Transposon
Name: Tn21.1
Family: Tn3        Group: Tn21
Evidence of Transposition: yes
 Host     

Host Organism:Salmonella enterica subsp. enterica serovar Typhimurium Molecular Source:plasmid pST1007-1A

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  21668 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGCACCT CAGAAAACGG AAAATAAAGC ACGCTAAGGC ATAGCTGACC TTGCCAGGCC TGCTTCGCCC TGTAGTGACG CGATCAACGG GCAGGAAACA 100
TTCCCCTTTC GTGCATGGCA GGCGCACACG AGTTCAGACA GCACGGTTTC CATGCGCGCC AAGTCGGCCA TCTTCTCGCG CACGTCCTTG AGCTTGTGTT 200
CGGCCAGGCT GCTGGCCTCC TCGCAGTGGG TGCCATCGTC GAGCCGCAAC AGCTCGGCAA TCTCGTCCAG ACTGAACCCC AGCCGCTGTG CCGATTTCAC 300
GAATTTCACC CGAACCACGT CCGCCTCCCC ATAGCGGCGG ATGCTGCCGT AAGGCTTGTC CGGTTCCCGC AACAGGCCCT TGCGCTGATA GAAGCGGATT 400
GTCTCCACGT TGACCCCGGC CGCCTTGGCA AAAACGCCAA TGGTCAGGTT TTCCAAATTA TTTTCCATAT CGCTTGACTC CGTACATGAG TACGGAAGTA 500
AGGTTACGCT ATCCAATCCA AATTCAAAAG GGCCAACGTA TGTCTGAACC ACAAAACGGG CGCGGTGCGC TCTTCGCCGG CGGGCTGGCC GCCATTCTTG 600
CATCGACCTG CTGCCTGGGG CCGCTAGTAC TGGTCGCCCT GGGCTTCTCC GGTGCTTGGA TCGGCAACCT GACGGTGCTG GAACCCTATC GACCGTTGTT 700
CATCGGCGCG GCGCTAGTGG CGCTGTTCTT CGCCTGGAAG CGGATTTACC GGCCCGTGCA GGCATGCAAG CCAGGTGAGG TCTGCGCGAT TCCGCAGGTG 800
CGCGCCACCT ACAAGCTGAT TTTCTGGATC GTGGCCGTGC TGGTCCTGGT CGCGCTTGGA TTTCCCTATG TCGTTCCATT TTTCTATTAA CCAGGAGTTC 900
ATCATGAAGA AACTGTTTGC CTCCCTTGCC CTCGCCGCCG CTGTTGCCCC GGTGTGGGCC GCTACCCAGA CCGTCACGCT AGCGGTTCCC GGCATGACTT 1000
GCGCCGCCTG CCCGATCACA GTCAAGAAAG CGCTCTCCAA GGTCGAAGGC GTGAGCAAGG TCGATGTGGG CTTCGAGAAG CGCGAGGCCG TCGTCACTTT 1100
TGACGACACC AAGGCCAGCG TACAGAAGCT GACCAAGGCC ACCGCAGACG CCGGCTATCC GTCCAGCGTC AAGCAGTGAG CCAGCAAGCC AACGACAACA 1200
GCGAGAGCCG CTTCATGGGA CTGATGACAC GCATTGCCGA TAAAACCGGC GCGCTCGGCA GCGTCGTTTC CGCGATGGGC TGCGCCGCCT GCTTTCCAGC 1300
CCTCGCCAGC TTCGGCGCGG CCATCGGGCT GGGCTTCTTG AGCCAGTACG AGGGACTGTT CATCAGCCGC CTGCTGCCGC TGTTTGCCGC GCTGGCCTTC 1400
CTGGCGAACG CGCTGGGTTG GTTCAGTCAT CGGCAATGGC TGCGCAGTCT GCTCGGCATG ATCGGCCCGG CCATCGTGTT TGCGGCCACG GTCTGGCTGC 1500
TCGGCAACTG GTGGACGGCG AACCTGATGT ACGTCGGCCT GGCCTTGATG ATTGGGGTGT CGATCTGGGA CTTCGTGTCG CCGGCGCATC GCCGTTGCGG 1600
ACCGGACGGC TGCGAACTCC CCGCCAAGCG CTTGTGAAAG ACGGCTGACC GTGCGACACG GCGGCCCACA CGAATAAGGA ACGATGGTAT GAGCACTCTC 1700
AAAATCACCG GCATGACTTG CGACTCGTGC GCAGTGCATG TCAAGGACGC CCTGGAGAAA GTGCCCGGCG TGCAATCAGC GGATGTCTCC TACGCCAAGG 1800
GCAGCGCCAA GCTCGCCATT GAGGTCGGCA CGTCACCCGA CGCGCTGACG GCCGCTGTAG CTGGACTCGG TTATCGGGCC ACGCTGGCCG ATGCCCCCTC 1900
AGTTTCGACG CCGGGCGGAT TGCTCGACAA GATGCGCGAT CTGCTGGGCA GAAACGACAA GACGGGTAGC AGCGGCGCAT TGCATATCGC CGTCATCGGC 2000
AGCGGCGGGG CCGCGATGGC AGCGGCGCTG AAGGCCGTCG AGCAAGGCGC ACGTGTCACG CTGATCGAGC GCGGCACCAT CGGCGGCACC TGCGTCAATG 2100
TCGGTTGTGT GCCGTCCAAG ATCATGATCC GCGCCGCCCA TATCGCCCAT CTGCGCCGGG AAAGCCCGTT CGATGGCGGC ATCGCCGCTA CCACGCCGAC 2200
CATCCAGCGC ACGGCGCTGC TGGCCCAGCA GCAGGCCCGC GTCGATGAAC TGCGCCACGC CAAGTACGAA GGCATCTTGG AGGGCAATCC GGCGATCACT 2300
GTGCTGCACG GCTCCGCCCG CTTTAAGGAC AATCGCAACC TGATCGTGCA ACTCAACGAC GGCGGCGAGC GCGTGGTGGC ATTCGACCGC TGCCTGATCG 2400
CCACCGGCGC GAGCCCGGCC GTGCCGCCGA TTCCCGGCCT GAAAGACACT CCGTACTGGA CTTCCACTGA AGCGCTGGTC AGCGAGACGA TTCCTAAGCG 2500
CCTGGCCGTG ATTGGCTCAT CAGTGGTGGC GCTGGAGCTG GCGCAGGCGT TCGCCCGACT CGGAGCGAAG GTGACGATCC TGGCTCGCAG CACGCTGTTC 2600
TTCCGCGAAG ACCCAGCTAT AGGCGAAGCC GTCACGGCCG CATTCCGCAT GGAGGGCATC GAGGTGAGGG AACACACCCA GGCCAGCCAG GTCGCGTATA 2700
