Transposon
Name: Tn2411
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Escherichia coli 042 Molecular Source:chromosome
Date of Isolation:2010
Other Geographic Information:enteroaggregative E. coli (EAEC) causes diarrhea

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 37 bp)GGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  18055 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGCACCTC AGAAAACGGA AAATAAAGCA CGCTAAGGCA TAGCTGACCT TGCCAGGCCT GCTTCGCCCT GTAGTGACGC GATCAACGGG CAGGAAACAT 100
TCCCCTTTCG TGCATGGCAG GCGCACACGA GTTCAGACAG CACGGTTTCC ATGCGCGCCA AGTCGGCCAT CTTCTCGCGC ACGTCCTTGA GCTTGTGTTC 200
GGCCAGGCTG CTGGCCTCCT CGCAGTGGGT GCCATCGTCG AGCCGCAACA GCTCGGCAAT CTCGTCCAGA CTGAACCCCA GCCGCTGTGC CGATTTCACG 300
AATTTCACCC GAACCACGTC CGCCTCCCCA TAGCGGCGGA TGCTGCCGTA AGGCTTGTCC GGTTCCCGCA ACAGGCCCTT GCGCTGATAG AAGCGGATTG 400
TCTCCACGTT GACCCCGGCC GCCTTGGCAA AAACGCCAAT GGTCAGGTTT TCCAAATTAT TTTCCATATC GCTTGACTCC GTACATGAGT ACGGAAGTAA 500
GGTTACGCTA TCCAATCCAA ATTCAAAAGG GCCAACGTAT GTCTGAACCA CAAAACGGGC GCGGTGCGCT CTTCGCCGGC GGGCTGGCCG CCATTCTTGC 600
ATCGACCTGC TGCCTGGGGC CGCTAGTACT GGTCGCCCTG GGCTTCTCCG GTGCTTGGAT CGGCAACCTG ACGGTGCTGG AACCCTATCG ACCGTTGTTC 700
ATCGGCGCGG CGCTAGTGGC GCTGTTCTTC GCCTGGAAGC GGATTTACCG GCCCGTGCAG GCATGCAAGC CAGGTGAGGT CTGCGCGATT CCGCAGGTGC 800
GCGCCACCTA CAAGCTGATT TTCTGGATCG TGGCCGTGCT GGTCCTGGTC GCGCTTGGAT TTCCCTATGT CGTTCCATTT TTCTATTAAC CAGGAGTTCA 900
TCATGAAGAA ACTGTTTGCC TCCCTTGCCC TCGCCGCCGC TGTTGCCCCG GTGTGGGCCG CTACCCAGAC CGTCACGCTA GCGGTTCCCG GCATGACTTG 1000
CGCCGCCTGC CCGATCACAG TCAAGAAAGC GCTCTCCAAG GTCGAAGGCG TGAGCAAGGT CGATGTGGGC TTCGAGAAGC GCGAGGCCGT CGTCACTTTT 1100
GACGACACCA AGGCCAGCGT ACAGAAGCTG ACCAAGGCCA CCGCAGACGC CGGCTATCCG TCCAGCGTCA AGCAGTGAGC CAGCAAGCCA ACGACAACAG 1200
CGAGAGCCGC TTCATGGGAC TGATGACACG CATTGCCGAT AAAACCGGCG CGCTCGGCAG CGTCGTTTCC GCGATGGGCT GCGCCGCCTG CTTTCCAGCC 1300
CTCGCCAGCT TCGGCGCGGC CATCGGGCTG GGCTTCTTGA GCCAGTACGA GGGACTGTTC ATCAGCCGCC TGCTGCCGCT GTTTGCCGCG CTGGCCTTCC 1400
TGGCGAACGC GCTGGGTTGG TTCAGTCATC GGCAATGGCT GCGCAGTCTG CTCGGCATGA TCGGCCCGGC CATCGTGTTT GCGGCCACGG TCTGGCTGCT 1500
CGGCAACTGG TGGACGGCGA ACCTGATGTA CGTCGGCCTG GCCTTGATGA TTGGGGTGTC GATCTGGGAC TTCGTGTCGC CGGCGCATCG CCGTTGCGGA 1600
CCGGACGGCT GCGAACTCCC CGCCAAGCGC TTGTGAAAGA CGGCTGACCG TGCGACACGG CGGCCCACAC GAATAAGGAA CGATGGTATG AGCACTCTCA 1700
AAATCACCGG CATGACTTGC GACTCGTGCG CAGTGCATGT CAAGGACGCC CTGGAGAAAG TGCCCGGCGT GCAATCAGCG GATGTCTCCT ACGCCAAGGG 1800
CAGCGCCAAG CTCGCCATTG AGGTCGGCAC GTCACCCGAC GCGCTGACGG CCGCTGTAGC TGGACTCGGT TATCGGGCCA CGCTGGCCGA TGCCCCCTCA 1900
GTTTCGACGC CGGGCGGATT GCTCGACAAG ATGCGCGATC TGCTGGGCAG AAACGACAAG ACGGGTAGCA GCGGCGCATT GCATATCGCC GTCATCGGCA 2000
GCGGCGGGGC CGCGATGGCA GCGGCGCTGA AGGCCGTCGA GCAAGGCGCA CGTGTCACGC TGATCGAGCG CGGCACCATC GGCGGCACCT GCGTCAATGT 2100
CGGTTGTGTG CCGTCCAAGA TCATGATCCG CGCCGCCCAT ATCGCCCATC TGCGCCGGGA AAGCCCGTTC GATGGCGGCA TCGCCGCTAC CACGCCGACC 2200
ATCCAGCGCA CGGCGCTGCT GGCCCAGCAG CAGGCCCGCG TCGATGAACT GCGCCACGCC AAGTACGAAG GCATCTTGGA GGGCAATCCG GCGATCACTG 2300
TGCTGCACGG CTCCGCCCGC TTTAAGGACA ATCGCAACCT GATCGTGCAA CTCAACGACG GCGGCGAGCG CGTGGTGGCA TTCGACCGCT GCCTGATCGC 2400
CACCGGCGCG AGCCCGGCCG TGCCGCCGAT TCCCGGCCTG AAAGACACTC CGTACTGGAC TTCCACTGAA GCGCTGGTCA GCGAGACGAT TCCTAAGCGC 2500
CTGGCCGTGA TTGGCTCATC AGTGGTGGCG CTGGAGCTGG CGCAGGCGTT CGCCCGACTC GGAGCGAAGG TGACGATCCT GGCTCGCAGC ACGCTGTTCT 2600
TCCGCGAAGA CCCAGCTATA GGCGAAGCCG TCACGGCCGC ATTCCGCATG GAGGGCATCG AGGTGAGGGA ACACACCCAG GCCAGCCAGG TCGCGTATAT 2700
CAATGGTGAA GGGGACGGCG AATTCGTGCT CACCACGGCG CACGGCGAAC TGCGCGCCGA CAAGCTGCTG GTCGCCACCG GCCGCGCGCC CAACACACGC 2800
AAGCTGGCAC TGGATGCGAC GGGCGTCACG CTCACCCCGC AAGGCGCTAT CGTCATCGAC CCCGGCATGC GTACAAGCGT GGAACACATC TACGCCGCAG 2900
GCGACTGCAC CGACCAGCCG CAGTTCGTCT ATGTGGCGGC AGCGGCCGGC ACTCGCGCCG CGATCAACAT GACCGGCGGT GACGCGGCCC TGAACCTGAC 3000
CGCGATGCCG GCCGTGGTGT TCACCGACCC GCAAGTGGCG ACCGTAGGCT ACAGCGAGGC GGAAGCGCAC CATGACGGCA TCAAAACTGA TAGTCGCACG 3100
CTAACGCTGG ACAACGTGCC GCGCGCGCTC GCCAACTTCG ACACGCGCGG CTTCATCAAA CTGGTGGTTG AAGAAGGCAG CGGACGACTG ATCGGCGTGC 3200
AGGCAGTGGC CCCGGAAGCG GGCGAACTGA TCCAGACGGC CGCACTGGCG ATTCGCAACC GGATGACGGT GCAGGAACTG GCCGACCAGT TGTTCCCCTA 3300
CCTGACGATG GTCGAAGGGT TGAAGCTCGC GGCGCAGACC TTCAACAAGG ATGTGAAGCA GCTTTCCTGC TGCGCCGGGT GAGGACAAGG AGGTGTGCGA 3400
