAGGGACCAG TACTGGCAGG GAAGTGTGAA CACAATATGC TGCCACGGGC AGTCGGGGAC CAGGCTCAGC AGATACTGTA TCCACTGTGC GCCAGCCTTC 11000
ACCCCGCAGT GCGGGCAGGA GCGGCTTTTA CACCGGAAGC AGACCTTTTT TGTATGGCAA CAGTCCGGTG ATGAACAGCA CCACTGTGTA TACCCCATCA 11100
GTGTGGTCCC GCACGCCATG ATTTTGGTCA CCGACTCAAT CACCACCGGA CGTACTGCCC CTTCCGGCTG CTTCTCCAGC CAGTTAAGCC AGCGGTTTCC 11200
CTGCTGAAAG ATATCGGCAA AACGGGGAAG CATCAGAAGG GCGGGGCGAC TCCGTCCGGC CAGTGAACCG TGCCACACTC CGGGCAGTAC ATACCGCCGG 11300
CGCTGATACC GGAAAGAATG GTCGCAAATT CCCGCTCCGT GCAGCGGGCG ATTTCCGGAT ACCCTTCGTC ATCAACACGT ACAAACCAGA AGACCAGCTT 11400
TTTGTTTCCC GCATCCACAA AGAACGGAAT ATTCAGGTCT GCGCAGCATT CAACGGCATC GTCAAAACTA TCAAAGCGCA GAACTTCTGC GTCTTCTTCG 11500
TCAAAAAAAT CATCTTCGTG AAGCTTCACG ACATAGCGGG GAAGTTTGCT TCTTTGAGAG GCGGGTTTAC GTTTACGGGG TTTAGCTGAA CGGGCCATAT 11600
AACCACCTGA AAGACAATGA CATTGCCTGT TTTTATAACG GTAATTGCAG ACCATGACAA GCCGCAGCCG TCAGGCTGCC TACTCGAGCA TCGCTGCAAA 11700
GCGCTGTGGT CTGAGCTGCG CCACCCCGAA TTGGACCAAA CCGTGCAAGA GGCCTTTGCC GATGAACAAG GCGAGTTGAT GGCGCTACCC AATGCCTTTG 11800
ATGCATTCGT GGAGCAAACC AAGCGAGTCA CTTCAACCTG CCTTGTTCAC CACGAGGGCA ATCGCTACAG CGTTCCTGCC AGTTACGCCA ACAGGGCCAT 11900
CAGCCTTCGG ATTTATGCAG ACAAGCTGGT GATGGCTGCC GAAGGCCAAC ACATTGCCGA GCATCCAAGA TTGTTTGGCA GTGGCCACGC TCGGCGTGGC 12000
CACACACAAT ACGACTGGCA CCATTACTTG TCTGTGCTTC AGAAGAAACC TGGGGCGTTG CGCAATGGTG CGCCATTTGC TGAATTGCCA CCCGCGTTCA 12100
AGAAGCTTCA ATCCATCTTG CTGCAACGCC CCGGCGGTGA CCGTGACATG GTGGAAATTC TGGCCCTTGT ATTGCACCAC GATGAAGGTG CGGTACTCAG 12200
TGCTGTGGAA TTGGCATTGG AGTGTGGCAA GCCATCGAAG GAGCATGTGC TTAATCTGTT GGGACGTTTG ACCGAAGAAC CTCCACCCAA ACCGATTCCA 12300
ATTCCCAAGG GGTTAAGGCT GACATTGGAA CCACAGGCCA ACGTGAACCG CTATGACAGT TTAAGGAGAG CCCATGATGC AGCATGAAGG CCATGTGAGA 12400
ATCCTCAAAT CCTTGAAACT CTTTGGCATG GCACACGCCA TTGAGGAGTT GGGCAATCAG AATTCACCAG CATTTAATCA AGCCTTGCCC ATGCTGGACA 12500
GCTTGATTAA AGCTGAAGTG GCAGAGCGTG AAGTACGTTC GGTGAACTAT CAATTGCGGG TGGCCAAGTT CCCCGTGTAT CGGGACTTGG TGGGCTTTGA 12600
CTTCAGTCAA AGCCTGGTTA ATGAGGCCAC GGTCAAACAA TTGCACCGGT GCGACTTCAT GGAACAAGCC CAGAACGTGG TGCTGATTGG TGGGCCAGGC 12700
ACAGGCAAGA CTCACCTGGC CACAGCCATT GGTACACAAG CAGTGATGCA CTTGAACCGA CGGGTGCGTT TCTTCTCCAC CGTGGATTTG GTCAATGCAC 12800
TGGAGCAAGA GAAATCATCT GGGCGTCAGG GACAAATCGC AAACCGTCTG TTGTATGCCG ATTTGGTGAT TCTGGATGAG CTGGGATATT TGCCTTTTAG 12900
CCAAACCGGT GGGGCACTGC TGTTTCACCT GCTCTCAAAG CTGTACGAAA AAACCAGCGT GATACTGACC ACCAACTTGA GCTTCTCGGA ATGGAGCCGA 13000
GTGTTTGGCG ATGAAAAGAT GACAACAGCG TTGTTGGACC GACTAACCCA CCACTGCCAC ATCCTGGAAA CCGGCAATGA AAGTTACCGC TTCAAACACA 13100
GTTCAACTCA GAATAAGCAG GAGGAAAAAC AGACCCGCAA ACTGAAAATC GAGACATAAT TCTGACAACA AGGGGTGGGT CAAAATTCAA TGCAAATCCC 13200
GGGTCAAATT TGGGTGCAAA TCAACAGATA TCGACAACCT CTCGCGCAAC CAAGACATCG CGGTCGGACT GCAAGTGATC TTGAAGCCAC GGGCCCGTCC 13300
CACCCCGACA TGGACCTCGA TGCCCGAACG GACGTTAGAT TTCGAGTTCT AGGCGTTCTG CGATGAAGGT TGGATCCCAG CCGGGATTGA AAGTGTCGAC 13400
GTGGGTGAAT CCGAGCCGCT CGTATAGGCC ACGCAGGTTC GGGTGGCAGT CGAGCCGCAG CTTGGCGCAC CCCTGCGTTC GCGCGGCATG GCGGCAAGCC 13500
TCGATCAGCG CGGAGCTGAC ACCCCGGCCC GCATGTGTCC GTCGCACCGC GAGCTTGTGC AGATATGCGG CCTCCCCCTT GAGGGCGTCG GGCCAGAACT 13600
CGGGATCCTC GGCCGACAAG GTGCAACAGC CGACGATGCC GTCGCTGCAA CTCGCGACTA GGAGCTCGGA TCTCAGGACG AAGGTCTCCG CGAATGTCCG 13700
GTCGATCCGC GCGACGTCCC AGGCGGGCGT TCCCTTGGCG GACATCCACG CCGCAGCGTC GTGCATCAGC CGCACAACCT CGTCGATATC ACCCGAGCAG 13800
GCGACCCGAA CGTTCGGAGG CTCCTCGCTG TCCATTCGCT CCCCTGGCGC GGTATGAACC GCCGCCTCAT AGTGCAGTTT GATCCTGACG AGCCCAGCAT 13900
GTCTGCGCCC ACCTTCGCGG AACCTGACCA GGGTCCGCTA GCGGGCGGCC GGAAGGTGAA TGCTAGGCAT GATCTAACCC TCGGTCTCTG GCGTCGCGAC 14000
TGCGAAATTT CGCGAGGGTT TCCGAGAAGG TGATTGCGCT TCGCAGATCT CCAGGCGCGT GGGTGCGGAC GTAGTCAGCG CCATTGCCGA TCGCGTGAAG 14100
TTCCGCCGCA AGGCTCGCTG GACCCAGATC CTTTACAGGA AGGCCAACGG TGGCGCCCAA GAAGGATTTC CGCGACACCG AGACCAATAG CGGAAGCCCC 14200
AACGCCGACT TCAGCTTTTG AAGGTTCGAC AGCACGTGCA GCGATGTTTC CGGTGCGGGG CTCAAGAAAA ATCCCATCCC CGGATCGAGG ATGAGCCGGT 14300
CGGCAGCGAC CCCGCTCCGT CGCAAGGCGG AAACCCGCGC CTCGAAGAAC CGCACAATCT CGTCGAGCGC GTCTTCGGGT CGAAGGTGAC CGGTGCGGGT 14400
GGCGATGCCA TCCCGCTGCG CTGAGTGCAT AACCACCAGC CTGCAGTCCG CCTCAGCAAT ATCGGGATAG AGCGCAGGGT CAGGAAATCC TTGGATATCG 14500