TCAATGGTGA AGGGGACGGC GAATTCGTGC TCACCACGGC GCACGGCGAA CTGCGCGCCG ACAAGCTGCT GGTCGCCACC GGCCGCGCGC CCAACACACG 2800
CAAGCTGGCA CTGGATGCGA CGGGCGTCAC GCTCACCCCG CAAGGCGCTA TCGTCATCGA CCCCGGCATG CGTACAAGCG TGGAACACAT CTACGCCGCA 2900
GGCGACTGCA CCGACCAGCC GCAGTTCGTC TATGTGGCGG CAGCGGCCGG CACTCGCGCC GCGATCAACA TGACCGGCGG TGACGCGGCC CTGAACCTGA 3000
CCGCGATGCC GGCCGTGGTG TTCACCGACC CGCAAGTGGC GACCGTAGGC TACAGCGAGG CGGAAGCGCA CCATGACGGC ATCAAAACTG ATAGTCGCAC 3100
GCTAACGCTG GACAACGTGC CGCGCGCGCT CGCCAACTTC GACACGCGCG GCTTCATCAA ACTGGTGGTT GAAGAAGGCA GCGGACGACT GATCGGCGTG 3200
CAGGCAGTGG CCCCGGAAGC GGGCGAACTG ATCCAGACGG CCGCACTGGC GATTCGCAAC CGGATGACGG TGCAGGAACT GGCCGACCAG TTGTTCCCCT 3300
ACCTGACGAT GGTCGAAGGG TTGAAGCTCG CGGCGCAGAC CTTCAACAAG GATGTGAAGC AGCTTTCCTG CTGCGCCGGG TGAGGACAAG GAGGTGTGCG 3400
ATGAGCGCCT ACACGGTATC GCAACTGGCC CATAACGCTG GGGTGAGCGT ACATATCGTG CGCGACTACC TGGTGCGCGG CTTGTTACGG CCGGTGGCCT 3500
GCACCACGGG CGGCTACGGC GTGTTCGACG ATGCGGCCTT GCAACGGCTG TGCTTCGTGC GCGCGGCCTT CGAGGCGGGT ATCGGCCTGG ATGCCCTGGC 3600
GCGGCTGTGC CGTGCGCTCG ACGCAGCGGA CGGCGCACAA GCCGCAGCGC AGCTTGCCGT GCTGCGCCAG TTGGTCGAGC GGCGGCGCGC GGCGTTGGCC 3700
CATCTGGACG CGCAACTGGC CTCCATGCCA GCCGAGCGGG CGCACGAGGA GGCATTGCCG TGAACGCCCC TGACAAACTG CCGCCCGAGA CGCGCCAACC 3800
CGTTTCCGGC TACCTGTGGG GTGCGCTGGC CGTGTTGACC TGCCCCTGCC ATCTGCCGAT TCTCGCCGCC GTGCTGGCCG GGACGACCGC CGGTGCCTTC 3900
CTTGGCGAGC ATTGGGGTGT TGCCGCGCTC GCGCTGACCG GCTTGTTCGT TCTGGCCGTA ACGCGGCTGC TGCGCGCCTT CCGGGGCGGA TCATGACGAG 4000
TTCGCAGCCC GCCGGATGGA CGGCGGCCGA GTTGGCGCAG GCGGCGGCGC GCGGACAGCT TGACCTGCAT TACCAGCCGC TGGTCGATCT GCGCGATCAC 4100
CGGATCGCTG GCGCGGAAGC GTTGATGCGC TGGCGGCATC CGAGGCTTGG CCTGTTGCCG CCCGGCCAGT TCCTGCCGCT GGCCGAGTCG TTCGGCCTGA 4200
TGCCGGAAAT AGGCGCGTGG GTGCTGGGCG AGGCCTGTCG CCAGATGCAC AAGTGGCAAG GACCGGCATG GCAACCGTTC CGTCTTGCCA TCAATGTGTC 4300
CGCCAGCCAG GTTGGGCCAA CGTTCGACGA CGAGGTAAAG CGGGTGCTGG CCGATATGGC CCTGCCCGCC GAGCTTCTGG AGATCGAACT GACCGAATCG 4400
GTCGCATTCG GCAATCCAGC CCTGTTCGCC AGTTTCGACG CCTTGCGCGC CATCGGCGTG CGCTTCGCCG CCGACGACTT CGGCACCGGC TATTCCTGCC 4500
TGCAACATCT GAAATGCTGC CCCATCACCA CATTGAAAAT CGACCAATCC TTTGTCGCCA GGCTCCCGGA TGATGCCCGT GACCAAACTA TCGTGCGGGC 4600
GGTGATCCAG CTCGCGCACG GGCTGGGCAT GGATGTCATT TTCAGAAGAC GACTGCACCA GTTGATTGGG CGTAATGGCT GTTGTGCAGC CAGCTCCTGA 4700
CAGTTCAATA TCAGAAGTGA TCTGCACCAA TCTCGACTAT GCTCAATACT CGTGTGCACC AAAGCGAGGT GAGCATGGCG ACGGACACCC CACGGATTCC 4800
AGAACAAGGC GTGGCCACTC TGCCTGATGA GGCTTGGGAG CGTGCGCGCC GTCGTGCGGA GATCATCAGT CCGTTGGCGC AGTCGGAGAC GGTCGGGCAC 4900
GAAGCGGCCG ATATGGCGGC TCAGGCGCTG GGCTTGTCTC GGCGCCAGGT ATACGTTCTG ATCCGGCGTG CCCGGCAAGG CAGCGGCCTC GTGACGGATC 5000
TGGTGCCCGG CCAGTCCGGT GGAGGTAAAG GTAAGGGGCG CTTGCCGGAA CCGGTCGAGC GCGTCATCCA CGAGCTACTG CAAAAGCGGT TCCTGACCAA 5100
GCAGAAGCGC AGCCTAGCGG CCTTTCACCG CGAAGTCACT CAGGTGTGCA AGGCTCAAAA ACTGCGAGTG CCGGCGCGCA ATACCGTGGC CTTACGGATC 5200
GCTAGCCTTG ACCCGCGCAA GGTCATCCGC CGGCGGGAAG GCCAGGATGC CGCTCGTGAC CTACAAGGTG TGGGCGGCGA GCCTCCTGCC GTGACCGCGC 5300
CGCTGGAGCA GGTGCAGATA GACCATACGG TCATCGACCT GATCGTGGTC GATGACCGCG ACCGGCAACC TATTGGCCGC CCGTACCTGA CCCTCGCCAT 5400
CGACGTGTTC ACCCGCTGCG TGCTCGGCAT GGTCGTCACG CTGGAAGCGC CGTCTGCCGT TTCGGTTGGC CTGTGCCTCG TGCATGTCGC CTGCGACAAG 5500
CGCCCTTGGC TGGAAGGACT GAACGTGGAA ATGGATTGGC AGATGAGCGG CAAGCCCTTG CTGCTCTACC TAGACAACGC GGCCGAGTTC AAGAGCGAGG 5600
CCCTGCGCCG GGGTTGCGAG CAGCATGGCA TCCGGCTGGA CTATCGCCCG CTGGGACAGC CGCACTATGG CGGCATCGTG GAACGGATCA TCGGCACGGC 5700