TGAGCGCCTA CACGGTATCG CAACTGGCCC ATAACGCTGG GGTGAGCGTA CATATCGTGC GCGACTACCT GGTGCGCGGC TTGTTACGGC CGGTGGCCTG 3500
CACCACGGGC GGCTACGGCG TGTTCGACGA TGCGGCCTTG CAACGGCTGT GCTTCGTGCG CGCGGCCTTC GAGGCGGGTA TCGGCCTGGA TGCCCTGGCG 3600
CGGCTGTGCC GTGCGCTCGA CGCAGCGGAC GGCGCACAAG CCGCAGCGCA GCTTGCCGTG CTGCGCCAGT TGGTCGAGCG GCGGCGCGCG GCGTTGGCCC 3700
ATCTGGACGC GCAACTGGCC TCCATGCCAG CCGAGCGGGC GCACGAGGAG GCATTGCCGT GAACGCCCCT GACAAACTGC CGCCCGAGAC GCGCCAACCC 3800
GTTTCCGGCT ACCTGTGGGG TGCGCTGGCC GTGTTGACCT GCCCCTGCCA TCTGCCGATT CTCGCCGCCG TGCTGGCCGG GACGACCGCC GGTGCCTTCC 3900
TTGGCGAGCA TTGGGGTGTT GCCGCGCTCG CGCTGACCGG CTTGTTCGTT CTGGCCGTAA CGCGGCTGCT GCGCGCCTTC CGGGGCGGAT CATGACGAGT 4000
TCGCAGCCCG CCGGATGGAC GGCGGCCGAG TTGGCGCAGG CGGCGGCGCG CGGACAGCTT GACCTGCATT ACCAGCCGCT GGTCGATCTG CGCGATCACC 4100
GGATCGCTGG CGCGGAAGCG TTGATGCGCT GGCGGCATCC GAGGCTTGGC CTGTTGCCGC CCGGCCAGTT CCTGCCGCTG GCCGAGTCGT TCGGCCTGAT 4200
GCCGGAAATA GGCGCGTGGG TGCTGGGCGA GGCCTGTCGC CAGATGCACA AGTGGCAAGG ACCGGCATGG CAACCGTTCC GTCTTGCCAT CAATGTGTCC 4300
GCCAGCCAGG TTGGGCCAAC GTTCGACGAC GAGGTAAAGC GGGTGCTGGC CGATATGGCC CTGCCCGCCG AGCTTCTGGA GATCGAACTG ACCGAATCGG 4400
TCGCATTCGG CAATCCAGCC CTGTTCGCCA GTTTCGACGC CTTGCGCGCC ATCGGCGTGC GCTTCGCCGC CGACGACTTC GGCACCGGCT ATTCCTGCCT 4500
GCAACATCTG AAATGCTGCC CCATCACCAC ATTGAAAATC GACCAATCCT TTGTCGCCAG GCTCCCGGAT GATGCCCGTG ACCAAACTAT CGTGCGGGCG 4600
GTGATCCAGC TCGCGCACGG GCTGGGCATG GATGTCATTT TCAGAAGACG ACTGCACCAG TTGATTGGGC GTAATGGCTG TTGTGCAGCC AGCTCCTGAC 4700
AGTTCAATAT CAGAAGTGAT CTGCACCAAT CTCGACTATG CTCAATACTC GTGTGCACCA AAGCGAGGTG AGCATGGCGA CGGACACCCC ACGGATTCCA 4800
GAACAAGGCG TGGCCACTCT GCCTGATGAG GCTTGGGAGC GTGCGCGCCG TCGTGCGGAG ATCATCAGTC CGTTGGCGCA GTCGGAGACG GTCGGGCACG 4900
AAGCGGCCGA TATGGCGGCT CAGGCGCTGG GCTTGTCTCG GCGCCAGGTA TACGTTCTGA TCCGGCGTGC CCGGCAAGGC AGCGGCCTCG TGACGGATCT 5000
GGTGCCCGGC CAGTCCGGTG GAGGTAAAGG TAAGGGGCGC TTGCCGGAAC CGGTCGAGCG CGTCATCCAC GAGCTACTGC AAAAGCGGTT CCTGACCAAG 5100
CAGAAGCGCA GCCTAGCGGC CTTTCACCGC GAAGTCACTC AGGTGTGCAA GGCTCAAAAA CTGCGAGTGC CGGCGCGCAA TACCGTGGCC TTACGGATCG 5200
CTAGCCTTGA CCCGCGCAAG GTCATCCGCC GGCGGGAAGG CCAGGATGCC GCTCGTGACC TACAAGGTGT GGGCGGCGAG CCTCCTGCCG TGACCGCGCC 5300
GCTGGAGCAG GTGCAGATAG ACCATACGGT CATCGACCTG ATCGTGGTCG ATGACCGCGA CCGGCAACCT ATTGGCCGCC CGTACCTGAC CCTCGCCATC 5400
GACGTGTTCA CCCGCTGCGT GCTCGGCATG GTCGTCACGC TGGAAGCGCC GTCTGCCGTT TCGGTTGGCC TGTGCCTCGT GCATGTCGCC TGCGACAAGC 5500
GCCCTTGGCT GGAAGGACTG AACGTGGAAA TGGATTGGCA GATGAGCGGC AAGCCCTTGC TGCTCTACCT AGACAACGCG GCCGAGTTCA AGAGCGAGGC 5600
CCTGCGCCGG GGTTGCGAGC AGCATGGCAT CCGGCTGGAC TATCGCCCGC TGGGACAGCC GCACTATGGC GGCATCGTGG AACGGATCAT CGGCACGGCG 5700
ATGCAGATGA TTCACGACGA ACTGCCGGGA ACGACCTTCT CCAACCCTGA CCAGCGCGGC GACTACGATT CCGAAAACAA GGCCGCCCTG ACGCTGCGCG 5800
AGCTAGAGCG CTGGCTCACA TTGGCGGTCG GCACCTACCA CGGTTCGGTG CACAACGGCC TGCTCCAACC GCCGGCCGCG CGCTGGGCCG AGGCCGTGGC 5900
GCGTGTCGGC GTACCGGCCG TCGTCACACG CGCTACTTCG TTCCTGGTCG ATTTTCTGCC GATCCTCCGG CGCACGCTGA CCCGCACCGG CTTTGTCATC 6000
GACCACATCC ACTACTACGC CGATGCGCTC AAGCCGTGGA TTGCGCGGCG TGAACGCTGG CCGTCCTTTC TGATCCGGCG CGATCCGCGC GACATCAGCC 6100
GTATCTGGGT CCTGGAACCG GAGGGACAGC ATTACCTGGA AATTCCCTAC CGTACCTTGT CGCATCCGGC TGTCACCCTC TGGGAACAAC GGCAGGCGCT 6200
GGCGAAACTG CGGCAGCAAG GGCGCGAACA GGTGGATGAG TCGGCGCTGT TCCGCATGAT CGGCCAGATG CGTGAGATTG TGACCAGCGC GCAGAAGGCC 6300
ACACGCAAGG CGCGGCGTGA CGCGGATCGC CGCCAGCACC TCAAGACATC AGCTCGGCCG GACAAGCCCG TTCCGCCGGA TACGGATATT GCCGACCCGC 6400
AGGCAGACAA CTTGCCACCC GCCAAACCGT TCGACCAGAT TGAGGAGTGG TAGCCGTGGA CGAATATCCC ATCATCGACC TGTCCCACCT GCTGCCGGCG 6500
GCCCAGGGCT TGGCCCGTCT TCCGGCGGAC GAGCGCATCC AGCGCCTTCG CGCCGACCGC TGGATCGGCT ATCCGCGCGC AGTCGAGGCG CTGAACCGGC 6600
TGGAAGCCCT TTATGCGTGG CCAAACAAGC AACGCATGCC CAACCTGCTG CTGGTTGGCC CGACCAACAA TGGCAAGTCG ATGATCGTCG AGAAGTTCCG 6700
CCGCACCCAC CCGGCCAGCT CCGACGCCGA CCAGGAGCAC ATCCCGGTGT TGGTCGTGCA GATGCCGTCC GAGCCGTCCG TGATCCGCTT CTACGTCGCG 6800
CTGCTCGCCG CGATGGGCGC GCCGCTGCGC CCACGCCCAC GGTTGCCGGA AATGGAGCAA CTGGCTCTGG CACTGCTGCG CAAGGTCGGC GTGCGCATGC 6900
TGGTGATCGA CGAGCTGCAC AACGTGCTGG CCGGCAACAG CGTCAACCGC CGGGAATTCC TCAACCTGCT GCGCTTCCTC GGCAACGAAC TGCGCATCCC 7000
GTTGGTTGGG GTAGGCACGC GCGACGCCTA CCTAGCCATC CGCTCCGATG ACCAGTTGGA AAATCGCTTC GAGCCGATGA TGCTGCCGGT ATGGGAGGCC 7100
AACGACGATT GCTGCTCACT GCTGGCCAGC TTCGCCGCTT CGCTCCCGCT GCGCCGGCCT TCCCCAATTG CCACGCTGGA CATGGCTCGC TACCTGCTCA 7200