TTCAGGTAGC CCACGCCGCG CTTGAGCGCA TAGCGCTGGG TTTCCGGTTG GAAGCTGTCG ATTGAAACAC GGTGCATCTG ATCGGACAGG GCGTCTAAGA 14600
GCGGCGCAAT ACGTCTGATC TCATCGGCCG GCGATACAGG CCTCGCGTCC GGATGGCTGG CGGCCGGTCC GACATCCACG ACGTCTGATC CGACTCGCAG 14700
CATTTCGATC GCCGCGGTGA CAGCGCCGGC GGGGTCTAGC CGCCGGCTCT CATCGAAGAA GGAGTCCTCG GTGAGATTCA GAATGCCGAA CACCGTCACC 14800
ATGGCGTCGG CCTCCGCAGC GACTTCCACG ATGGGGATCG GGCGAGCAAA AAGGCAGCAA TTATGAGCCC CATACCTACA AAGCCCCACG CATCAAGCTT 14900
TTGCCCATGA AGCAACCAGG CAATGGCTGT AATTATGACG ACGCCGAGTC CCGACCAGAC TGCATAAGCA ACACCGACAG GGATGGATTT CAGAACCAGA 15000
GAAAGAAAAT AAAATGCGAT GCCATAACCG ATTATGACAA CGGCGGAAGG GGCAAGCTTA GTAAAGCCCT CGCTAGATTT TAATGCGGAT GTTGCGATTA 15100
CTTCGCCAAC TATTGCGATA ACAAGAAAAA GCCAGCCTTT CATGATATAT CTCCCAATTT GTGTAGGGCT TATTATGCAC GCTTAAAAAT AATAAAAGCA 15200
GACTTGACCT GATAGTTTGG CTGTGAGCAA TTATGTGCTT AGTGCATCTA ACGCCACGCT CACCGGCAAA TTAGGAGCGC AGCGAGTAAT TTGTCCGTGT 15300
GTAGCGTATT GTTAGGCGCT TGTGCCTTGC CAGCGACGAT ACAGGCTGGC AATGCCAGAC GAACAAAGAA AAGGCATTGC TTCCTTGATT TGTTCCAGCG 15400
GCCAATCCCA CCAAGCCATA TCTAAAAGCA TAGAAATTTC TTCTTCAGAA AAGCGCTTCC TAATCGACTT TGCAGGGTTT CCCCCCACTA TGGTGTAGGG 15500
TTCCACGTCT TTGGCAACCA AAGCGCGGCT ACCTATCACC GCTCCATGCC CGATCTTGAT CCCGGGCATG ATCATGGCCT CCGAACCGAT CCACACATCA 15600
CTTCCTATAA CTGTGTCGCC AGCCCGCTGG AATGCATCGA CTGATTTTGC AAACGCGGGC TCCTCGTTCA TGTAGAAGAA AGGGAAAGAA GAGACCCAAT 15700
CATATCGGTG GCCTTGATTC CCAGCCATAA TAAAAGCTGC GCCTGATCCG ATGGAGCAGA AGCTGCCGAT AATCAGCTGA TCAACGTCAT CACGGTCTGG 15800
TAGAAGGTAG CGAGCACAAT CATCAAACGA GTGCCCATGG TAATAGCCGG AATAGTAGCT ATACCGCCCT ACCTTGATGT TCGGATTCTT CACCTGCTCA 15900
GTCAGAAGCT TCCCTTTGAA GGGACTCTCA AAATAATTCG TCATAAAATT TGTACCCGAA AATTCTAGAG CGACTCCACG CGTCGCCTAA CATGTATTAG 16000
ACCGCCTTCT ACATAAGCCA ATCATCGTGA AGGCGGTATA ACCCGATGCG ACTAAATTTT GATTGCCCGA TTAGACCATA GGGATCAACC CGTTACAAGA 16100
CCATACTTCT TGGTAGATTA TTTTCGCTTG ACCCGCCTTG CGTAACCAGG AAAACATTAT CTGGCACTGG CCAGTAAAAA GCGTCAGGTT GTTGCCACGT 16200
AACCAGATTA GCGAGCAACA GGCCGGCAAG GCTGATCCGG CAAACACCGA ACTTTACTAT CTGTTCCAGC TCGGCCGGCC ACTGCAGCTG GCCAACCCTG 16300
TCACCCGCGT GCCGCATCGC CCCATCCGCA ACACCATGAA GCTGACCACC CTGCACCTGC TGGAGCAGTA TCAGCTGTTC AGGAATCTGC CAGTGACCTA 16400
TCTGCAAGCC TTTGCCGCAT CAAGGCAAAA GCCCGATGAA TGATGCTGTT TAACTTGTTG CCGCCAAAAC GGCTGGTGCC CGGGGTGGTT CATGAAACAC 16500
CCTCTGTTTC TGCAGGAGCG GGGGCTATTG ACTGGTTATT CTTCGTTTTC TGGTAATTCA AGCTGCCTCT CACTACACCA GATCCGGATG AGCACAGTCT 16600
CGGTAGACTG CCTGAGGTAA ACAACCCGAA ATGGTGCATG AATCAATTCA CGAATATTAT CCAGATTGAA CTCAGGGACA ACACGGCCTG CTTCAGGGTG 16700
GCGTTGAAGC ATCTCACAAT GCCCGAGGGT GGCTGCCACA AAATCATCAC CGATCTGCGG CACACCCTCT GCTCTGTAAT ATTCCTGAAT AGCCTGTAAA 16800
TCACCACGAG TGGACTCTGC GATGCGTAAT TCCATTTACT CGATGCCCAA CGCTTTCCTC GCGTCCTCCA ACGAAACGGT GCTGCCCTCG CGAACATCCA 16900
CCAGCCCCTG CGCCACCGCT TTGACAAACC GCAATTCCTC TGCGGCTCTC TCATAATCCT CAAGCCCCTG AACAACAGCA ACACCGCGGC CACGACTGGT 17000
AAGCAGGATT GGCCGTTGTG TATCCTGCGT GCGATTAACC ACCTTTCCGG GATTGATCTT CAGATCTGAC AGAGGAATGA CATCTTCGGA AAATTTCACT 17100
TGCATGGTAA TAATCCAATC AATAAACCGG CACCATCAAT AGCACCCGTT AACAGGTGCG GTCAAGAAGC ATAACGCTAA GCTCAGCCGC AGTTTATAAG 17200
TCGAGCGCAC AAAGTGCGCA TTGCTGGAGC GCCTTGTTAA CTTTTGACTT AAATGCACTA TTGTTGGTTT ATTTTTCTAC TAACTCAAGC TCTGTTGAGG 17300
ACAAGCCTAA AGAGTGCGAA TACGATTTAC CTTCATCTAA ATGCCACCAC TTTTCAACCC ATGCTTGGCC ATATTCGTCT ATTTCGTAAA CTTCGAATAT 17400
TTCACCCAGC ATAGAATTAA TGTCATTTAC TTCGCTTGAT GGCAGTCCAT TCATAATCGT TTGATCAATA AATAGAACTT TAACTTTAGC CCCAACAAAG 17500
ATTTGTGCAC CGTTAAAATC ATGCACGATG TTTAATTCCC CTCAAGTTAA CGTAGAGCTA AGAGGCGCTG CTTGCGGCGT CCACGGTAGC CGAAGGCTGC 17600
GCCTTGAGCG CCTGGTTAGG TGCATACATT TTAAGCCGCT GCTCTTTAAA ATACTGTTTC ATTTTCTCAT TGAAGCCTAA AATATTTTCG GCCAACTCGA 17700
CATCTTCTAT GGGCCATGCG ATCCATTCTT TACCTCTATA AACGCGCCTT GTTGTCTGGA TGCCGTGTTG CGATAATTTT TCAACCAATT GGGCGTTTCG 17800
ATCGTCCCAA GAGGTAGCTC TACCCCAGAT TGGCGGAAAG TCATCAATGA CTTCTTTGTT AATTTTATTC GTAATATTGC TGTATTTATG TGAGTAGAAA 17900
ATGCACGTAG CCCCCTTAGG GAGAACACTT TTTACGCCCG CTGAAGTAAA TGATACCCTG TCGACCAAAA CTGTTTCTTG AGTGAATGGC ACATGCTCAT 18000
TTTTCAATAG TTGTGAGATC TGTTCTAATT CGATGGGGTT TTCAGAACAG GTAAATGATT CATTAAGCGG TACAGATTCA GGTTTGCACG CAACCAATAG 18100