GATGCAGATG ATTCACGACG AACTGCCGGG AACGACCTTC TCCAACCCTG ACCAGCGCGG CGACTACGAT TCCGAAAACA AGGCCGCCCT GACGCTGCGC 5800
GAGCTAGAGC GCTGGCTCAC ATTGGCGGTC GGCACCTACC ACGGTTCGGT GCACAACGGC CTGCTCCAAC CGCCGGCCGC GCGCTGGGCC GAGGCCGTGG 5900
CGCGTGTCGG CGTACCGGCC GTCGTCACAC GCGCTACTTC GTTCCTGGTC GATTTTCTGC CGATCCTCCG GCGCACGCTG ACCCGCACCG GCTTTGTCAT 6000
CGACCACATC CACTACTACG CCGATGGGCA CTGTTGCAAA TAGTCGGTGG TGATAAACTT ATCATCCCCT TTTGCTGATG GAGCTGCACA TGAACCCATT 6100
CAAAGGCCGG CATTTTCAGC GTGACATCAT TCTGTGGGCC GTACGCTGGT ACTGCAAATA CGGCATCAGT TACCGTGAGC TGCAGGAGAT GCTGGCTGAA 6200
CGCGGAGTGA ATGTCGATCA CTCCACGATT TACCGCTGGG TTCAGCGTTA TGCGCCTGAA ATGGAAAAAC GGCTGCGCTG GTACTGGCGT AACCCTTCCG 6300
ATCTTTGCCC GTGGCACATG GATGAAACCT ACGTGAAGGT CAATGGCCGC TGGGCGTATC TGTACCGGGC CGTCGACAGC CGGGGCCGCA CTGTCGATTT 6400
TTATCTCTCC TCCCGTCGTA ACAGCAAAGC TGCATACCGG TTTCTGGGTA AAATCCTCAA CAACGTGAAG AAGTGGCAGA TCCCGCGATT CATCAACACG 6500
GATAAAGCGC CCGCCTATGG TCGCGCGCTT GCTCTGCTCA AACGCGAAGG CCGGTGCCCG TCTGACGTTG AACACCGACA GATTAAGTAC CGGAACAACG 6600
TGATTGAATG CGATCATGGC AAACTGAAAC GGATAATCGG CGCCACGCTG GGATTTAAAT CCATGAAGAC GGCTTACGCC ACCATCAAAG GTATTGAGGT 6700
GATGCGTGCA CTACGCAAAG GCCAGGCCTC AGCATTTTAT TATGGTGATC CCCTGGGCGA AATGCGCCTG GTAAGCAGAG TTTTTGAAAT GTAAGGCCTT 6800
TGAATAAGAC AAAAGGCTGC CTCATCGCTA ACTTTGCAAC AGTGCCCATT TATGAATGTT CCTGTTATGG CTTATGTTCA AGAAAGCATT GCCCCTGAAA 6900
TGATGGGCAA GGTGTTTTCC CTTTTGATGA CCGCCATGAC TCTTTCTATG CCGATAGGCT TACTTGTTGC AGGTCCGGTT GTTGAGGTTA TAGGTGTTAA 7000
TACATGGTTT TTCTGGTCTG GTGTTGCGTT GATAGTAAAC GCTGTTCTCT GCCGCATTCT GACACGACGC TATGACAAAG TAACAATGAA ACCGCAAGTG 7100
GACTGAAAAA AGGACCGGGT TGATGATAAT TTGTAGTGGT GAGCTTCTGG GAGTACAAAA CAAAGTGCTC AAAATTGTCG GGCTCATGGC GTTTAACGGT 7200
ATTAATTTCG CTTATAATAA TCTTTCTATA ATAGCCTAAA GGAGAATATC TATGATACCT AATAGCGAAA ATAAAAGAGT ATGGTTTATT ACCGGAGCAA 7300
GCAAGGGGCT TGGCTATGCT TTTACATGCG CCGCCTTGAA AGCCGGGGAT AAAGTTGTTG CAGTTGCAAG GACTATCGAT AATTTGGCGA AGCTAGAAGA 7400
AACATATCAA GAGAGCTTAC TGCCATTAAA CCTCGATGTT ACAGATAGGG AGGCTGTTTT TTCTACGGTT GAAACAGCAG TTAAACATTT CGGTAGGCTT 7500
GATATTGTTG TTAATAATGC GGGTATCATG ACTATGGGTA TGATTGAAGA ACTAAACGAA TCCGATGCTC GGAAACTAAT GGACACAAAC TTTTTTGGAG 7600
CTCTTTGGGT TTGTCAGGCA GTGATGCCCT ATTTGAGGTC GCAGCGTTCT GGACATATCA TACAGATTAC AAGCATTGGC GCTATTATCT CGGGTCCGAT 7700
GTCTGGTATT TACAGTGCAA GTAAATTTGC GCTGGAAGGA ATGAGTGAAG CCTTAGCAAA AGAAGCGGAA CATTTCGGAG TGAAACTCAC TATGGTGGAA 7800
CCAGGAGGAT ATTGGACAGA TTTATACACT TCGATGAGTT ACAGCAATCC ATTAGATTCA TACGGTACAC TGCGCGATGA GCTGGCGAAA CAGTATTCCG 7900
AAGATTCGGT CGATAGTGAT CCTTCCTTGG CAGCGGAAGC CCTTATGAAA TTAGTAGCCA GCAATAATCC GCCTTTGAGG CTTATCCTTG GCAGCATGGT 8000
ATACGATTTG GCGATGGATA CCTTAAAAGC ACGGATGGCT ACCTGGGAAG AATGGGAAGC TGTTAGCCGT GCATCAGAAA AGGCTATTCC TGCACCGGAG 8100
AGATATGGAG TATAATACCA AACATGGTTT TTGAGGCAAG GACGAAACTA TCATGAAAAT TGAAATTATG GAATATAACC CGGATTGGAC AAAGAATTTT 8200
GAAGAAGAGA AAATAAAATT GCTCCATTTT TTCGGTTCTC ATGCCGTAGC CATTGAACAT ATCGGAAGCA CGGCGATACC CAATCAACGG GCGAAACCGG 8300
TTATAGATAT ATTTATTGGC GTTTCGCCTT TTGCTGAACT ACCTTTTATC AGCGCATTTT TAATGCAAAG GAGTATCACC ACACTCCGAC AGATATGACA 8400
GGCAGATATT TGTTTGCAAA ATATACAAAT GAAGTTTGGA CCCATAATCT TCTTGCTTTG GTGTAGGTAT AATACCCAAA AACGAAGTTT ATGCGGAACA 8500
GGATAACACC TCGAAATCGG AGTTTATATG GCTTCGTGGG GGAGTTATGT GTTTGAGCTT TGTCGCATTA ACGCGAATCA GGGGTTGACG GCAGAAATAG 8600
ACTGGAATTA CACTTCTTGG AGTCGGCGTT GCCGGAAAAT TCTGATTGGA TTAGTTGTTC GGGGTGCGAA AACAGTCGTA GTTCGGGGAA AAAACCGAAT 8700