CACGCAGCGA GGGCACCATA GGGGAACTGG CGCACTTGCT GATGGCGGCG GCCATCGTCG CCGTGGAGAG CGGCGAGGAA GCGATCAACC ATCGCACACT 7300
CAGCATGGCC TGTTGAGTTG CATCTAAAAT TGACCCACTT AGGGTAAAGA TTTGCGTCGA AATTTGACCC ACGTATGACA CTGTTTCCCG TCTGGATATG 7400
GCGGGAGAAA TCAAGGAGTG ATAAACGTGG CGATATTGAG CGCAATTCGA CGCTGGCATT TTCGCGATGG TGCGTCGATT CGGGAAATAG CCCGACGAAG 7500
CGGCCTGTCC AGGAACACCG TTCGCAAGTA TTTGCAAAGC AAGGTGGTTG AACCGCAGTA CCCAGCGCGA GACAGCGTTG GCAAGTTAAG TCCTTTTGAG 7600
CCCAAGTTAA GGCAGTGGCT CTCCACCGAG CACAAAAAGA CAAAGAAGCT GCGCAGAAAC CTGCGCAGCA TGTACCGGGA TTTGGTCGCT TTGGGCTTTA 7700
CCGGGTCTTA TGACCGAGTG TGTGCCTTTG CCCGACAGTG GAAAGATTCC GAACAGTTCA AGGCGCAAAC CTCGGGCAAG GGTTGTTTCA TCCCCTTGCG 7800
CTTTGCTTGT GGCGAAGCCT TCCAATTCGA TTGGAGTGAG GACTTTGCCC GCATAGCGGG CAAACAGGTC AAACTTCAGA TTGCCCAGTT TAAGTTGGCC 7900
CACAGCCGGG CCTTTGTGCT TCGGGCTTAC TACCAGCAAA AACATGAAAT GCTGTTTGAT GCCCACTGGC ATGCCTTTCA AATCTTCGGT GGCATTCCCA 8000
AGCGCGGCAT CTACGACAAC ATGAAGACCG CTGTGGATTC GGTGGGGCGT GGCAAAGAGC GCAGGGTCAA TCAGCGGTTC ACTGCCATGG TCAGCCACTA 8100
CCTGTTTGAT GCGCAGTTCT GTAATCCAGC ATCGGGTTGG GAGAAAGGCC AGATTGAGAA GAACGTGCAG GATTCCCGCC AACGCCTGTG GCAAGGGGCA 8200
CCAGACTTTC AAAGCCTTGC TGATTTGAAT GTGTGGCTTG AGCATCGCTG CAAAGCGCTG TGGTCTGAGC TGCGCCACCC CGAATTGGAC CAAACCGTGC 8300
AAGAGGCCTT TGCCGATGAA CAAGGCGAGT TGATGGCGCT ACCCAATGCC TTTGATGCAT TCGTGGAGCA AACCAAGCGA GTCACTTCAA CCTGCCTTGT 8400
TCACCACGAG GGCAATCGCT ACAGCGTTCC TGCCAGTTAC GCCAACAGGG CCATCAGCCT TCGGATTTAT GCAGACAAGC TGGTGATGGC TGCCGAAGGC 8500
CAACACATTG CCGAGCATCC AAGATTGTTT GGCAGTGGCC ACGCTCGGCG TGGCCACACA CAATACGACT GGCACCATTA CTTGTCTGTG CTTCAGAAGA 8600
AACCTGGGGC GTTGCGCAAT GGTGCGCCAT TTGCTGAATT GCCACCCGCG TTCAAGAAGC TTCAATCCAT CTTGCTGCAA CGCCCCGGCG GTGACCGTGA 8700
CATGGTGGAA ATTCTGGCCC TTGTATTGCA CCACGATGAA GGTGCGGTAC TCAGTGCTGT GGAATTGGCA TTGGAGTGTG GCAAGCCATC GAAGGAGCAT 8800
GTGCTTAATC TGTTGGGACG TTTGACCGAA GAACCTCCAC CCAAACCGAT TCCAATTCCC AAGGGGTTAA GGCTGACATT GGAACCACAG GCCAACGTGA 8900
ACCGCTATGA CAGTTTAAGG AGAGCCCATG ATGCAGCATG AAGGCCATGT GAGAATCCTC AAATCCTTGA AACTCTTTGG CATGGCACAC GCCATTGAGG 9000
AGTTGGGCAA TCAGAATTCA CCAGCATTTA ATCAAGCCTT GCCCATGCTG GACAGCTTGA TTAAAGCTGA AGTGGCAGAG CGTGAAGTAC GTTCGGTGAA 9100
CTATCAATTG CGGGTGGCCA AGTTCCCCGT GTATCGGGAC TTGGTGGGCT TTGACTTCAG TCAAAGCCTG GTTAATGAGG CCACGGTCAA ACAATTGCAC 9200
CGGTGCGACT TCATGGAACA AGCCCAGAAC GTGGTGCTGA TTGGTGGGCC AGGCACAGGC AAGACTCACC TGGCCACAGC CATTGGTACA CAAGCAGTGA 9300
TGCACTTGAA CCGACGGGTG CGTTTCTTCT CCACCGTGGA TTTGGTCAAT GCACTGGAGC AAGAGAAATC ATCTGGGCGT CAGGGACAAA TCGCAAACCG 9400
TCTGTTGTAT GCCGATTTGG TGATTCTGGA TGAGCTGGGA TATTTGCCTT TTAGCCAAAC CGGTGGGGCA CTGCTGTTTC ACCTGCTCTC AAAGCTGTAC 9500
GAAAAAACCA GCGTGATACT GACCACCAAC TTGAGCTTCT CGGAATGGAG CCGAGTGTTT GGCGATGAAA AGATGACAAC AGCGTTGTTG GACCGACTAA 9600
CCCACCACTG CCACATCCTG GAAACCGGCA ATGAAAGTTA CCGCTTCAAA CACAGTTCAA CTCAGAATAA GCAGGAGGAA AAACAGACCC GCAAACTGAA 9700
AATCGAGACA TAATTCTGAC AACAAGGGGT GGGTCAAAAT TCAATGCAAA TCCCGGGTCA AATTTGGGTG CAAATCAACA GATATCGACA ACCTCTCGCG 9800
CAACCAAGAC ATCGCGGTCG GACTGCAAGT GATCTTGAAG CCACGGGCCC GTCCCACCCC GACATGGACC TCGATGCCCG AACGGACGTT AGATTTCGAG 9900
TTCTAGGCGT TCTGCGATGA AGGTTGGATC CCAGCCGGGA TTGAAAGTGT CGACGTGGGT GAATCCGAGC CGCTCGTATA GGCCACGCAG GTTCGGGTGG 10000
CAGTCGAGCC GCAGCTTGGC GCACCCCTGC GTTCGCGCGG CATGGCGGCA AGCCTCGATC AGCGCGGAGC TGACACCCCG GCCCGCATGT GTCCGTCGCA 10100
CCGCGAGCTT GTGCAGATAT GCGGCCTCCC CCTTGAGGGC GTCGGGCCAG AACTCGGGAT CCTCGGCCGA CAAGGTGCAA CAGCCGACGA TGCCGTCGCT 10200
GCAACTCGCG ACTAGGAGCT CGGATCTCAG GACGAAGGTC TCCGCGAATG TCCGGTCGAT CCGCGCGACG TCCCAGGCGG GCGTTCCCTT GGCGGACATC 10300
CACGCCGCAG CGTCGTGCAT CAGCCGCACA ACCTCGTCGA TATCACCCGA GCAGGCGACC CGAACGTTCG GAGGCTCCTC GCTGTCCATT CGCTCCCCTG 10400
GCGCGGTATG AACCGCCGCC TCATAGTGCA GTTTGATCCT GACGAGCCCA GCATGTCTGC GCCCACCTTC GCGGAACCTG ACCAGGGTCC GCTAGCGGGC 10500
GGCCGGAAGG TGAATGCTAG GCATGATCTA ACCCTCGGTC TCTGGCGTCG CGACTGCGAA ATTTCGCGAG GGTTTCCGAG AAGGTGATTG CGCTTCGCAG 10600
ATCTCCAGGC GCGTGGGTGC GGACGTAGTC AGCGCCATTG CCGATCGCGT GAAGTTCCGC CGCAAGGCTC GCTGGACCCA GATCCTTTAC AGGAAGGCCA 10700
ACGGTGGCGC CCAAGAAGGA TTTCCGCGAC ACCGAGACCA ATAGCGGAAG CCCCAACGCC GACTTCAGCT TTTGAAGGTT CGACAGCACG TGCAGCGATG 10800
TTTCCGGTGC GGGGCTCAAG AAAAATCCCA TCCCCGGATC GAGGATGAGC CGGTCGGCAG CGACCCCGCT CCGTCGCAAG GCGGAAACCC GCGCCTCGAA 10900
GAACCGCACA ATCTCGTCGA GCGCGTCTTC GGGTCGAAGG TGACCGGTGC GGGTGGCGAT GCCATCCCGC TGCGCTGAGT GCATAACCAC CAGCCTGCAG 11000