AAGTAACGCT ATGAGTTGAG TAAAAATTCT TGGCATGTGT GCACCTAACG TAGAGCTAAC CGGCGCTGCG CGGCCTTATC GCGCAGCGTC CAGCAACTGA 18200
AGGGAGCGAG GTTGAGGCCA GGTTAGGCAG AGTGTTCATT ATGTGGCCAC AGTATTTCAG ATGGAAGCCA AAAGCTCAGA CAAGCGAAAA AGCATCACAA 18300
TTAATAACAG TGTGGGGATG CCATAATAAA CCAGCTTGCC TTGCCACCCT GGGTATTGCT TGCGATAGCT CCTAAGGAGA GTCCATGCGC TATTGCCCTC 18400
GCCGGGAGCG AGAGGCGGAG ACGGGAAACG CTGAAAAAAC AAGCCAATAC CACCACACAA AGCGACAAAT GCTGAAATAA CAAGCAAAGT GATGCTATCC 18500
CTTACGTTGC CGGAGATGAG AGCATCAATC GCTAGGACTG CAAAGATTGC AGAAACGACA CAAACCAGCG TTTTGATGAA ATTGCCCATG TGTTGCCTAA 18600
CATTTGCTTA ACCTGCAATT CCGGCCCGAA GGGCTTGGCG TGGTTTGTGC TGAGCAAAGC GACAGCACAA ACCATGACAA CAGGAATTGT CAGGTTGAAG 18700
CATTTGTTAG GGCAAATTTC GGTTGATCAT TTTAATGTCA TTTTGAACTG CATTACCTTT ATGAAATCTT CTAATATATT TTCTTCTTTT AATTCAAACA 18800
TGCAAGGCCT TGATCTTCCA ATATTATTTG TCTCTATAAA TGCTTTCTTT GTAATCTCAT GAATATCTAA TACTAATACA CCGTTAATAT GTTTTTCTGG 18900
AAGATATATA GTAGCTTTTA TGTAGTTCTT CCATGCAGAC ATCCAAACAA TCGTTTTCTT TCCCTTTATA ACTTTACATA ACCAAGCTTT TCCATCTTTA 19000
TAATACTTCC ACTCTGGTAT TAAACTATAA TTTTCATAGA GTCGTAGTAA TTTTAAATAT ACACTAAACG ATTTTCCAAG TATTCTTTTT AAGATTTCAT 19100
CTGTTGGGTA GATAGATGGA TCTACAAGTT CTATGTTATT AATCTGTTCC ATTGTTTTAC TCTTTGATTA AACTTTTCCA CATCCAAATA TCTGGTTTGT 19200
TTTTACCATT GGCATTTGGA ATTATTCCAA CAATATAATA ACCATTCTTC TGATAAAACT CATATGGATG TTTATTAATA TTTTTAATAT TTTTTATTGA 19300
ATCAAATATA TTATCTTCTG TTATAGTTAT TAAAGAGAGA CTTGTTCTAT AGTATTCATC ATCTGTTCCT AAAGCGATTC CAATAATACC TTGCTCTCTA 19400
GCTCTGTTTT CTAATTCCTT AAGCAGGATC TTGCCAATAC CTTTATTTTG ATAATCTGGT CTGACAACCA ATGGATGCAA TTCCCAGGTT TCCTTGTACA 19500
TTGGCCTTAA GCCTATCCAG CCAACTAAGG AGTTATTTAT TAGCAGACCG AAACAAAGGT TTGGACTCTC AATACATTCT TTTACTTCTT TTGTTGCACT 19600
CGTCATATCT GGCCATGAAT TGTTACCAAG ATCATTGAAC GCTTCTGTTA GTATATTTGC TGCTTCTAAC TGATAATTGC TGCATTCCGC AATATTCACA 19700
ATTTGATAAT TCATCTCTTC CTCTTTGTAT TCGCGCCGCA ATAGCGGCGT CGCCCTAACG CTTGAGTTAA GCCGCGCCGC GAAGCGGCGT CGGCTTGAAC 19800
GAATTGTTAG ACATTATTTG CCGACTACCT TGGTGATCTC GCCTTTCACG TAGTGAATAA ATTCTTCCAA GTGATCTGCG CGTGAGGCCA AGTGATCTTC 19900
TTTTTGTCCC AGATAAGCTT GCTTAGCTTC AAGTAAGACG GGCTGATACT GGGCAGGTAG GCGTTTTATT GCCCAGTCGG CAGCGACATC CTTCGGCGCG 20000
ATTTTGCCGG TTATTGCGCT GTACCAAATG CGGGACAACG TAAGCACTAC ATTTCGCTCA TCGCCGGCCC AGTCGGGCTG CGAGTTCCAT AGCTTCAAGG 20100
TTTCCCTCAG CGCCTCGAAT AGATCCTGTT CAGGAACCGG GTCAAAGAAT TCCTCCGCTG CCGGACCTAC CAAGGCAACG CTATGTTCTC TTGCTTTTGT 20200
AAGCAGGATA GCTAGATCAA TGTCGATCAT GGCTGGCTCG AAGATACCCG CAAGAATGTC ATTGCGCTGC CATTCTCCAA ATTGCAGCTC GCGCTTAGCC 20300
GGATAACGCC ACGGGATGAT GTCGTCATGC ACGACAAGGG TGACTTCTAT AGCGCGGAGC GTCTCGCTCT CGCCAGGGAA AGCCGAAGCC TCCATAAGGT 20400
CATTGAGCAA TGCTCGCCGC GTCGTTTCAT CAAGCTTTAC GGCCACAGTA ACCAACAAAT CAATATCGCT GTATGGCTTC AGGCCGCCAT CCACTGCGGA 20500
GCCGTACAAA TGCACGGCCA GCAACGTTGA TTCCAGATGG CGCTCAATGA CGCTTAGCAC CTCTGATAGT TGGTTCGAAA TTTCGATGGT CACCGCTACC 20600
CTCATGATGT CTAACTTTGT TTTAGGGCGA CTGCCCTGCT GCGTAACATC GTTGCTGCTC CATAACATCA AACATCGACC CACGGCGTAA CGCGCTTGCT 20700
GCTTGGATGC CCGAGGCATA GACTGTACCC CAAAAAAACA GTCATAACAA GCCATGAAAA CCGCCACTGC GCCGTTACCA CCGCTGCGTT CGGTCAAGGT 20800
TCTGGACCAG TTGCGTGAGC GCATACGCTA CTTGCATTAC AGCTTACGAA CCGAACAGGC TTATGTCCAC TGGGTTCGTG CCTTCATCCG TTTCCACGGT 20900
GTGCGTCACC CGGCAACCTT GGGCAGCAGC GAAGTCGAGG CATTTCTGTC CTGGCTGGCG AACGAGCGCA AGGTTTCGGT CTCCACGCAT CGTCAGGCAT 21000
TGGCGGCCTT GCTGTTCTTC TACGGCAAGG TGCTGTGCAC GGATCTGCCC TGGCTTCAGG AGATCGGAAG ACCTCGGCCG TCGCGGCGCT TGCCGGTGGT 21100
GCTGACCCCG GATGAAGTGG TTCGCATCCT CGGTTTTCTG GAAGGCGAGC ATCGTTTGTT CGCCCAGCTT CTGTATGGAA CGGGCATGCG GATCAGTGAG 21200
GGTTTGCAAC TGCGGGTCAA GGATCTGGAT TTCGATCACG GCACGATCAT CGTGCGGGAG GGCAAGGGCT CCAAGGATCG GGCCTTGATG TTACCCGAGA 21300
GCTTGGCACC CAGCCTGCGC GAGCAGCTGT CGCGTGCACG GGCATGGTGG CTGAAGGACC AGGCCGAGGG CCGCAGCGGC GTTGCGCTTC CCGACGCCCT 21400
TGAGCGGAAG TATCCGCGCG CCGGGCATTC CTGGCCGTGG TTCTGGGTTT TTGCGCAGCA CACGCATTCG ACCGATCCAC GGAGCGGTGT CGTGCGTCGC 21500
CATCACATGT ATGACCAGAC CTTTCAGCGC GCCTTCAAAC GTGCCGTAGA ACAAGCAGGC ATCACGAAGC CCGCCACACC GCACACCCTC CGCCACTCGT 21600
TCGCGACGGC CTTGCTCCGC AGCGGTTACG ACATTCGAAC CGTGCAGGAT CTGCTCGGCC ATTCCGACGT CTCTACGACG ATGATTTACA CGCATGTGCT 21700