TTTGACCCAA AACCGCGAAA AACTCGAAAT GACAGTTCCT ATCAGTTTTC ATAATGAATT AAAACAAAAA AATTAGGCTG CAAAGATAGG GAAAATGTGT 8800
CAATTTGCGT AAGTGATAAT TAGTCAATTA AGATAAATGC TACTTTTGTA ATCAAAGCAA AATGATATGA GCAAGATTTT TGGAATCGTA AATATAACCA 8900
CCGATAGTTT TTCCGATGGA GGACTTTATT TAGATACAGA TAAGGCAATT GAGCATGCTC TGCATTTGGT TGAAGATGGA GCAGATGTGA TTGATTTGGG 9000
AGCCGCTTCC AGTAATCCTG ATACAACTGA AGTGGGCGTT GTGGAAGAAA TCAAAAGACT CAAACCTGTC ATTAAGGCTT TAAAAGAAAA AGGCATTTCT 9100
ATTTCTGTTG ATACATTTAA ACCTGAGGTT CAGAGTTTTT GCATAGAACA AAAGGTTGAT TTTATTAATG ATATTCAAGG TTTTCCTTAT CCTGAGATTT 9200
ATTCAGGCTT GGCAAAGTCA GATTGCAAAC TTGTGTTGAT GCACTCCGTT CAGCGAATTG GTGCAGCTAC TAAAGTTGAA ACGAATCCGG AAGAGGTTTT 9300
TACTTCCATG ATGGAATTTT TTAAAGAAAG AATTGCTGCT TTAGTTGAGG CTGGTGTAAA GCGTGAACGA ATTATTCTTG ATCCGGGTAT GGGCTTCTTT 9400
TTAGGCTCTA ATCCAGAAAC ATCTATTCTT GTTTTGAAGC GTTTCCCTGA AATTCAAGAA GCTTTTAATT TGCAAGTAAT GATTGCAGTG TCACGGAAAT 9500
CATTCTTAGG TAAAATAACT GGAACCGATG TGAAATCTCG TTTAGCACCA ACTCTTGCAG CAGAAATGTA TGCATACAAA AAAGGTGCAG ATTATCTCCG 9600
CACCCATGAT GTTAAGTCTT TATCAGATGC CTTGAAAATA TCCAAAGCCC TAGGTTAGTT TTATTTTTTT AGCTTTCTAA ATGAATATGC TATACTTGCT 9700
CTGAAGTTGT GTTGGCGTAC TTGACTTAGG TCTGGATCTT TCGAACTGTT ACTAAGAGGG TAATCATAGC CAAACATAAA CTGGAAATGT CCTAATTCTA 9800
AACCTGTTCC AATACCTACA CTATAATCAA GAGGACTTAA ACTTCCATCA CTTCCAAAAG GTTTTGTGTA CTTCTCTTGA GTTTTCGTAG CTAAATAGTA 9900
GTGTTTGTTG GTAAATCCAA ATAATCCAAT ATTCAATCTT GCGACCGGGA AAGTCCTCTT GAAAGTACCA CAAGTTCGCG GGATGGAGTT TTATCCCAGC 10000
TGCATCGAGA AAGGCATGCG CAGTGAGCGT GCTCTCAAGC TCGCCATCGC CGAAATGTAT GTCAAAGGAG TAAGTACCCG CAGGGTCTCG GATATCGTCG 10100
AAATTCTTTG TGGCACCGAA GTCAGCTCGT CCCAGGTCAG CAGGCTGGCA AAGGAGCTCG ATGAAGAGAT TACGTCTTGG AAGGCGCAGC CTGTCGGACA 10200
GATTCAATAC TTGGTACTTG ATGCGACCTA TGAATCGGTT CGCGTCGGTT CCCATGTGGT CAAGCAGGCG CTTCTAGTGG CTATTGGCGT TGATTACAGC 10300
GGGAATCGGC ATATTCTTGA CGCCGAAGTC GCGAACAGTG AGGCAGAGGT AAACTGGCGT TCCTTTCTCG AGGGTCTCGT ACGACGAGGG ATGCACGGCC 10400
TGCGAATGAT CACCAGTGAT GACCACTCAG GACTGCGCGC GGCAATCGAT GCTGTCTTCC CTGGAATTCT GTGGCAACGC TGCCAGTTTC ATCTGCAGCA 10500
GAATGCCCAC TCCTACGTCA CGAAAAAAGA TGAGATCCCG CTGATAGCCG CTGATATTCG GAAGGTGTTC AATCGGAATA TGTCAAGATA GTTTATGCCA 10600
GATTTTTGAG AGGTTTGCAT CAAGCAGCCT TCGAAAGAGG ACGGCATGAC ATTGAGACCG GCAAGGCGTC GTAGATACGC ACTTTCCCAG TACGCCACCG 10700
TAAGGGGTTT TTCTCTTTGG CAGCAAGAAT GGTTTGGTTT CTTTTTTCCT CGGCGCCGTA GGCGTCCGAC TAACACCTGA ATTAAGCCGC GCCGCGAAGC 10800
GGCGTCGGCT TGAATGAACT GTTAGATGCC AGCCCGATCA ATGTGCGCTG ACCTTGGATA GCAGATTTAG AACGGCGACG CCACTAACGA TAAGTCCCAT 10900
GCCAACGAAC GCCCACAAGT CTAGTTTCTG GCCATGGAAG ATCCAAGCGA TAGCTGCCAC AAGTACGATG CCGAGGCCAG CCCAAACAGC ATAAGCAATG 11000
CCGACCGGGA TGGACTTGAG TGCGAGAGAG AGGAAATAGA ACGCAAGCCC GTAGCCAGCC ACAACTACAA CAGAAGGAAC TAACTTGGTG AATCCATGGC 11100
TGGACTTCAG TGCGGAAGTT GCGACGACCT CACCAAATAT TGCAATAGCC AGAAAGAGCC AGTTCTTCAC GTGCAATCTC CTCTACGGTA TGAAGGATAA 11200
ATAGTGGTGG CTATGAGTTG CCAAAAACAG TCTTGCGGCT GTCGATTTTC TGTGAGCATA CGCAACGCCA AATCTGGCAT CTAACGCTTG AGTTAAGCCG 11300
CGCCGCGAAG CGGCGTCGGC TTGAACGAAT TGTTAGACAT TATTTGCCGA CTACCTTGGT GATCTCGCCT TTCACGTAGT GAACAAATTC TTCCAACTGA 11400
TCTGCGCGGG AGGCCAAGCG ATCTTCTTCT TGTCCAAGAT AAGCCTGTCT AGCTTCAAGT ATGACGGGCT GATACTGGGC CGGCAGGCGC TCCATTGCCC 11500
AGTCGGCAGC GACATCCTTC GGCGCGATTT TGCCGGTTAC TGCGCTGTAC CAAATGCGGG ACAACGTAAG CACTACATTT CGCTCATCGC CAGCCCAGTC 11600
GGGCGGCGAG TTCCATAGCG TTAAGGTTTC ATTTAGCGCC TCAAATAGAT CCTGTTCAGG AACCGGATCA AAGAGTTCCT CCGCCGCTGG ACCTACCAAG 11700