TCCGCCTCAG CAATATCGGG ATAGAGCGCA GGGTCAGGAA ATCCTTGGAT ATCGTTCAGG TAGCCCACGC CGCGCTTGAG CGCATAGCGC TGGGTTTCCG 11100
GTTGGAAGCT GTCGATTGAA ACACGGTGCA TCTGATCGGA CAGGGCGTCT AAGAGCGGCG CAATACGTCT GATCTCATCG GCCGGCGATA CAGGCCTCGC 11200
GTCCGGATGG CTGGCGGCCG GTCCGACATC CACGACGTCT GATCCGACTC GCAGCATTTC GATCGCCGCG GTGACAGCGC CGGCGGGGTC TAGCCGCCGG 11300
CTCTCATCGA AGAAGGAGTC CTCGGTGAGA TTCAGAATGC CGAACACCGT CACCATGGCG TCGGCCTCCG CAGCGACTTC CACGATGGGG ATCGGGCGAG 11400
CAAAAAGGCA GCAATTATGA GCCCCATACC TACAAAGCCC CACGCATCAA GCTTTTGCCC ATGAAGCAAC CAGGCAATGG CTGTAATTAT GACGACGCCG 11500
AGTCCCGACC AGACTGCATA AGCAACACCG ACAGGGATGG ATTTCAGAAC CAGAGAAAGA AAATAAAATG CGATGCCATA ACCGATTATG ACAACGGCGG 11600
AAGGGGCAAG CTTAGTAAAG CCCTCGCTAG ATTTTAATGC GGATGTTGCG ATTACTTCGC CAACTATTGC GATAACAAGA AAAAGCCAGC CTTTCATGAT 11700
ATATCTCCCA ATTTGTGTAG GGCTTATTAT GCACGCTTAA AAATAATAAA AGCAGACTTG ACCTGATAGT TTGGCTGTGA GCAATTATGT GCTTAGTGCA 11800
TCTAACGCTT GAGTTAAGCC GCGCCGCGAA GCGGCGTCGG CTTGAACGAA TTGTTAGACA TTATTTGCCG ACTACCTTGG TGATCTCGCC TTTCACGTAG 11900
TGGACAAATT CTTCCAACTG ATCTGCGCGC GAGGCCAAGC GATCTTCTTC TTGTCCAAGA TAAGCCTGTC TAGCTTCAAG TATGACGGGC TGATACTGGG 12000
CCGGCAGGCG CTCCATTGCC CAGTCGGCAG CGACATCCTT CGGCGCGATT TTGCCGGTTA CTGCGCTGTA CCAAATGCGG GACAACGTAA GCACTACATT 12100
TCGCTCATCG CCAGCCCAGT CGGGCGGCGA GTTCCATAGC GTTAAGGTTT CATTTAGCGC CTCAAATAGA TCCTGTTCAG GAACCGGATC AAAGAGTTCC 12200
TCCGCCGCTG GACCTACCAA GGCAACGCTA TGTTCTCTTG CTTTTGTCAG CAAGATAGCC AGATCAATGT CGATCGTGGC TGGCTCGAAG ATACCTGCAA 12300
GAATGTCATT GCGCTGCCAT TCTCCAAATT GCAGTTCGCG CTTAGCTGGA TAACGCCACG GAATGATGTC GTCGTGCACA ACAATGGTGA CTTCTACAGC 12400
GCGGAGAATC TCGCTCTCTC CAGGGGAAGC CGAAGTTTCC AAAAGGTCGT TGATCAAAGC TCGCCGCGTT GTTTCATCAA GCCTTACGGT CACCGTAACC 12500
AGCAAATCAA TATCACTGTG TGGCTTCAGG CCGCCATCCA CTGCGGAGCC GTACAAATGT ACGGCCAGCA ACGTCGGTTC GAGATGGCGC TCGATGACGC 12600
CAACTACCTC TGATAGTTGA GTCGATACTT CGGCGATCAC CGCTTCCCTC ATGATGTTTA ACTTTGTTTT AGGGCGACTG CCCTGCTGCG TAACATCGTT 12700
GCTGCTCCAT AACATCAAAC ATCGACCCAC GGCGTAACGC GCTTGCTGCT TGGATGCCCG AGGCATAGAC TGTACCCCAA AAAAACAGTC ATAACAAGCC 12800
ATGAAAACCG CCACTGCGCC GTTACCACCG CTGCGTTCGG TCAAGGTTCT GGACCAGTTG CGTGAGCGCA TACGCTACTT GCATTACAGC TTACGAACCG 12900
AACAGGCTTA TGTCCACTGG GTTCGTGCCT TCATCCGTTT CCACGGTGTG CGTCACCCGG CAACCTTGGG CAGCAGCGAA GTCGAGGCAT TTCTGTCCTG 13000
GCTGGCGAAC GAGCGCAAGG TTTCGGTCTC CACGCATCGT CAGGCATTGG CGGCCTTGCT GTTCTTCTAC GGCAAGGTGC TGTGCACGGA TCTGCCCTGG 13100
CTTCAGGAGA TCGGAAGACC TCGGCCGTCG CGGCGCTTGC CGGTGGTGCT GACCCCGGAT GAAGTGGTTC GCATCCTCGG TTTTCTGGAA GGCGAGCATC 13200
GTTTGTTCGC CCAGCTTCTG TATGGAACGG GCATGCGGAT CAGTGAGGGT TTGCAACTGC GGGTCAAGGA TCTGGATTTC GATCACGGCA CGATCATCGT 13300
GCGGGAGGGC AAGGGCTCCA AGGATCGGGC CTTGATGTTA CCCGAGAGCT TGGCACCCAG CCTGCGCGAG CAGCTGTCGC GTGCACGGGC ATGGTGGCTG 13400
AAGGACCAGG CCGAGGGCCG CAGCGGCGTT GCGCTTCCCG ACGCCCTTGA GCGGAAGTAT CCGCGCGCCG GGCATTCCTG GCCGTGGTTC TGGGTTTTTG 13500
CGCAGCACAC GCATTCGACC GATCCACGGA GCGGTGTCGT GCGTCGCCAT CACATGTATG ACCAGACCTT TCAGCGCGCC TTCAAACGTG CCGTAGAACA 13600
AGCAGGCATC ACGAAGCCCG CCACACCGCA CACCCTCCGC CACTCGTTCG CGACGGCCTT GCTCCGCAGC GGTTACGACA TTCGAACCGT GCAGGATCTG 13700
CTCGGCCATT CCGACGTCTC TACGACGATG ATTTACACGC ATGTGCTGAA AGTTGGCGGT GCCGGAGTGC GCTCACCGCT TGATGCGCTG CCGCCCCTCA 13800
CTAGTGAGAG GTAGGGCAGC GCAAGTCAAT CCTGGCGGAT TCACTACCCC TGCGCGAAGG CCATCGGTGC CGCATCGAAC GGCCGGTTGC GGAAAGTCCT 13900
CCCTGCGTCC GCTGATGGCC GGCAGCAGCC CGTCGTTGCC TGATGGATCC AACCCCTCCG CTGCTATAGT GCAGTCGGCT TCTGACGTTC AGTGCAGCCG 14000
TCTTCTGAAA ACGACAATGG AGGTGGTAGC CGAGGGTGTG GAAACACCCG ACTGCCTTGC GTGGTTGCGG CAGGCGGGTT GCGACACGGT GCAGGGTTTC 14100
CTGTTCGCCA GGCCGATGCC GGCGGCGGCC TTCGTCGGCT TCGTCAACCA ATGGAGGAAC ACCACCATGA ACGCCAATGA ACCGAGCACC AGTTGCTGCG 14200
TGTGCTGCAA GGAAATCCCG CTCGATGCCG CCTTCACGCC GGAAGGGGCC GAGTACGTGG AGCATTTCTG CGGGCTGGAG TGCTATCAGC GCTTCCAGGC 14300
GCGGGCCAGC ACTGCGACCG AAACCAGCGT CAAACCGGAC GCTTGTGATT CGCCGCCGTC AGGTTGAGGC ATACCCTAAC CTGATGTCAG ATGCCATGTG 14400
TAAATTGCGT CAGGATAGGA TTGAATTTTG AATTTATTGA CATATCTCGT TGAAGGTCAT AGAGTCTTCC CTGACATTTT GCAGGGAATT CCATGACTGG 14500
ACAGCGCATT GGGTATATCA GGGTCAGCAC CTTCGACCAG AACCCGGAAC GGCAACTGGA AGGCGTCAAG GTTGATCGCG CTTTTAGCGA CAAGGCATCC 14600
GGCAAGGATG TCAAGCGTCC GCAACTGGAA GCGCTGATAA GCTTCGCCCG CACCGGCGAC ACCGTGGTGG TGCATAGCAT GGATCGCCTG GCGCGCAATC 14700
TCGATGATTT GCGCCGGATC GTGCAAACGC TGACACAACG CGGCGTGCAT ATCGAATTCG TCAAGGAACA CCTCAGTTTT ACTGGCGAAG ACTCTCCGAT 14800