GAAAGTTGGC GGTGCCGGAG TGCGCTCACC GCTTGATGCG CTGCCGCCCC TCACTAGTGA GAGGTAGGGC AGCGCAAGTC AATCCTGGCG GATTCACTAC 21800
CCCTGCGCGA AGGCCATCGG TGCCGCATCG AACGGCCGGT TGCGGAAAGT CCTCCCTGCG TCCGCTGATG GCCGGCAGCA GCCCGTCGTT GCCTGATGGA 21900
TCCAACCCCT CCGCTGCTAT AGTGCAGTCG GCTTCTGACG TTCAGTGCAG CCGTCTTCTG AAAACGACAA TGGAGGTGGT AGCCGAGGGT GTGGAAACAC 22000
CCGACTGCCT TGCGTGGTTG CGGCAGGCGG GTTGCGACAC GGTGCAGGGT TTCCTGTTCG CCAGGCCGAT GCCGGCGGCG GCCTTCGTCG GCTTCGTCAA 22100
CCAATGGAGG AACACCACCA TGAACGCCAA TGAACCGAGC ACCAGTTGCT GCGTGTGCTG CAAGGAAATC CCGCTCGATG CCGCCTTCAC GCCGGAAGGG 22200
GCCGAGTACG TGGAGCATTT CTGCGGGCTG GAGTGCTATC AGCGCTTCCA GGCGCGGGCC AGCACTGCGA CCGAAACCAG CGTCAAACCG GACGCTTGTG 22300
ATTCGCCGCC GTCAGGTTGA GGCATACCCT AACCTGATGT CAGATGCCAT GTGTAAATTG CGTCAGGATA GGATTGAATT TTGAATTTAT TGACATATCT 22400
CGTTGAAGGT CATAGAGTCT TCCCTGACAT TTTGCAGGGA ATTCCATGAC TGGACAGCGC ATTGGGTATA TCAGGGTCAG CACCTTCGAC CAGAACCCGG 22500
AACGGCAACT GGAAGGCGTC AAGGTTGATC GCGCTTTTAG CGACAAGGCA TCCGGCAAGG ATGTCAAGCG TCCGCAACTG GAAGCGCTGA TAAGCTTCGC 22600
CCGCACCGGC GACACCGTGG TGGTGCATAG CATGGATCGC CTGGCGCGCA ATCTCGATGA TTTGCGCCGG ATCGTGCAAA CGCTGACACA ACGCGGCGTG 22700
CATATCGAAT TCGTCAAGGA ACACCTCAGT TTTACTGGCG AAGACTCTCC GATGGCGAAC CTGATGCTCT CGGTGATGGG CGCGTTCGCC GAGTTCGAGC 22800
GCGCCCTGAT CCGCGAGCGT CAGCGCGAGG GTATTGCGCT CGCCAAGCAA CGCGGGGCTT ACCGTGGCAG GAAGAAATCC CTGTCGTCTG AGCGTATTGC 22900
CGAACTGCGC CAACGTGTCG AGGCTGGCGA GCAAAAGACC AAGCTTGCTC GTGAATTCGG AATCAGTCGC GAAACCCTGT ATCAATACTT GAGAACGGAT 23000
CAGTAAATAT GCCACGTCGT TCCATCCTGT CCGCCGCCGA GCGGGAAAGC CTGCTGGCGT TGCCGGACTC CAAGGACGAC CTGATCCGAC ATTACACATT 23100
CAACGATACC GACCTCTCGA TCATCCGACA GCGGCGCGGG CCAGCCAATC GGCTGGGCTT CGCGGTGCAG CTCTGTTACC TGCGCTTTCC CGGCGTCATC 23200
CTGGGCGTCG ATGAACTACC GTTCCCGCCC TTGTTGAAGC TGGTCGCCGA CCAGCTCAAG GTCGGCGTCG AAAGCTGGAA CGAGTACGGC CAGCGGGAGC 23300
AGACCCGGCG CGAGCACCTG AGCGAGCTGC AAACCGTGTT CGGTTTCCGG CCCTTCACCA TGAGCCATTA CCGGCAGGCC GTCCAGATGC TGACCGAGCT 23400
GGCGATGCAA ACCGACAAAG GCATCGTGCT GGCCAGCGCC TTGATCGGGC ACCTGCGGCG GCAGTCGGTC ATTCTGCCCG CCCTCAACGC CGTCGAGCGG 23500
GCGAGTGCCG AGGCGATCAC CCGTGCTAAC CGGCGCATCT ACGACGCCTT GGCCGAACCA CTGGCGGACG CGCATCGCCG CCGCCTCGAC GATCTGCTCA 23600
AGCGCCGGGA CAACGGCAAG ACGACCTGGT TGGCTTGGTT GCGCCAGTCT CCGGCCAAGC CAAATTCGCG GCATATGCTG GAACACATCG AACGCCTCAA 23700
GGCATGGCAG GCACTCGATC TGCCTACCGG CATCGAGCGG CTGGTTCACC AGAACCGCCT GCTCAAGATT GCCCGCGAGG GCGGCCAGAT GACACCCGCC 23800
GACCTGGCCA AATTCGAGCC GCAACGGCGC TACGCCACTC TCGTGGCGCT GGCCACCGAG GGCATGGCCA CCGTCACCGA CGAAATCATC GACCTGCACG 23900
ACCGCATCCT GGGTAAGCTG TTTAACGCTG CCAAGAATAA GCATCAGCAG CAGTTCCAGG CGTCAGGCAA GGCCATCAAC GCCAAGGTAC GTCTGTACGG 24000
GCGCATCGGT CAGGCGCTGA TCGACGCCAA GCAATCAGGC CGCGATGCGT TTGCCGCCAT CGAGGCCGTC ATGTCCTGGG ATTCCTTTGC CGAGAGCGTC 24100
ACCGAGGCGC AGAAGCTCGC GCAACCCGAT GACTTCGATT TCCTGCATCG CATCGGCGAG AGCTACGCCA CCCTGCGCCG CTATGCACCG GAATTCCTTG 24200
CCGTGCTCAA GCTGCGGGCC GCGCCCGCCG CCAAAAACGT GCTTGATGCC ATTGAGGTGC TGCGCGGCAT GAACACCGAC AACGCCCGCA AGCTGCCAGC 24300
CGATGCACCG ACCGGCTTCA TCAAGCCGCG CTGGCAGAAA CTGGTGATGA CCGACGCCGG CATCGACCGG CGCTACTACG AACTGTGCGC GCTGTCCGAG 24400
TTGAAGAACT CCCTGCGCTC GGGCGACATC TGGGTGCAGG GTTCACGCCA GTTCAAGGAC TTCGAGGACT ACCTGGTACC GCCCGAGAAG TTCACCAGCC 24500
TCAAGCAGTC CAGCGAATTG CCGCTGGCCG TGGCCACCGA CTGCGAACAA TATCTGCATG AGCGGCTGAC GCTGCTGGAA GCACAACTTG CCACCGTCAA 24600
CCGCATGGCG GCAGCCAACG ACCTGCCGGA TGCCATCATC ACCGAGTCGG GCTTGAAGAT CACGCCGCTG GATGCGGCGG TGCCCGACAC CGCGCAGGCG 24700
CTGATAGACC AGACAGCCAT GGTCCTGCCG CACGTCAAGA TCACCGAACT GCTGCTCGAA GTCGATGAGT GGACGGGCTT CACCCGGCAC TTCACGCACT 24800
TGAAATCGGG CGATCTGGCC AAGGACAAGA ACCTGTTGTT GACCACGATC CTGGCCGACG CGATCAACCT GGGCCTGACC AAGATGGCCG AGTCCTGCCC 24900
CGGCACGACC TACGCGAAGC TCGCTTGGCT GCAAGCCTGG CATACCCGCG ACGAAACGTA CTCGACAGCG TTGGCTGAAC TGGTCAACGC TCAGTTTCGG 25000
CATCCCTTTG CCGGGCACTG GGGCGATGGC ACCACATCAT CATCGGACGG ACAGAATTTC CGAACCGCTA GCAAGGCAAA GAGCACGGGG CACATCAACC 25100
CAAAATATGG CAGCAGCCCA GGACGGACTT TCTACACCCA CATCTCCGAC CAATACGCGC CATTCCACAC CAAGGTGGTC AATGTCGGCC TGCGCGACTC 25200
AACCTACGTG CTCGACGGCC TGCTGTACCA CGAATCCGAC CTGCGGATCG AGGAGCACTA CACCGACACG GCGGGCTTCA CCGATCACGT CTTCGCCCTG 25300