GCAACGCTAT GTTCTCTTGC TTTTGTCAGC AAGATAGCCA GATCAATGTC GATCGTGGCT GGCTCGAAGA TACCTGCAAG AATGTCATTG CGCTGCCATT 11800
CTCCAAATTG CAGTTCGCGC TTAGCTGGAT AACGCCACGG AATGATGTCG TCGTGCACAA CAATGGTGAC TTCTACAGCG CGGAGAATCT CGCTCTCTCC 11900
AGGGGAAGCC GAAGTTTCCA AAAGGTCGTT GATCAAAGCT CGCCGCGTTG TTTCATCAAG CCTTACGGTC ACCGTAACCA GCAAATCAAT ATCACTGTGT 12000
GGCTTCAGGC CGCCATCCAC TGCGGAGCCG TACAAATGTA CGGCCAGCAA CGTCGGTTCG AGATGGCGCT CGATGACGCC AACTACCTCT GATAGTTGAG 12100
TCGATACTTC GGCGATCACC GCTTCCCTCA TGATGTTTAA CGCCTGAGCT CAGCCGACCG AAACCGCGTA GCGGTTTTGG GTCGGCTGCA GCGATTTGTT 12200
GGGCGATAGC TTGCCACATT CTCTCAACGA TTGGGATTTG ATGTACTTTC CGCACTTTGT AGCGCGACCA CATCATGCTC CCCCTGGCCG CGAGAGCCCT 12300
TCACTCGGGA AACACAAGAC AGACCGAGCA CGACTGTTGC AAGGGTCAAA CAGTACACGA CAACCGGCCA AGCCGTGTTG CGCGGCAACA GCGAAATGAT 12400
CAACGTTCCG ATGCTTCCTA GCAGTACACC GCCCAAGCAG AAGTAGACTG CCGTGACCGT TCCAGCAACA TGGTCGAATC CTCGAAGAGC GCCATTGGGC 12500
GCCACAGATA CCGCTGTGGC GACACCAATA CCCACTAGCC ACATTGGAGC AATAAAGCCT AACACGGACT GCAAAGCCCA TATTTCGGTG ATGGCAAGCA 12600
ATACTGCTCC AGCTATCAGG CATCCCATTC CCATTCGCAA GACACTTGGG CTGCCCCACT TGGGTATCAC ACGCCCCATA AAACGAGCCG TAAACACCAT 12700
GGCAATTGCC ACTGTGGCGA ACAGCAGGCT GAAGCCAAGC TGAGACACAC CTTGCCTGCC CATCATTAGT CCGGGCGCAA TGGAGAAAAA GACGAAGAAG 12800
CTACCCATTC CAGCGGCGTA ACACAACGTG TACAACCAGA AGTTCAGGCA CTTAACGGGG AGTAGCAGCT GCGACCATTG CAAGCCCGCA ACTCGTTGCA 12900
CCCGGGTTTC AGGCCAGAAT CGCCACGCTG CTGCAGATGC AGCGATCATG CCCAAACCTA GAAACGCAAA GATAGCCCGC CACCCAAGCC ACATGTCGAC 13000
GAGCGCTCCG AGCAATGGGC CTACCGCCGG GACCATGGCC AGCATGGATC CGAGTATGCC GTAAATGACA TTACTTTCCT CGCGACCTGC GTAAATGTCA 13100
CGTACTGTTG CAAATGTGGA AACAAGGCAC GCCGAGGCAC CACAAGCCTG AAGAATCCGA AGCCCCAGAA AGACTTCAGC CGATGACGTA AGAGCGAGGC 13200
CCATTGACGC CACAACGTAG GCGAGGCCAC CTCCCAGTAG AACGGGGCGG CGCCCCAGTC GGTCCGATAG CGGTCCAAAC AAGAGCTGAC CGGCACCAAT 13300
CATGACCAAG TACGTTGTCA GCGTAAGCTG AATTGTGCTC GCTGTCGTAC CAAGCGCGTT TGGCATAAAC GGCACTGCTG GCAAGTACAT GTCCATGCCG 13400
AGTGATGCCA ATAAATCGAA CGGTGATAAC AACAACACCG TGGCGGCAAG GGAGTACCGC CAACTAAAGT TTTTTGAGCT CACGAAACCA TCTCCTTGAA 13500
CAAAGGATTT GGCGGCGCTC CCGTAGAGCA AAAGGATTCA TGAGAACGCC GCAACAACCG AAAAATGAAG GTTGCTGCGG CTTACTTGTC TGCGTTCTTG 13600
GAAGTGCTCA TCTGCTGACT ATCTCATGAT TGAATTTGAA TCGTAACAAC TTTCAAGCAA CTCTGCAAGG AGCCTTATTG TGCGCCCAAC GCCGGAGTTA 13700
AGCCGCCGCG CGTAGCGCGG TCGGCTTGAA CGAATTGTTA GACATCATTT ACCAACTGAC TTGATGATCT CGCCTTTCAC AAAGCGAATA AATTCTTCCA 13800
AGTGATCTGC GCGTGAGGCC AAGTGATCTT CTTTTTGTCC CAGATAAGCT TGCTTAGCTT CAAGTAAGAC GGGCTGATAC TGGGCAGGTA GGCGTTTTAT 13900
TGCCCAGTCG GCAGCGACAT CCTTCGGCGC GATTTTGCCG GTTATTGCGC TGTACCAAAT GCGGGACAAC GTAAGCACTA CATTTCGCTC ATCGCCGGCC 14000
CAGTCGGGCT GCGAGTTCCA TAGCTTCAAG GTTTCCCTCA GCGCCTCGAA TAGATCCTGT TCAGGAACCG GGTCAAAGAA TTCCTCCGCT GCCGGACCTA 14100
CCAAGGCAAC GCTATGTTCT CTTGCTTTTG TAAGCAGGAT AGCTAGATCA ATGTCGATCA TGGCTGGCTC GAAGATACCC GCAAGAATGT CATTGCGCTG 14200
CCATTCTCCA AATTGCAGCT CGCGCTTAGC CGGATAACGC CACGGGATGA TGTCGTCATG CACGACAAGG GTGACTTCTA TAGCGCGGAG CGTCTCGCTC 14300
TCGCCAGGGA AAGCCGAAGC CTCCATAAGA TCATTGAGCA ATGCTCGCCG CGTCGTTTCA TCAAGCTTTA CGGCCACAGT AACCAACAAA TCAATATCGC 14400
TGTATGGCTT CAGGCCGCCA TCCACTGCGG AGCCGTACAA ATGCACGGCC AGCAACGTTG ATTCCAGATG GCGCTCAATG ACGCTTAGCA CCTCTGATAG 14500
TTGGTTCGAA ATTTCGATGG TCACCGCTTC CCTCATGATG TCTAACGGGC GAGGTAAGCC GACCGCAGAA TGCGGGTCGG CTTGACCGAA ATGTTAGAAC 14600
CAGAAGCCAA AACGGATAAC TTGAATTTGG CGACGGGCGC TAACCGTGAA AAAACGCTGC GCCACCGAGG CGGCACAGCA CTGCAAAAAC GATAGCTGCT 14700