GGCGAACCTG ATGCTCTCGG TGATGGGCGC GTTCGCCGAG TTCGAGCGCG CCCTGATCCG CGAGCGTCAG CGCGAGGGTA TTGCGCTCGC CAAGCAACGC 14900
GGGGCTTACC GTGGCAGGAA GAAATCCCTG TCGTCTGAGC GTATTGCCGA ACTGCGCCAA CGTGTCGAGG CTGGCGAGCA AAAGACCAAG CTTGCTCGTG 15000
AATTCGGAAT CAGTCGCGAA ACCCTGTATC AATACTTGAG AACGGATCAG TAAATATGCC ACGTCGTTCC ATCCTGTCCG CCGCCGAGCG GGAAAGCCTG 15100
CTGGCGTTGC CGGACTCCAA GGACGACCTG ATCCGACATT ACACATTCAA CGATACCGAC CTCTCGATCA TCCGACAGCG GCGCGGGCCA GCCAATCGGC 15200
TGGGCTTCGC GGTGCAGCTC TGTTACCTGC GCTTTCCCGG CGTCATCCTG GGCGTCGATG AACTACCGTT CCCGCCCTTG TTGAAGCTGG TCGCCGACCA 15300
GCTCAAGGTC GGCGTCGAAA GCTGGAACGA GTACGGCCAG CGGGAGCAGA CCCGGCGCGA GCACCTGAGC GAGCTGCAAA CCGTGTTCGG TTTCCGGCCC 15400
TTCACCATGA GCCATTACCG GCAGGCCGTC CAGATGCTGA CCGAGCTGGC GATGCAAACC GACAAAGGCA TCGTGCTGGC CAGCGCCTTG ATCGGGCACC 15500
TGCGGCGGCA GTCGGTCATT CTGCCCGCCC TCAACGCCGT CGAGCGGGCG AGTGCCGAGG CGATCACCCG TGCTAACCGG CGCATCTACG ACGCCTTGGC 15600
CGAACCACTG GCGGACGCGC ATCGCCGCCG CCTCGACGAT CTGCTCAAGC GCCGGGACAA CGGCAAGACG ACCTGGTTGG CTTGGTTGCG CCAGTCTCCG 15700
GCCAAGCCAA ATTCGCGGCA TATGCTGGAA CACATCGAAC GCCTCAAGGC ATGGCAGGCA CTCGATCTGC CTACCGGCAT CGAGCGGCTG GTTCACCAGA 15800
ACCGCCTGCT CAAGATTGCC CGCGAGGGCG GCCAGATGAC ACCCGCCGAC CTGGCCAAAT TCGAGCCGCA ACGGCGCTAC GCCACTCTCG TGGCGCTGGC 15900
CACCGAGGGC ATGGCCACCG TCACCGACGA AATCATCGAC CTGCACGACC GCATCCTGGG TAAGCTGTTT AACGCTGCCA AGAATAAGCA TCAGCAGCAG 16000
TTCCAGGCGT CAGGCAAGGC CATCAACGCC AAGGTACGTC TGTACGGGCG CATCGGTCAG GCGCTGATCG ACGCCAAGCA ATCAGGCCGC GATGCGTTTG 16100
CCGCCATCGA GGCCGTCATG TCCTGGGATT CCTTTGCCGA GAGCGTCACC GAGGCGCAGA AGCTCGCGCA ACCCGATGAC TTCGATTTCC TGCATCGCAT 16200
CGGCGAGAGC TACGCCACCC TGCGCCGCTA TGCACCGGAA TTCCTTGCCG TGCTCAAGCT GCGGGCCGCG CCCGCCGCCA AAAACGTGCT TGATGCCATT 16300
GAGGTGCTGC GCGGCATGAA CACCGACAAC GCCCGCAAGC TGCCAGCCGA TGCACCGACC GGCTTCATCA AGCCGCGCTG GCAGAAACTG GTGATGACCG 16400
ACGCCGGCAT CGACCGGCGC TACTACGAAC TGTGCGCGCT GTCCGAGTTG AAGAACTCCC TGCGCTCGGG CGACATCTGG GTGCAGGGTT CACGCCAGTT 16500
CAAGGACTTC GAGGACTACC TGGTACCGCC CGAGAAGTTC ACCAGCCTCA AGCAGTCCAG CGAATTGCCG CTGGCCGTGG CCACCGACTG CGAACAATAT 16600
CTGCATGAGC GGCTGACGCT GCTGGAAGCA CAACTTGCCA CCGTCAACCG CATGGCGGCA GCCAACGACC TGCCGGATGC CATCATCACC GAGTCGGGCT 16700
TGAAGATCAC GCCGCTGGAT GCGGCGGTGC CCGACACCGC GCAGGCGCTG ATAGACCAGA CAGCCATGGT CCTGCCGCAC GTCAAGATCA CCGAACTGCT 16800
GCTCGAAGTC GATGAGTGGA CGGGCTTCAC CCGGCACTTC ACGCACTTGA AATCGGGCGA TCTGGCCAAG GACAAGAACC TGTTGTTGAC CACGATCCTG 16900
GCCGACGCGA TCAACCTGGG CCTGACCAAG ATGGCCGAGT CCTGCCCCGG CACGACCTAC GCGAAGCTCG CTTGGCTGCA AGCCTGGCAT ACCCGCGACG 17000
AAACGTACTC GACAGCGTTG GCTGAACTGG TCAACGCTCA GTTTCGGCAT CCCTTTGCCG GGCACTGGGG CGATGGCACC ACATCATCAT CGGACGGACA 17100
GAATTTCCGA ACCGCTAGCA AGGCAAAGAG CACGGGGCAC ATCAACCCAA AATATGGCAG CAGCCCAGGA CGGACTTTCT ACACCCACAT CTCCGACCAA 17200
TACGCGCCAT TCCACACCAA GGTGGTCAAT GTCGGCCTGC GCGACTCAAC CTACGTGCTC GACGGCCTGC TGTACCACGA ATCCGACCTG CGGATCGAGG 17300
AGCACTACAC CGACACGGCG GGCTTCACCG ATCACGTCTT CGCCCTGATG CACCTCTTGG GCTTCCGCTT CGCGCCGCGC ATCCGCGACC TGGGCGACAC 17400
CAAGCTCTAC ATCCCGAAGG GCGATGCCGC CTATGACGCG CTCAAGCCGA TGATCGGCGG CACGCTCAAC ATCAAGCACG TCCGCGCCCA TTGGGACGAA 17500
ATCCTGCGGC TGGCCACCTC GATCAAGCAG GGCACGGTGA CGGCCTCGCT GATGCTCAGG AAACTCGGCA GCTACCCGCG CCAGAACGGC TTGGCCGTCG 17600
CGCTGCGCGA GTTGGGCCGC ATCGAGCGCA CGCTGTTCAT CCTCGACTGG CTGCAAAGCG TCGAGCTACG CCGCCGCGTG CATGCCGGGC TGAACAAGGG 17700
CGAGGCGCGC AATGCGCTGG CCCGTGCCGT GTTCTTCAAC CGCCTTGGTG AAATCCGTGA CCGCAGTTTC GAGCAGCAGC GCTACCGGGC CAGCGGCCTC 17800
AACCTGGTGA CGGCGGCCAT CGTGCTGTGG AACACGGTCT ACCTGGAGCG TGCGGCGCAT GCGTTGCGCG GCAATGGTCA TGCCGTCGAT GACTCGCTAT 17900
TGCAGTACCT GTCGCCACTC GGCTGGGAGC ACATCAACCT GACCGGTGAT TACCTATGGC GCAGCAGCGC CAAGATCGGC GCGGGGAAGT TCAGGCCGCT 18000
ACGGCCTCTG CAACCGGCTT AGCGTGCTTT ATTTTCCGTT TTCTGAGACG ACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
attC qacH_sul1 core 10489-10522 34 CCGCTAGCGG GCGGCCGGAA GGTGAATGCT AGGC
attC aadA1a core 11806-11859 54 CGCTTGAGTT AAGCCGCGCC GCGAAGCGGC GTCGGCTTGA ACGAATTGTT AGAC
attI 12662-12717 56 CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCA
res 14352-14482 131 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAGA TGCCATGTGT AAATTGCGTC
AGGATAGGAT TGAATTTTGA ATTTATTGAC ATATCTCGTT GAAGGTCATA GAGTCTTCCC
TGACATTTTG C
res_site_I 14352-14390 39 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAG
res_site_II 14404-14447 44 ATTGCGTCAG GATAGGATTG AATTTTGAAT TTATTGACAT ATCT
res_site_III 14451-14482 32 TGAAGGTCAT AGAGTCTTCC CTGACATTTT GC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn2411 33-467 Passenger Gene Heavy Metal Resistance -
merT Tn2411 539-889 Passenger Gene Heavy Metal Resistance +
merP Tn2411 903-1178 Passenger Gene Heavy Metal Resistance +
merC Tn2411 1214-1636 Passenger Gene Heavy Metal Resistance +
merA Tn2411 1688-3382 Passenger Gene Heavy Metal Resistance +
merD Tn2411 3400-3762 Passenger Gene Heavy Metal Resistance +
merE Tn2411 3759-3995 Passenger Gene Heavy Metal Resistance +
urfM 5'-end Tn2411 3992-4662 Passenger Gene Other +
tniA In_Tn4 4774-6453 Transposase   +
tniB delta1 In_Tn4 6456-7316 Accessory Gene   +
istA IS1326 7418-8941 Transposase   +
istB IS1326 8928-9713 Accessory Gene ATPase Transposition Helper +
GNAT_fam In_Tn4 9889-10389 Passenger Gene Antibiotic Resistance -
sul1 (ARO:3000410) In2 10517-11356 Passenger Gene Antibiotic Resistance -
qacEdelta1 (ARO:3005010) In_Tn4 11350-11697 Passenger Gene Antibiotic Resistance -
aadA (ARO:3002601) In_Tn4 11861-12652 Passenger Gene Antibiotic Resistance -
intI1 In_Tn4 12801-13814 Integron Integrase Class 1 +
tnpM Tn2411 14017-14367 Accessory Gene Inhibitor +
tnpR Tn2411 14493-15053 Accessory Gene Resolvase +
tnpA Tn21 15056-18022 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn2411 435 33-467 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLREPDKPY GSIRRYGEAD VVRVKFVKSA QRLGFSLDEI AELLRLDDGT HCEEASSLAE HKLKDVREKM
ADLARMETVL SELVCACHAR KGNVSCPLIA SLQGEAGLAR SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn2411 351 539-889 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPQNGRGA LFAGGLAAIL ASTCCLGPLV LVALGFSGAW IGNLTVLEPY RPLFIGAALV ALFFAWKRIY RPVQACKPGE VCAIPQVRAT YKLIFWIVAV
LVLVALGFPY VVPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn2411 276 903-1178 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFASLAL AAAVAPVWAA TQTVTLAVPG MTCAACPITV KKALSKVEGV SKVDVGFEKR EAVVTFDDTK ASVQKLTKAT ADAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn2411 423 1214-1636 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   transmembrane protein mercury transport
Target:   Mercury
Protein Sequence:  
MGLMTRIADK TGALGSVVSA MGCAACFPAL ASFGAAIGLG FLSQYEGLFI SRLLPLFAAL AFLANALGWF SHRQWLRSLL GMIGPAIVFA ATVWLLGNWW
TANLMYVGLA LMIGVSIWDF VSPAHRRCGP DGCELPAKRL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn2411 1695 1688-3382 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MSTLKITGMT CDSCAVHVKD ALEKVPGVQS ADVSYAKGSA KLAIEVGTSP DALTAAVAGL GYRATLADAP SVSTPGGLLD KMRDLLGRND KTGSSGALHI
AVIGSGGAAM AAALKAVEQG ARVTLIERGT IGGTCVNVGC VPSKIMIRAA HIAHLRRESP FDGGIAATTP TIQRTALLAQ QQARVDELRH AKYEGILEGN
PAITVLHGSA RFKDNRNLIV QLNDGGERVV AFDRCLIATG ASPAVPPIPG LKDTPYWTST EALVSETIPK RLAVIGSSVV ALELAQAFAR LGAKVTILAR
STLFFREDPA IGEAVTAAFR MEGIEVREHT QASQVAYING EGDGEFVLTT AHGELRADKL LVATGRAPNT RKLALDATGV TLTPQGAIVI DPGMRTSVEH
IYAAGDCTDQ PQFVYVAAAA GTRAAINMTG GDAALNLTAM PAVVFTDPQV ATVGYSEAEA HHDGIKTDSR TLTLDNVPRA LANFDTRGFI KLVVEEGSGR
LIGVQAVAPE AGELIQTAAL AIRNRMTVQE LADQLFPYLT MVEGLKLAAQ TFNKDVKQLS CCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn2411 363 3400-3762 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MSAYTVSQLA HNAGVSVHIV RDYLVRGLLR PVACTTGGYG VFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGAQ AAAQLAVLRQ LVERRRAALA
HLDAQLASMP AERAHEEALP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn2411 237 3759-3995 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Comment:   similar to urf-1 in pKLH2 (GenBank AF213017), pKLH272 (Genbank Y08992), pMER610 (GenBank Y08993), pKLH210 (GenBank Y10102), Tn5036 (Genbank Y09025), orf1 in Tn501 (GenBank Z00027), and urf-1 in Tn5041 (GenBank X98999)
Protein Sequence:  
MNAPDKLPPE TRQPVSGYLW GALAVLTCPC HLPILAAVLA GTTAGAFLGE HWGVAALALT GLFVLAVTRL LRAFRGGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM 5'-end N Tn2411 671 3992-4662 +
Class:   Passenger Gene
Sub Class:   Other
Comment:   urfM ORF interrupted by insertion of In2
Protein Sequence:  
MTSSQPAGWT AAELAQAAAR GQLDLHYQPL VDLRDHRIAG AEALMRWRHP RLGLLPPGQF LPLAESFGLM PEIGAWVLGE ACRQMHKWQG PAWQPFRLAI
NVSASQVGPT FDDEVKRVLA DMALPAELLE IELTESVAFG NPALFASFDA LRAIGVRFAA DDFGTGYSCL QHLKCCPITT LKIDQSFVAR LPDDARDQTI