ATGCACCTCT TGGGCTTCCG CTTCGCGCCG CGCATCCGCG ACCTGGGCGA CACCAAGCTC TACATCCCGA AGGGCGATGC CGCCTATGAC GCGCTCAAGC 25400
CGATGATCGG CGGCACGCTC AACATCAAGC ACGTCCGCGC CCATTGGGAC GAAATCCTGC GGCTGGCCAC CTCGATCAAG CAGGGCACGG TGACGGCCTC 25500
GCTGATGCTC AGGAAACTCG GCAGCTACCC GCGCCAGAAC GGCTTGGCCG TCGCGCTGCG CGAGTTGGGC CGCATCGAGC GCACGCTGTT CATCCTCGAC 25600
TGGCTGCAAA GCGTCGAGCT ACGCCGCCGC GTGCATGCCG GGCTGAACAA GGGCGAGGCG CGCAATGCGC TGGCCCGTGC CGTGTTCTTC AACCGCCTTG 25700
GTGAAATCCG TGACCGCAGT TTCGAGCAGC AGCGCTACCG GGCCAGCGGC CTCAACCTGG TGACGGCGGC CATCGTGCTG TGGAACACGG TCTACCTGGA 25800
GCGTGCGGCG CATGCGTTGC GCGGCAATGG TCATGCCGTC GATGACTCGC TATTGCAGTA CCTGTCGCCA CTCGGCTGGG AGCACATCAA CCTGACCGGT 25900
GATTACCTAT GGCGCAGCAG CGCCAAGATC GGCGCGGGGA AGTTCAGGCC GCTACGGCCT CTGCAACCGG CTTAGCGTGC TTTATTTTCC GTTTTCTGAG 26000
ACGACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
attC qacEdelta1_sul1 core 13935-13968 34 CCGCTAGCGG GCGGCCGGAA GGTGAATGCT AGGC
attC catB2 core 15252-15317 66 CGCCACGCTC ACCGGCAAAT TAGGAGCGCA GCGAGTAATT TGTCCGTGTG TAGCGTATTG
TTAGGC
attC orfM core 15991-16098 108 CATGTATTAG ACCGCCTTCT ACATAAGCCA ATCATCGTGA AGGCGGTATA ACCCGATGCG
ACTAAATTTT GATTGCCCGA TTAGACCATA GGGATCAACC CGTTACAA
attC parE_phd core 16454-16541 88 CTTGTTGCCG CCAAAACGGC TGGTGCCCGG GGTGGTTCAT GAAACACCCT CTGTTTCTGC
AGGAGCGGGG GCTATTGACT GGTTATTC
attC orfJ core 17175-17242 68 CGCTAAGCTC AGCCGCAGTT TATAAGTCGA GCGCACAAAG TGCGCATTGC TGGAGCGCCT
TGTTAACT
attC orfI core 17551-17621 71 CGTAGAGCTA AGAGGCGCTG CTTGCGGCGT CCACGGTAGC CGAAGGCTGC GCCTTGAGCG
CCTGGTTAGG T
attC orfH core 18149-18228 80 CGTAGAGCTA ACCGGCGCTG CGCGGCCTTA TCGCGCAGCG TCCAGCAACT GAAGGGAGCG
AGGTTGAGGC CAGGTTAGGC
attC AAC(6')-Ia core 18601-18712 112 CATTTGCTTA ACCTGCAATT CCGGCCCGAA GGGCTTGGCG TGGTTTGTGC TGAGCAAAGC
GACAGCACAA ACCATGACAA CAGGAATTGT CAGGTTGAAG CATTTGTTAG GG
attC aadA1a core 19759-19812 54 CGCTTGAGTT AAGCCGCGCC GCGAAGCGGC GTCGGCTTGA ACGAATTGTT AGAC
attI 20615-20670 56 CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCA
res 22305-22435 131 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAGA TGCCATGTGT AAATTGCGTC
AGGATAGGAT TGAATTTTGA ATTTATTGAC ATATCTCGTT GAAGGTCATA GAGTCTTCCC
TGACATTTTG C
res_site_I 22305-22343 39 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAG
res_site_II 22357-22400 44 ATTGCGTCAG GATAGGATTG AATTTTGAAT TTATTGACAT ATCT
res_site_III 22404-22435 32 TGAAGGTCAT AGAGTCTTCC CTGACATTTT GC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn2424 34-468 Passenger Gene Heavy Metal Resistance -
merT Tn2424 540-890 Passenger Gene Heavy Metal Resistance +
merP Tn2424 904-1179 Passenger Gene Heavy Metal Resistance +
merC Tn2424 1215-1637 Passenger Gene Heavy Metal Resistance +
merA Tn2424 1689-3383 Passenger Gene Heavy Metal Resistance +
merD Tn2424 3401-3763 Passenger Gene Heavy Metal Resistance +
merE Tn2424 3760-3996 Passenger Gene Heavy Metal Resistance +
urfM 5'-end Tn2424 3993-4663 Passenger Gene Other +
tniA In21 4775-6454 Transposase   +
tniB delta1 In21 6457-7317 Accessory Gene   +
tnp IS1353 7368-8912 Transposase   -
istA N-ter IS1326_IS1353_ISEc37.1 9044-9865 Transposase   +
tnp ISEc37.1 10046-11233 Transposase   -
orf2 ISEc37.1 11233-11598 Accessory Gene   -
istA C-ter IS1326_IS1353_ISEc37.1 11687-12387 Transposase   +
istB IS1326_IS1353_ISEc37.1 12374-13159 Accessory Gene ATPase Transposition Helper +
GNAT_fam In21 13335-13835 Passenger Gene Antibiotic Resistance -
sul1 (ARO:3000410) In21 13963-14802 Passenger Gene Antibiotic Resistance -
qacEdelta1 (ARO:3005010) In21 14796-15143 Passenger Gene Antibiotic Resistance -
catB2 (ARO:3002675) In21 15312-15944 Passenger Gene Antibiotic Resistance -
orfM In21 16093-16356 Passenger Gene Hypothetical -
parE In21 16536-16835 Passenger Gene Toxin -
phd In21 16836-17105 Passenger Gene Antitoxin -
orfJ In21 17269-17526 Passenger Gene Hypothetical -
orfI In21 17558-18136 Passenger Gene Hypothetical -
orfH In21 18257-18589 Passenger Gene Hypothetical -
orfG In21 18727-19152 Passenger Gene Hypothetical -
AAC(6')-Ia (ARO:3002545) In21 19157-19714 Passenger Gene Antibiotic Resistance -
aadA3 (ARO:3002603) In21 19814-20605 Passenger Gene Antibiotic Resistance -
intI1 In21 20754-21767 Integron Integrase Class 1 +