TGCGCTTGCT ACGCAAGGGC TAGAGGCCAA AAAGACTGAA AACCTGCGCA GCCCATGCAG GCGAAGCCCG GAAAAAAGGC AAAACAGGCA CTGAATAACG 14800
CCTGAAAAGC TAAATGCCGT TTGAATAAAC ATGAGCTAAA TAAAGCTGGG TTTCAGTGGT GCTAACGTTG GACGTAACGA GAGCCGGAGC GCAGCGGAGG 14900
GAACCAAAAT GCGCAGCATT TTGGCGTCCC GTTGACGGAA TGGTTAGCCG TTTCGACGCG CATAAACGGA GTGGGTGTAC GGAATTACAG CTTGAATGGT 15000
TTCGGTTGAG ACAAGCTCGA ATTCTGTTTC GTTGAGCATT GGGAAGAAGG CGTCACCCTC GAAGGTTTGA TGTACCTCAG ATAGAAACAC GCCGTGGGCG 15100
TGAGGTAGTG CCAGAGTGTA TATCTCAGCT CCGCCCGCGA CGTAGAGTTC ATTGCCGAGT TCGGATGCCA AAGCGATAGC GTGCGACAGC GTTGAAACAA 15200
CTACGCAGCC AGTGGCGCGG TAGTTAGCTT GGCGTGAGAT TACCAATGTG TGACGGTTCG GTAGAGGCTT GCCGATAGAC TCAAAGGTCT TTCGCCCCAT 15300
GACAACGACT TTTCCCTCAG TGAGTCTGCG AAAAATCTTC TGCTCACCCG GAATTTTCCA GGGGATATTA GGACCATTGC CAATAACCCG ATTGGCTCCC 15400
ATCGCAGCAA CGAGATAAAT GCGTACTGAT TCCGAGTTCA TATGGCTAAC TTTGTTTTAG GGCGACTGCC CTGCTGCGTA ACATCGTTGC TGCTCCATAA 15500
CATCAAACAT CGACCCACGG CGTAACGCGC TTGCTGCTTG GATGCCCGAG GCATAGACTG TACAAAAAAA CAGTCATAAC AAGCCATGAA AACCGCCACT 15600
GCGCCGTTAC CACCGCTGCG TTCGGTCAAG GTTCTGGACC AGTTGCGTGA GCGCATACGC TACTTGCATT ACAGCTTACC AACCGAACAG GCTTATGTCC 15700
ACTGGGTTCG TGCCTTCATC CGTTTCCACG GTGTGCGTCA CCCGGCAACC TTGGGCAGCA GCGAAGTCGA GGCATTTCTG TCCTGGCTGG CGAACGAGCG 15800
CAAGGTTTCG GTCTCCACGC ATCGTCAGGC ATTGGCGGCC TTGCTGTTCT TCTACGGCAA GGTGCTGTGC ACGGATCTGC CCTGGCTTCA GGAGATCGGA 15900
AGACCTCGGC CGTCGCGGCG CTTGCCGGTG GTGCTGACCC CGGATGAAGT GGTTCGCATC CTCGGTTTTC TGGAAGGCGA GCATCGTTTG TTCGCCCAGC 16000
TTCTGTATGG AACGGGCATG CGGATCAGTG AGGGTTTGCA ACTGCGGGTC AAGGATCTGG ATTTCGATCA CGGCACGATC ATCGTGCGGG AGGGCAAGGG 16100
CTCCAAGGAT CGGGCCTTGA TGTTACCCGA GAGCTTGGCA CCCAGCCTGC GCGAGCAGCT GTCGCGTGCA CGGGCATGGT GGCTGAAGGA CCAGGCCGAG 16200
GGCCGCAGCG GCGTTGCGCT TCCCGACGCC CTTGAGCGGA AGTATCCGCG CGCCGGGCAT TCCTGGCCGT GGTTCTGGGT TTTTGCGCAG CACACGCATT 16300
CGACCGATCC ACGGAGCGGT GTCGTGCGTC GCCATCACAT GTATGACCAG ACCTTTCAGC GCGCCTTCAA ACGTGCCGTA GAACAAGCAG GCATCACGAA 16400
GCCCGCCACA CCGCACACCC TCCGCCACTC GTTCGCGACG GCCTTGCTCC GCAGCGGTTA CGACATTCGA ACCGTGCAGG ATCTGCTCGG CCATTCCGAC 16500
GTCTCTACGA CGATGATTTA CACGCATGTG CTGAAAGTTG GCGGTGCCGG AGTGCGCTCA CCGCTTGATG CGCTGCCGCC CCTCACTAGT GAGAGGTAGG 16600
GCAGCGCAAG TCAATCCTGG CGGATTCACT ACCCCTGCGC GAAGGCCATC GGTGCCGCAT CGAACGGCCG GTTGCGGAAA GTCCTCCCTG CGTCCGCTGA 16700
TGGCCGGCAG CAGCCCGTCG TTGCCTGATG GATCCAACCC CTCCGCTGCT ATAGTGCAGT CGGCTTCTGA CGTTCAGTGC AGCCGTCTTC TGAAAACGAC 16800
AATGGAGGTG GTAGCCGAGG GTGTGGAAAC ACCCGACTGC CTTGCGTGGT TGCGGCAGGC GGGTTGCGAC ACGGTGCAGG GTTTCCTGTT CGCCAGGCCG 16900
ATGCCGGCGG CGGCCTTCGT CGGCTTCGTC AACCAATGGA GGAACACCAC CATGAACGCC AATGAACCGA GCACCAGTTG CTGCGTGTGC TGCAAGGAAA 17000
TCCCGCTCGA TGCCGCCTTC ACGCCGGAAG GGGCCGAGTA CGTGGAGCAT TTCTGCGGGC TGGAGTGCTA TCAGCGCTTC CAGGCGCGGG CCAGCACTGC 17100
GACCGAAACC AGCGTCAAAC CGGACGCTTG TGATTCGCCG CCGTCAGGTT GAGGCATACC CTAACCTGAT GTCAGATGCC ATGTGTAAAT TGCGTCAGGA 17200
TAGGATTGAA TTTTGAATTT ATTGACATAT CTCGTTGAAG GTCATAGAGT CTTCCCTGAC ATTTTGCAGG GAATTCCATG ACTGGACAGC GCATTGGGTA 17300
TATCAGGGGG CACTGTTGCA AATAGTCGGT GGTGATAAAC TTATCATCCC CTTTTGCTGA TGGAGCTGCA CATGAACCCA TTCAAAGGCC GGCATTTTCA 17400
GCGTGACATC ATTCTGTGGG CCGTACGCTG GTACTGCAAA TACGGCATCA GTTACCGTGA GCTGCAGGAG ATGCTGGCTG AACGCGGAGT GAATGTCGAT 17500
CACTCCACGA TTTACCGCTG GGTTCAGCGT TATGCGCCTG AAATGGAAAA ACGGCTGCGC TGGTACTGGC GTAACCCTTC CGATCTTTGC CCGTGGCACA 17600