VRAVIQLAHG LGMDVIFRRR LHQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA In_Tn4 1680 4774-6453 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   can be extended upstream by 12 amino acids| identical to tniA (Tn1721 and In2)| 25% amino acid sequence identity to TnsB from Tn7
Protein Sequence:  
MATDTPRIPE QGVATLPDEA WERARRRAEI ISPLAQSETV GHEAADMAAQ ALGLSRRQVY VLIRRARQGS GLVTDLVPGQ SGGGKGKGRL PEPVERVIHE
LLQKRFLTKQ KRSLAAFHRE VTQVCKAQKL RVPARNTVAL RIASLDPRKV IRRREGQDAA RDLQGVGGEP PAVTAPLEQV QIDHTVIDLI VVDDRDRQPI
GRPYLTLAID VFTRCVLGMV VTLEAPSAVS VGLCLVHVAC DKRPWLEGLN VEMDWQMSGK PLLLYLDNAA EFKSEALRRG CEQHGIRLDY RPLGQPHYGG
IVERIIGTAM QMIHDELPGT TFSNPDQRGD YDSENKAALT LRELERWLTL AVGTYHGSVH NGLLQPPAAR WAEAVARVGV PAVVTRATSF LVDFLPILRR
TLTRTGFVID HIHYYADALK PWIARRERWP SFLIRRDPRD ISRIWVLEPE GQHYLEIPYR TLSHPAVTLW EQRQALAKLR QQGREQVDES ALFRMIGQMR
EIVTSAQKAT RKARRDADRR QHLKTSARPD KPVPPDTDIA DPQADNLPPA KPFDQIEEW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB delta1 TniB delta1 In_Tn4 861 6456-7316 +
Class:   Accessory Gene
Function:   probable ATP-binding protein.
Comment:   probably truncated by insertion of IS1326::IS1353
Protein Sequence:  
MDEYPIIDLS HLLPAAQGLA RLPADERIQR LRADRWIGYP RAVEALNRLE ALYAWPNKQR MPNLLLVGPT NNGKSMIVEK FRRTHPASSD ADQEHIPVLV
VQMPSEPSVI RFYVALLAAM GAPLRPRPRL PEMEQLALAL LRKVGVRMLV IDELHNVLAG NSVNRREFLN LLRFLGNELR IPLVGVGTRD AYLAIRSDDQ
LENRFEPMML PVWEANDDCC SLLASFAASL PLRRPSPIAT LDMARYLLTR SEGTIGELAH LLMAAAIVAV ESGEEAINHR TLSMAC

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istA IstA IS1326 1524 7418-8941 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MINVAILSAI RRWHFRDGAS IREIARRSGL SRNTVRKYLQ SKVVEPQYPA RDSVGKLSPF EPKLRQWLST EHKKTKKLRR NLRSMYRDLV ALGFTGSYDR
VCAFARQWKD SEQFKAQTSG KGCFIPLRFA CGEAFQFDWS EDFARIAGKQ VKLQIAQFKL AHSRAFVLRA YYQQKHEMLF DAHWHAFQIF GGIPKRGIYD
NMKTAVDSVG RGKERRVNQR FTAMVSHYLF DAQFCNPASG WEKGQIEKNV QDSRQRLWQG APDFQSLADL NVWLEHRCKA LWSELRHPEL DQTVQEAFAD
EQGELMALPN AFDAFVEQTK RVTSTCLVHH EGNRYSVPAS YANRAISLRI YADKLVMAAE GQHIAEHPRL FGSGHARRGH TQYDWHHYLS VLQKKPGALR
NGAPFAELPP AFKKLQSILL QRPGGDRDMV EILALVLHHD EGAVLSAVEL ALECGKPSKE HVLNLLGRLT EEPPPKPIPI PKGLRLTLEP QANVNRYDSL
RRAHDAA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istB IstB IS1326 786 8928-9713 +
Class:   Accessory Gene
Sub Class:   ATPase Transposition Helper
Function:   stimulates transposition
Protein Sequence:  
MMQHEGHVRI LKSLKLFGMA HAIEELGNQN SPAFNQALPM LDSLIKAEVA EREVRSVNYQ LRVAKFPVYR DLVGFDFSQS LVNEATVKQL HRCDFMEQAQ
NVVLIGGPGT GKTHLATAIG TQAVMHLNRR VRFFSTVDLV NALEQEKSSG RQGQIANRLL YADLVILDEL GYLPFSQTGG ALLFHLLSKL YEKTSVILTT
NLSFSEWSRV FGDEKMTTAL LDRLTHHCHI LETGNESYRF KHSSTQNKQE EKQTRKLKIE T

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
GNAT_fam GNAT_fam In_Tn4 501 9889-10389 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  Acetyltransf_1 (Pfam:PF00583)
Comment:   putative acetyltransferase ADU64769.1
Protein Sequence:  
MDSEEPPNVR VACSGDIDEV VRLMHDAAAW MSAKGTPAWD VARIDRTFAE TFVLRSELLV ASCSDGIVGC CTLSAEDPEF WPDALKGEAA YLHKLAVRRT
HAGRGVSSAL IEACRHAART QGCAKLRLDC HPNLRGLYER LGFTHVDTFN PGWDPTFIAE RLELEI

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
sul1 (ARO:3000410) Sul1 In2 840 10517-11356 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Transpoase Chemistry:   dihydropteroate synthase
Target:   sulfonamide antibiotic (ARO:3000282)||sulfone antibiotic (ARO:3003401)
Sequence Family:  sulfonamide resistant sul (ARO:3004238)
Comment:   perfect match to reference sequence for ARO:3000410
Protein Sequence:  
MVTVFGILNL TEDSFFDESR RLDPAGAVTA AIEMLRVGSD VVDVGPAASH PDARPVSPAD EIRRIAPLLD ALSDQMHRVS IDSFQPETQR YALKRGVGYL
NDIQGFPDPA LYPDIAEADC RLVVMHSAQR DGIATRTGHL RPEDALDEIV RFFEARVSAL RRSGVAADRL ILDPGMGFFL SPAPETSLHV LSNLQKLKSA
LGLPLLVSVS RKSFLGATVG LPVKDLGPAS LAAELHAIGN GADYVRTHAP GDLRSAITFS ETLAKFRSRD ARDRGLDHA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacEdelta1 (ARO:3005010) QacEdelta1 In_Tn4 348 11350-11697 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   acridine dye (ARO:3000054)||quaternary ammonium salts
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Comment:   subunit of the qac multidrug efflux pump||perfect match to reference sequence for ARO:3005010 (bitscore:219)
Protein Sequence:  
MKGWLFLVIA IVGEVIATSA LKSSEGFTKL APSAVVIIGY GIAFYFLSLV LKSIPVGVAY AVWSGLGVVI ITAIAWLLHG QKLDAWGFVG MGLIIAAFLL