tnpM Tn2424 21970-22320 Accessory Gene Inhibitor +
tnpR Tn2424 22446-23006 Accessory Gene Resolvase +
tnpA Tn2424 23009-25975 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn2424 435 34-468 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLREPDKPY GSIRRYGEAD VVRVKFVKSA QRLGFSLDEI AELLRLDDGT HCEEASSLAE HKLKDVREKM
ADLARMETVL SELVCACHAR KGNVSCPLIA SLQGEAGLAR SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn2424 351 540-890 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPQNGRGA LFAGGLAAIL ASTCCLGPLV LVALGFSGAW IGNLTVLEPY RPLFIGAALV ALFFAWKRIY RPVQACKPGE VCAIPQVRAT YKLIFWIVAV
LVLVALGFPY VVPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn2424 276 904-1179 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFASLAL AAAVAPVWAA TQTVTLAVPG MTCAACPITV KKALSKVEGV SKVDVGFEKR EAVVTFDDTK ASVQKLTKAT ADAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn2424 423 1215-1637 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   transmembrane protein mercury transport
Target:   Mercury
Protein Sequence:  
MGLMTRIADK TGALGSVVSA MGCAACFPAL ASFGAAIGLG FLSQYEGLFI SRLLPLFAAL AFLANALGWF SHRQWLRSLL GMIGPAIVFA ATVWLLGNWW
TANLMYVGLA LMIGVSIWDF VSPAHRRCGP DGCELPAKRL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn2424 1695 1689-3383 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MSTLKITGMT CDSCAVHVKD ALEKVPGVQS ADVSYAKGSA KLAIEVGTSP DALTAAVAGL GYRATLADAP SVSTPGGLLD KMRDLLGRND KTGSSGALHI
AVIGSGGAAM AAALKAVEQG ARVTLIERGT IGGTCVNVGC VPSKIMIRAA HIAHLRRESP FDGGIAATTP TIQRTALLAQ QQARVDELRH AKYEGILEGN
PAITVLHGSA RFKDNRNLIV QLNDGGERVV AFDRCLIATG ASPAVPPIPG LKDTPYWTST EALVSETIPK RLAVIGSSVV ALELAQAFAR LGAKVTILAR
STLFFREDPA IGEAVTAAFR MEGIEVREHT QASQVAYING EGDGEFVLTT AHGELRADKL LVATGRAPNT RKLALDATGV TLTPQGAIVI DPGMRTSVEH
IYAAGDCTDQ PQFVYVAAAA GTRAAINMTG GDAALNLTAM PAVVFTDPQV ATVGYSEAEA HHDGIKTDSR TLTLDNVPRA LANFDTRGFI KLVVEEGSGR
LIGVQAVAPE AGELIQTAAL AIRNRMTVQE LADQLFPYLT MVEGLKLAAQ TFNKDVKQLS CCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn2424 363 3401-3763 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MSAYTVSQLA HNAGVSVHIV RDYLVRGLLR PVACTTGGYG VFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGAQ AAAQLAVLRQ LVERRRAALA
HLDAQLASMP AERAHEEALP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn2424 237 3760-3996 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Comment:   similar to urf-1 in pKLH2 (GenBank AF213017), pKLH272 (Genbank Y08992), pMER610 (GenBank Y08993), pKLH210 (GenBank Y10102), Tn5036 (Genbank Y09025), orf1 in Tn501 (GenBank Z00027), and urf-1 in Tn5041 (GenBank X98999)
Protein Sequence:  
MNAPDKLPPE TRQPVSGYLW GALAVLTCPC HLPILAAVLA GTTAGAFLGE HWGVAALALT GLFVLAVTRL LRAFRGGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM 5'-end N Tn2424 671 3993-4663 +
Class:   Passenger Gene
Sub Class:   Other
Comment:   urfM ORF interrupted by insertion of In2
Protein Sequence:  
MTSSQPAGWT AAELAQAAAR GQLDLHYQPL VDLRDHRIAG AEALMRWRHP RLGLLPPGQF LPLAESFGLM PEIGAWVLGE ACRQMHKWQG PAWQPFRLAI
NVSASQVGPT FDDEVKRVLA DMALPAELLE IELTESVAFG NPALFASFDA LRAIGVRFAA DDFGTGYSCL QHLKCCPITT LKIDQSFVAR LPDDARDQTI
VRAVIQLAHG LGMDVIFRRR LHQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA In21 1680 4775-6454 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   can be extended upstream by 12 amino acids| identical to tniA (Tn1721 and In2)| 25% amino acid sequence identity to TnsB from Tn7
Protein Sequence:  
MATDTPRIPE QGVATLPDEA WERARRRAEI ISPLAQSETV GHEAADMAAQ ALGLSRRQVY VLIRRARQGS GLVTDLVPGQ SGGGKGKGRL PEPVERVIHE
LLQKRFLTKQ KRSLAAFHRE VTQVCKAQKL RVPARNTVAL RIASLDPRKV IRRREGQDAA RDLQGVGGEP PAVTAPLEQV QIDHTVIDLI VVDDRDRQPI
GRPYLTLAID VFTRCVLGMV VTLEAPSAVS VGLCLVHVAC DKRPWLEGLN VEMDWQMSGK PLLLYLDNAA EFKSEALRRG CEQHGIRLDY RPLGQPHYGG
IVERIIGTAM QMIHDELPGT TFSNPDQRGD YDSENKAALT LRELERWLTL AVGTYHGSVH NGLLQPPAAR WAEAVARVGV PAVVTRATSF LVDFLPILRR
TLTRTGFVID HIHYYADALK PWIARRERWP SFLIRRDPRD ISRIWVLEPE GQHYLEIPYR TLSHPAVTLW EQRQALAKLR QQGREQVDES ALFRMIGQMR
EIVTSAQKAT RKARRDADRR QHLKTSARPD KPVPPDTDIA DPQADNLPPA KPFDQIEEW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB delta1 TniB delta1 In21 861 6457-7317 +
Class:   Accessory Gene
Function:   probable ATP-binding protein.