TGGATGAAAC CTACGTGAAG GTCAATGGCC GCTGGGCGTA TCTGTACCGG GCCGTCGACA GCCGGGGCCG CACTGTCGAT TTTTATCTCT CCTCCCGTCG 17700
TAACAGCAAA GCTGCATACC GGTTTCTGGG TAAAATCCTC AACAACGTGA AGAAGTGGCA GATCCCGCGA TTCATCAACA CGGATAAAGC GCCCGCCTAT 17800
GGTCGCGCGC TTGCTCTGCT CAAACGCGAA GGCCGGTGCC CGTCTGACGT TGAACACCGA CAGATTAAGT ACCGGAACAA CGTGATTGAA TGCGATCATG 17900
GCAAACTGAA ACGGATAATC GGCGCCACGC TGGGATTTAA ATCCATGAAG ACGGCTTACG CCACCATCAA AGGTATTGAG GTGATGCGTG CACTACGCAA 18000
AGGCCAGGCC TCAGCATTTT ATTATGGTGA TCCCCTGGGC GAAATGCGCC TGGTAAGCAG AGTTTTTGAA ATGTAAGGCC TTTGAATAAG ACAAAAGGCT 18100
GCCTCATCGC TAACTTTGCA ACAGTGCCTA TCAGGGTCAG CACCTTCGAC CAGAACCCGG AACGGCAACT GGAAGGCGTC AAGGTTGATC GCGCTTTTAG 18200
CGACAAGGCA TCCGGCAAGG ATGTCAAGCG TCCGCAACTG GAAGCGCTGA TAAGCTTCGC CCGCACCGGC GACACCGTGG TGGTGCATAG CATGGATCGC 18300
CTGGCGCGCA ATCTCGATGA TTTGCGCCGG ATCGTGCAAA CGCTGACACA ACGCGGCGTG CATATCGAAT TCGTCAAGGA ACACCTCAGT TTTACTGGCG 18400
AAGACTCTCC GATGGCGAAC CTGATGCTCT CGGTGATGGG CGCGTTCGCC GAGTTCGAGC GCGCCCTGAT CCGCGAGCGT CAGCGCGAGG GTATTGCGCT 18500
CGCCAAGCAA CGCGGGGCTT ACCGTGGCAG GAAGAAATCC CTGTCGTCTG AGCGTATTGC CGAACTGCGC CAACGTGTCG AGGCTGGCGA GCAAAAGACC 18600
AAGCTTGCTC GTGAATTCGG AATCAGTCGC GAAACCCTGT ATCAATACTT GAGAACGGAT CAGTAAATAT GCCACGTCGT TCCATCCTGT CCGCCGCCGA 18700
GCGGGAAAGC CTGCTGGCGT TGCCGGACTC CAAGGACGAC CTGATCCGAC ATTACACATT CAACGATACC GACCTCTCGA TCATCCGACA GCGGCGCGGG 18800
CCAGCCAATC GGCTGGGCTT CGCGGTGCAG CTCTGTTACC TGCGCTTTCC CGGCGTCATC CTGGGCGTCG ATGAACTACC GTTCCCGCCC TTGTTGAAGC 18900
TGGTCGCCGA CCAGCTCAAG GTCGGCGTCG AAAGCTGGAA CGAGTACGGC CAGCGGGAGC AGACCCGGCG CGAGCACCTG AGCGAGCTGC AAACCGTGTT 19000
CGGTTTCCGG CCCTTCACCA TGAGCCATTA CCGGCAGGCC GTCCAGATGC TGACCGAGCT GGCGATGCAA ACCGACAAAG GCATCGTGCT GGCCAGCGCC 19100
TTGATCGGGC ACCTGCGGCG GCAGTCGGTC ATTCTGCCCG CCCTCAACGC CGTCGAGCGG GCGAGTGCCG AGGCGATCAC CCGTGCTAAC CGGCGCATCT 19200
ACGACGCCTT GGCCGAACCA CTGGCGGACG CGCATCGCCG CCGCCTCGAC GATCTGCTCA AGCGCCGGGA CAACGGCAAG ACGACCTGGT TGGCTTGGTT 19300
GCGCCAGTCT CCGGCCAAGC CAAATTCGCG GCATATGCTG GAACACATCG AACGCCTCAA GGCATGGCAG GCACTCGATC TGCCTACCGG CATCGAGCGG 19400
CTGGTTCACC AGAACCGCCT GCTCAAGATT GCCCGCGAGG GCGGCCAGAT GACACCCGCC GACCTGGCCA AATTCGAGCC GCAACGGCGC TACGCCACTC 19500
TCGTGGCGCT GGCCACCGAG GGCATGGCCA CCGTCACCGA CGAAATCATC GACCTGCACG ACCGCATCCT GGGTAAGCTG TTTAACGCTG CCAAGAATAA 19600
GCATCAGCAG CAGTTCCAGG CGTCAGGCAA GGCCATCAAC GCCAAGGTAC GTCTGTACGG GCGCATCGGT CAGGCGCTGA TCGACGCCAA GCAATCAGGC 19700
CGCGATGCGT TTGCCGCCAT CGAGGCCGTC ATGTCCTGGG ATTCCTTTGC CGAGAGCGTC ACCGAGGCGC AGAAGCTCGC GCAACCCGAT GACTTCGATT 19800
TCCTGCATCG CATCGGCGAG AGCTACGCCA CCCTGCGCCG CTATGCACCG GAATTCCTTG CCGTGCTCAA GCTGCGGGCC GCGCCCGCCG CCAAAAACGT 19900
GCTTGATGCC ATTGAGGTGC TGCGCGGCAT GAACACCGAC AACGCCCGCA AGCTGCCAGC CGATGCACCG ACCGGCTTCA TCAAGCCGCG CTGGCAGAAA 20000
CTGGTGATGA CCGACGCCGG CATCGACCGG CGCTACTACG AACTGTGCGC GCTGTCCGAG TTGAAGAACT CCCTGCGCTC GGGCGACATC TGGGTGCAGG 20100
GTTCACGCCA GTTCAAGGAC TTCGAGGACT ACCTGGTACC GCCCGAGAAG TTCACCAGCC TCAAGCAGTC CAGCGAATTG CCGCTGGCCG TGGCCACCGA 20200
CTGCGAACAA TATCTGCATG AGCGGCTGAC GCTGCTGGAA GCACAACTTG CCACCGTCAA CCGCATGGCG GCAGCCAACG ACCTGCCGGA TGCCATCATC 20300
ACCGAGTCGG GCTTGAAGAT CACGCCGCTG GATGCGGCGG TGCCCGACAC CGCGCAGGCG CTGATAGACC AGACAGCCAT GGTCCTGCCG CACGTCAAGA 20400
TCACCGAACT GCTGCTCGAA GTCGATGAGT GGACGGGCTT CACCCGGCAC TTCACGCACT TGAAATCGGG CGATCTGGCC AAGGACAAGA ACCTGTTGTT 20500
GACCACGATC CTGGCCGACG CGATCAACCT GGGCCTGACC AAGATGGCCG AGTCCTGCCC CGGCACGACC TACGCGAAGC TCGCTTGGCT GCAAGCCTGG 20600