ARSPSWKSLR RPTPW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aadA (ARO:3002601) AadA In_Tn4 792 11861-12652 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Transpoase Chemistry:   aminoglycoside nucleotidyltransferase
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  ANT(3'') (ARO:3004275)
Comment:   perfect match to reference sequence for ARO:3002601||Synonyms: aadA1-pm, aadA, aadA1, aad(3'')(9)
Protein Sequence:  
MREAVIAEVS TQLSEVVGVI ERHLEPTLLA VHLYGSAVDG GLKPHSDIDL LVTVTVRLDE TTRRALINDL LETSASPGES EILRAVEVTI VVHDDIIPWR
YPAKRELQFG EWQRNDILAG IFEPATIDID LAILLTKARE HSVALVGPAA EELFDPVPEQ DLFEALNETL TLWNSPPDWA GDERNVVLTL SRIWYSAVTG
KIAPKDVAAD WAMERLPAQY QPVILEARQA YLGQEEDRLA SRADQLEEFV HYVKGEITKV VGK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 In_Tn4 1014 12801-13814 +
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LRTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpM TnpM Tn2411 351 14017-14367 +
Class:   Accessory Gene
Sub Class:   Inhibitor
Function:   transposition regulator; reported to enhance Tn21 transposition and suppress resolution of cointegrate replicons in vivo
Comment:   3'-end of urfM ORF, which is interrupted by insertion of In2||inhibits tranposition probably by inhibiting resolution
Protein Sequence:  
MEVVAEGVET PDCLAWLRQA GCDTVQGFLF ARPMPAAAFV GFVNQWRNTT MNANEPSTSC CVCCKEIPLD AAFTPEGAEY VEHFCGLECY QRFQARASTA
TETSVKPDAC DSPPSG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn2411 561 14493-15053 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   identical to tnpR (TnAs3 )
Protein Sequence:  
MTGQRIGYIR VSTFDQNPER QLEGVKVDRA FSDKASGKDV KRPQLEALIS FARTGDTVVV HSMDRLARNL DDLRRIVQTL TQRGVHIEFV KEHLSFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKSLSSER IAELRQRVEA GEQKTKLARE FGISRETLYQ YLRTDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn21 2967 15056-18022 +
Class:   Transposase
Function:   transposition, DNA-mediated (GO:0006313)
Transpoase Chemistry:   DDE
Comment:   identical to TnAs3 tnpA
Protein Sequence:  
MPRRSILSAA ERESLLALPD SKDDLIRHYT FNDTDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEL PFPPLLKLVA DQLKVGVESW NEYGQREQTR
REHLSELQTV FGFRPFTMSH YRQAVQMLTE LAMQTDKGIV LASALIGHLR RQSVILPALN AVERASAEAI TRANRRIYDA LAEPLADAHR RRLDDLLKRR
DNGKTTWLAW LRQSPAKPNS RHMLEHIERL KAWQALDLPT GIERLVHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LATEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLY GRIGQALIDA KQSGRDAFAA IEAVMSWDSF AESVTEAQKL AQPDDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKN VLDAIEVLRG MNTDNARKLP ADAPTGFIKP RWQKLVMTDA GIDRRYYELC ALSELKNSLR SGDIWVQGSR QFKDFEDYLV PPEKFTSLKQ
SSELPLAVAT DCEQYLHERL TLLEAQLATV NRMAAANDLP DAIITESGLK ITPLDAAVPD TAQALIDQTA MVLPHVKITE LLLEVDEWTG FTRHFTHLKS
GDLAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHTRDET YSTALAELVN AQFRHPFAGH WGDGTTSSSD GQNFRTASKA KSTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGLRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERAAHALRGN GHAVDDSLLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
In_Tn4-KY749247.1 In Integron 4633-14016 9384
IS1326-KY749247.1 IS1326 Insertion Sequence 7311-9780 2470

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
repeat i4 Tn2411 9-27 TCAGAAAACG GAAAATAAA
IRt In_Tn4 4633-4665 TGTCATTTTC AGAAGACGAC TGCACCAGTT GAT
repeat t1 In_Tn4 4641-4659 TCAGAAGACG ACTGCACCA
repeat t2 In_Tn4 4681-4699 AACACGTCGG TCGAGGACT
repeat t3 In_Tn4 4710-4729 TCAGAAGTGA TCTGCACCAA
repeat t4 In_Tn4 4742-4760 TCAATACTCG TGTGCACCA
IRL IS1326_IS1353 7311-7336 TGTTGAGTTG CATCTAAAAT TGACCC
IRR IS1326 9755-9780 CCCAGTTTAA ACCCACGTTT AGTTGT
repeat i4 In_Tn4 13897-13915 AGGAGGGACG CAGGCGACT
repeat i3 In_Tn4 13925-13943 CGTCGGGCAG CAACGGACT
repeat i2 In_Tn4 13967-13985 ATCACGTCAG CCGAAGACT
IRi In_Tn4 13984-14016 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 In_Tn4 13990-14008 GTCACGTCGG CAGAAGACT
IRR Tn2411 18015-18055 GCCGAATCGC ACGAAATAAA AGGCAAAAGA CTCTGCTGGG G

 References     

Chaudhuri RR, Sebaihia M, Hobman JL, Webber MA, Leyton DL, Goldberg MD, Cunningham AF, Scott-Tucker A, Ferguson PR, Thomas CM, Frankel G, Tang CM, Dudley EG, Roberts IS, Rasko DA, Pallen MJ, Parkhill J, Nataro JP, Thomson NR, Henderson IR. Complete genome sequence and comparative metabolic profiling of the prototypical enteroaggregative Escherichia coli strain 042. PLoS One. 2010 Jan 20;5(1):e8801. doi: 10.1371/journal.pone.0008801. PubMed ID: 20098708