Comment:   probably truncated by insertion of IS1326::IS1353
Protein Sequence:  
MDEYPIIDLS HLLPAAQGLA RLPADERIQR LRADRWIGYP RAVEALNRLE ALYAWPNKQR MPNLLLVGPT NNGKSMIVEK FRRTHPASSD ADQEHIPVLV
VQMPSEPSVI RFYVALLAAM GAPLRPRPRL PEMEQLALAL LRKVGVRMLV IDELHNVLAG NSVNRREFLN LLRFLGNELR IPLVGVGTRD AYLAIRSDDQ
LENRFEPMML PVWEANDDCC SLLASFAASL PLRRPSPIAT LDMARYLLTR SEGTIGELAH LLMAAAIVAV ESGEEAINHR TLSMAC

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp Tnp IS1353 1545 7368-8912 -
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MYSYEDRLRA VRLYLKLGRR MSATLRQLGY PTKNSLKAWL AEFERNQDLR RGYQRIKRQY TDEQKQRAVD HYIEQGYCLS HTIRSLGYPS REALRAWIRD
LRPEFARTVV GSSAPTVARS RLEKQQAVIA LNLRVGSAKD VADTVGVSRP TLYNWQHRLL GKVPLKPMTK KKGDTSLEQR HEALLRELAE LESQNQRLRM
ENAILEKASE LIKKDMGINP LELTSREKTK VVDALRVTFP LANLLCGLKL ARSTYFYQRL RQTRPDKYTQ VREVIRTIFE DNYRCYGYRR IDSALRLGGM
RVSEKVVRRL MAQERLVVRT PRRRRFSAYA GDPTPAVPNL LNRDFHASAP NTKWLTDLTE IHIPAGKVYV SPIVDCFDGL VVAWNIGTSP DANLVNTMLD
HAVRTLRPGE HPVIHSDRGS HYRWPAWIRR TENAQLTRSM SKKGCSPDNA ACEGFFGRLK TELIYPRNWQ HVTLKDLMTR IDAYIHWYNE RRIKVSLGGR
SPIEYRHAVG LMSV

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istA N-ter IstA N-ter IS1326_IS1353_ISEc37.1 822 9044-9865 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MAILSAIRRW HFRDGASIRE IARRSGLSRN TVRKYLQSKV VEPQYPARDS VGKLSPFEPK LRQWLSTEHK KTKKLRRNLR SMYRDLVALG FTGSYDRVCA
FARQWKDSEQ FKAQTSGKGC FIPLRFACGE AFQFDWSEDF ARIAGKQVKL QIAQFKLAHS RAFVLRAYYQ QKHEMLFDAH WHAFQIFGGI PKRGIYDNMK
TAVDSVGRGK ERRVNQRFTA MVSHYLFDAQ FCNPASGWEK GQIEKNVQDS RQRLWQGAPD FQSLADLNVW LDR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp Tnp ISEc37.1 1188 10046-11233 -
Class:   Transposase
Transpoase Chemistry:   HUH
Protein Sequence:  
MLPRFADIFQ QGNRWLNWLE KQPEGAVRPV VIESVTKIMA CGTTLMGYTQ WCCSSPDCCH TKKVCFRCKS RSCPHCGVKA GAQWIQYLLS LVPDCPWQHI
VFTLPCQYWS LVFHNRWLLT EMSRIAADVI LEICHQADVE PGIFTVIHTW GRDQQWHPHI HLSTTAGGVT SGHTWKNLHF YARKVMSMWR YRITRLLSRK
YPDLVMPDAL AAEGSSKREW NRFLDTHYRR GWNVNVSRVM DNATHVAVYF GSYLKKPPVP MSRLEHYAGQ DEIGLRYNSH RTKREEYLLM SGDEFMERFS
WHVADKGFRM VRYYGFLSPA KRRLLEEVVY IITETVRKTA MQITWRGMYQ RLLKVDPLKC VLCGSQMRFT GLKRGYRLAE QVLMHELLAR MRWCG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orf2 Orf2 ISEc37.1 366 11233-11598 -
Class:   Accessory Gene
Protein Sequence:  
MARSAKPRKR KPASQRSKLP RYVVKLHEDD FFDEEDAEVL RFDSFDDAVE CCADLNIPFF VDAGNKKLVF WFVRVDDEGY PEIARCTERE FATILSGISA
GGMYCPECGT VHWPDGVAPP F

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istA C-ter IstA C-ter IS1326_IS1353_ISEc37.1 701 11687-12387 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
SIAAKRCGLS CATPNWTKPC KRPLPMNKAS *WRYPMPLMH SWSKPSESLQ PALFTTRAIA TAFLPVTPTG PSAFGFMQTS W*WLPKANTL PSIQDCLAVA
TLGVATHNTT GTITCLCFRR NLGRCAMVRH LLNCHPRSRS FNPSCCNAPA VTVTWWKFWP LYCTTMKVRY SVLWNWHWSV ASHRRSMCLI CWDV*PKNLH
PNRFQFPRG* G*HWNHRPT* TAMTV*GEPM MQH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istB IstB IS1326_IS1353_ISEc37.1 786 12374-13159 +
Class:   Accessory Gene
Sub Class:   ATPase Transposition Helper
Function:   stimulates transposition
Protein Sequence:  
MMQHEGHVRI LKSLKLFGMA HAIEELGNQN SPAFNQALPM LDSLIKAEVA EREVRSVNYQ LRVAKFPVYR DLVGFDFSQS LVNEATVKQL HRCDFMEQAQ
NVVLIGGPGT GKTHLATAIG TQAVMHLNRR VRFFSTVDLV NALEQEKSSG RQGQIANRLL YADLVILDEL GYLPFSQTGG ALLFHLLSKL YEKTSVILTT
NLSFSEWSRV FGDEKMTTAL LDRLTHHCHI LETGNESYRF KHSSTQNKQE EKQTRKLKIE T

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
GNAT_fam GNAT_fam In21 501 13335-13835 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  Acetyltransf_1 (Pfam:PF00583)
Comment:   putative acetyltransferase ADU64769.1
Protein Sequence:  
MDSEEPPNVR VACSGDIDEV VRLMHDAAAW MSAKGTPAWD VARIDRTFAE TFVLRSELLV ASCSDGIVGC CTLSAEDPEF WPDALKGEAA YLHKLAVRRT
HAGRGVSSAL IEACRHAART QGCAKLRLDC HPNLRGLYER LGFTHVDTFN PGWDPTFIAE RLELEI

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
sul1 (ARO:3000410) Sul1 In21 840 13963-14802 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Transpoase Chemistry:   dihydropteroate synthase
Target:   sulfonamide antibiotic (ARO:3000282)||sulfone antibiotic (ARO:3003401)
Sequence Family:  sulfonamide resistant sul (ARO:3004238)
Comment:   perfect match to reference sequence for ARO:3000410
Protein Sequence:  
MVTVFGILNL TEDSFFDESR RLDPAGAVTA AIEMLRVGSD VVDVGPAASH PDARPVSPAD EIRRIAPLLD ALSDQMHRVS IDSFQPETQR YALKRGVGYL
NDIQGFPDPA LYPDIAEADC RLVVMHSAQR DGIATRTGHL RPEDALDEIV RFFEARVSAL RRSGVAADRL ILDPGMGFFL SPAPETSLHV LSNLQKLKSA
LGLPLLVSVS RKSFLGATVG LPVKDLGPAS LAAELHAIGN GADYVRTHAP GDLRSAITFS ETLAKFRSRD ARDRGLDHA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacEdelta1 (ARO:3005010) QacEdelta1 In21 348 14796-15143 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   acridine dye (ARO:3000054)||quaternary ammonium salts
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Comment:   subunit of the qac multidrug efflux pump||perfect match to reference sequence for ARO:3005010 (bitscore:219)
Protein Sequence:  
MKGWLFLVIA IVGEVIATSA LKSSEGFTKL APSAVVIIGY GIAFYFLSLV LKSIPVGVAY AVWSGLGVVI ITAIAWLLHG QKLDAWGFVG MGLIIAAFLL
ARSPSWKSLR RPTPW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
catB2 (ARO:3002675) CatB2 In21 633 15312-15944 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   phenicol antibiotic (ARO:3000387)
Sequence Family:  chloramphenicol acetyltransferase (CAT) (ARO:3000122)
Comment:   99% match to reference sequence for ARO:3002675 (bitscore: 436)
Protein Sequence:  
MTNYFESPFK GKLLTEQVKN PNIKVGRYSY YSGYYHGHSF DDCARYLLPD RDDVDQLIIG SFCSIGSGAA FIMAGNQGHR YDWVSSFPFF YMNEEPAFAK
SVDAFQRAGD TVIGSDVWIG SEAMIMPGIK IGHGAVIGSR ALVAKDVEPY TIVGGNPAKS IRKRFSEEEI SMLLDMAWWD WPLEQIKEAM PFLCSSGIAS
LYRRWQGTSA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfM OrfM In21 264 16093-16356 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Comment:   AAC14736.1
Protein Sequence:  
MQGGQLHGVA DGAMRHAGDR VGQLQWPAEL EQIVKFGVCR ISLAGLLLAN LVTWQQPDAF YWPVPDNVFL VTQGGSSENN LPRSMVL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
parE ParE In21 300 16536-16835 -
Class:   Passenger Gene
Sub Class:   Toxin
Target:   DNA gyrase
Sequence Family:  ParE_toxin (Pfam:PF05016)
Comment:   WP_115197934.1
Protein Sequence:  
MELRIAESTR GDLQAIQEYY RAEGVPQIGD DFVAATLGHC EMLQRHPEAG RVVPEFNLDN IRELIHAPFR VVYLRQSTET VLIRIWCSER QLELPENEE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
phd Phd In21 270 16836-17105 -
Class:   Passenger Gene
Sub Class:   Antitoxin
Sequence Family:  PhdYeFM_antitox (Pfam:PF02604)
Comment:   Phd
Protein Sequence:  
MQVKFSEDVI PLSDLKINPG KVVNRTQDTQ RPILLTSRGR GVAVVQGLED YERAAEELRF VKAVAQGLVD VREGSTVSLE DARKALGIE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfJ OrfJ In21 258 17269-17526 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Comment:   WP_115197932.1
Protein Sequence:  
MHDFNGAQIF VGAKVKVLFI DQTIMNGLPS SEVNDINSML GEIFEVYEID EYGQAWVEKW WHLDEGKSYS HSLGLSSTEL ELVEK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfI OrfI In21 579 17558-18136 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Comment:   WP_115197931.1
Protein Sequence:  
MPRIFTQLIA LLLLVACKPE SVPLNESFTC SENPIELEQI SQLLKNEHVP FTQETVLVDR VSFTSAGVKS VLPKGATCIF YSHKYSNITN KINKEVIDDF
PPIWGRATSW DDRNAQLVEK LSQHGIQTTR RVYRGKEWIA WPIEDVELAE NILGFNEKMK QYFKEQRLKM YAPNQALKAQ PSATVDAASS AS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfH OrfH In21 333 18257-18589 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Comment:   WP_115197930.1
Protein Sequence:  
MGNFIKTLVC VVSAIFAVLA IDALISGNVR DSITLLVISA FVALCGGIGL FFQRFPSPPL APGEGNSAWT LLRSYRKQYP GWQGKLVYYG IPTLLLIVML
FRLSELLASI

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfG OrfG In21 426 18727-19152 -
Class:   Passenger Gene
Sub Class:   Hypothetical
Comment:   WP_013136948.1
Protein Sequence:  
MEQINNIELV DPSIYPTDEI LKRILGKSFS VYLKLLRLYE NYSLIPEWKY YKDGKAWLCK VIKGKKTIVW MSAWKNYIKA TIYLPEKHIN GVLVLDIHEI
TKKAFIETNN IGRSRPCMFE LKEENILEDF IKVMQFKMTL K

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
AAC(6')-Ia (ARO:3002545) AAC(6')-Ia In21 558 19157-19714 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  AAC(6') (ARO:3000345)
Comment:   strict match to reference sequence for ARO:3002545 (bitscore: 378)
Protein Sequence:  
MNYQIVNIAE CSNYQLEAAN ILTEAFNDLG NNSWPDMTSA TKEVKECIES PNLCFGLLIN NSLVGWIGLR PMYKETWELH PLVVRPDYQN KGIGKILLKE
LENRAREQGI IGIALGTDDE YYRTSLSLIT ITEDNIFDSI KNIKNINKHP YEFYQKNGYY IVGIIPNANG KNKPDIWMWK SLIKE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aadA3 (ARO:3002603) AadA3 In21 792 19814-20605 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  ANT(3'') (ARO:3004275)
Comment:   strict match to reference sequence for ARO:3002603 (bitscore: 530)
Protein Sequence:  
MRVAVTIEIS NQLSEVLSVI ERHLESTLLA VHLYGSAVDG GLKPYSDIDL LVTVAVKLDE TTRRALLNDL MEASAFPGES ETLRAIEVTL VVHDDIIPWR
YPAKRELQFG EWQRNDILAG IFEPAMIDID LAILLTKARE HSVALVGPAA EEFFDPVPEQ DLFEALRETL KLWNSQPDWA GDERNVVLTL SRIWYSAITG
KIAPKDVAAD WAIKRLPAQY QPVLLEAKQA YLGQKEDHLA SRADHLEEFI HYVKGEITKV VGK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 In21 1014 20754-21767 +
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LRTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpM TnpM Tn2424 351 21970-22320 +
Class:   Accessory Gene
Sub Class:   Inhibitor
Function:   transposition regulator; reported to enhance Tn21 transposition and suppress resolution of cointegrate replicons in vivo
Comment:   3'-end of urfM ORF, which is interrupted by insertion of In2||inhibits tranposition probably by inhibiting resolution
Protein Sequence:  
MEVVAEGVET PDCLAWLRQA GCDTVQGFLF ARPMPAAAFV GFVNQWRNTT MNANEPSTSC CVCCKEIPLD AAFTPEGAEY VEHFCGLECY QRFQARASTA
TETSVKPDAC DSPPSG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn2424 561 22446-23006 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   identical to tnpR (TnAs3 )
Protein Sequence:  
MTGQRIGYIR VSTFDQNPER QLEGVKVDRA FSDKASGKDV KRPQLEALIS FARTGDTVVV HSMDRLARNL DDLRRIVQTL TQRGVHIEFV KEHLSFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKSLSSER IAELRQRVEA GEQKTKLARE FGISRETLYQ YLRTDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn2424 2967 23009-25975 +
Class:   Transposase
Function:   transposition, DNA-mediated (GO:0006313)
Transpoase Chemistry:   DDE
Comment:   identical to TnAs3 tnpA
Protein Sequence:  
MPRRSILSAA ERESLLALPD SKDDLIRHYT FNDTDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEL PFPPLLKLVA DQLKVGVESW NEYGQREQTR
REHLSELQTV FGFRPFTMSH YRQAVQMLTE LAMQTDKGIV LASALIGHLR RQSVILPALN AVERASAEAI TRANRRIYDA LAEPLADAHR RRLDDLLKRR
DNGKTTWLAW LRQSPAKPNS RHMLEHIERL KAWQALDLPT GIERLVHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LATEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLY GRIGQALIDA KQSGRDAFAA IEAVMSWDSF AESVTEAQKL AQPDDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKN VLDAIEVLRG MNTDNARKLP ADAPTGFIKP RWQKLVMTDA GIDRRYYELC ALSELKNSLR SGDIWVQGSR QFKDFEDYLV PPEKFTSLKQ
SSELPLAVAT DCEQYLHERL TLLEAQLATV NRMAAANDLP DAIITESGLK ITPLDAAVPD TAQALIDQTA MVLPHVKITE LLLEVDEWTG FTRHFTHLKS
GDLAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHTRDET YSTALAELVN AQFRHPFAGH WGDGTTSSSD GQNFRTASKA KSTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGLRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERAAHALRGN GHAVDDSLLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
In21-UGCJ01000005 In21 Integron 4634-21969 17336
IS1353-AF071413 IS1353 Insertion Sequence 7312-13226 5915
ISEc37.1-UGCJ01000005 ISEc37.1 Insertion Sequence 7340-8953 1614

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
repeat i4 Tn2424 10-28 TCAGAAAACG GAAAATAAA
IRt In21 4634-4666 TGTCATTTTC AGAAGACGAC TGCACCAGTT GAT
repeat t1 In21 4642-4660 TCAGAAGACG ACTGCACCA
repeat t2 In21 4682-4700 AACACGTCGG TCGAGGACT
repeat t3 In21 4711-4730 TCAGAAGTGA TCTGCACCAA
repeat t4 In21 4743-4761 TCAATACTCG TGTGCACCA
IRL IS1326_IS1353_ISEc37.1 7312-7337 TGTTGAGTTG CATCTAAAAT TGACCC
IRR IS1353 7340-7352 TGGGGGTGCG GAC
IRL IS1353 8942-8953 CAGGCGTGGG GT
IRR IS1326_IS1353_ISEc37.1 13201-13226 CCCAGTTTAA ACCCACGTTT AGTTGT
repeat i4 In21 21850-21868 AGGAGGGACG CAGGCGACT
repeat i3 In21 21878-21896 CGTCGGGCAG CAACGGACT
repeat i2 In21 21920-21938 ATCACGTCAG CCGAAGACT
IRi In21 21937-21969 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 In21 21943-21961 GTCACGTCGG CAGAAGACT
IRR Tn2424 25968-26008 GCCGAATCGC ACGAAATAAA AGGCAAAAGA CTCTGCTGGG G

 References     

1.Meyer JF, Nies BA, Wiedemann B. Amikacin resistance mediated by multiresistance transposon Tn2424. J Bacteriol. 1983 Aug;155(2):755-60. doi: 10.1128/JB.155.2.755-760.1983. PubMed ID: 6307980