CATACCCGCG ACGAAACGTA CTCGACAGCG TTGGCTGAAC TGGTCAACGC TCAGTTTCGG CATCCCTTTG CCGGGCACTG GGGCGATGGC ACCACATCAT 20700
CATCGGACGG ACAGAATTTC CGAACCGCTA GCAAGGCAAA GAGCACGGGG CACATCAACC CAAAATATGG CAGCAGCCCA GGACGGACTT TCTACACCCA 20800
CATCTCCGAC CAATACGCGC CATTCCACAC CAAGGTGGTC AATGTCGGCC TGCGCGACTC AACCTACGTG CTCGACGGCC TGCTGTACCA CGAATCCGAC 20900
CTGCGGATCG AGGAGCACTA CACCGACACG GCGGGCTTCA CCGATCACGT CTTCGCCCTG ATGCACCTCT TGGGCTTCCG CTTCGCGCCG CGCATCCGCG 21000
ACCTGGGCGA CACCAAGCTC TACATCCCGA AGGGCGATGC CGCCTATGAC GCGCTCAAGC CGATGATCGG CGGCACGCTC AACATCAAGC ACGTCCGCGC 21100
CCATTGGGAC GAAATCCTGC GGCTGGCCAC CTCGATCAAG CAGGGCACGG TGACGGCCTC GCTGATGCTC AGGAAACTCG GCAGCTACCC GCGCCAGAAC 21200
GGCTTGGCCG TCGCGCTGCG CGAGTTGGGC CGCATCGAGC GCACGCTGTT CATCCTCGAC TGGCTGCAAA GCGTCGAGCT ACGCCGCCGC GTGCATGCCG 21300
GGCTGAACAA GGGCGAGGCG CGCAATGCGC TGGCCCGTGC CGTGTTCTTC AACCGCCTTG GTGAAATCCG TGACCGCAGT TTCGAGCAGC AGCGCTACCG 21400
GGCCAGCGGC CTCAACCTGG TGACGGCGGC CATCGTGCTG TGGAACACGG TCTACCTGGA GCGTGCGGCG CATGCGTTGC GCGGCAATGG TCATGCCGTC 21500
GATGACTCGC TATTGCAGTA CCTGTCGCCA CTCGGCTGGG AGCACATCAA CCTGACCGGT GATTACCTAT GGCGCAGCAG CGCCAAGATC GGCGCGGGGA 21600
AGTTCAGGCC GCTACGGCCT CTGCAACCGG CTTAGCGTGC TTTATTTTCC GTTTTCTGAG ACGACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
attC aadA1a core 11285-11338 54 CGCTTGAGTT AAGCCGCGCC GCGAAGCGGC GTCGGCTTGA ACGAATTGTT AGAC
attC-cmlA6 5'-end 12141-12204 64 CGCCTGAGCT CAGCCGACCG AAACCGCGTA GCGGTTTTGG GTCGGCTGCA GCGATTTGTT
GGGC
attC cmlA6 core 12141-12204 64 CGCCTGAGCT CAGCCGACCG AAACCGCGTA GCGGTTTTGG GTCGGCTGCA GCGATTTGTT
GGGC
attC-cmlA6 3'-end 13684-13689 6 GCCCAA
attC-aadA2 5'-end 13690-13743 54 CGCCGGAGTT AAGCCGCCGC GCGTAGCGCG GTCGGCTTGA ACGAATTGTT AGAC
attC aadA3 core 13690-13743 54 CGCCGGAGTT AAGCCGCCGC GCGTAGCGCG GTCGGCTTGA ACGAATTGTT AGAC
attC-aadA2 3'-end 14540-14545 6 GTCTAA
attC orfD 14551-14598 48 GAGGTAAGCC GACCGCAGAA TGCGGGTCGG CTTGACCGAA ATGTTAGA
attC dfrA12 core 14866-14949 84 CGTTGGACGT AACGAGAGCC GGAGCGCAGC GGAGGGAACC AAAATGCGCA GCATTTTGGC
GTCCCGTTGA CGGAATGGTT AGCC
attI 15450-15505 56 CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCA
res 17137-17267 131 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAGA TGCCATGTGT AAATTGCGTC
AGGATAGGAT TGAATTTTGA ATTTATTGAC ATATCTCGTT GAAGGTCATA GAGTCTTCCC
TGACATTTTG C
res_site_I 17137-17175 39 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAG
res_site_II 17189-17232 44 ATTGCGTCAG GATAGGATTG AATTTTGAAT TTATTGACAT ATCT
res_site_III 17236-17267 32 TGAAGGTCAT AGAGTCTTCC CTGACATTTT GC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn21.1 34-468 Passenger Gene Heavy Metal Resistance -
merT Tn21.1 540-890 Passenger Gene Heavy Metal Resistance +
merP Tn21.1 904-1179 Passenger Gene Heavy Metal Resistance +
merC Tn21.1 1215-1637 Passenger Gene Heavy Metal Resistance +
merA Tn21.1 1689-3383 Passenger Gene Heavy Metal Resistance +
merD Tn21.1 3401-3763 Passenger Gene Heavy Metal Resistance +
merE Tn21.1 3760-3996 Passenger Gene Heavy Metal Resistance +
urfM 5'-end Tn21.1 3993-4663 Passenger Gene Other +
tniA 5'-end In_Tn21.1 4739-6043 Transposase   +
tnpA IS26 6090-6794 Transposase   +
SDR family oxidoreductase In_Tn21.1 7252-8115 Passenger Gene Other +
GrpB domain protein In_Tn21.1 8153-8398 Passenger Gene Other +
sul3 (ARO:3000413) In_Tn21.1 8867-9658 Passenger Gene Antibiotic Resistance +
tnp IS256 family In_Tn21.1 9983-10591 Transposase   +
qacL (ARO:3005098) In_Tn21.1 10838-11170 Passenger Gene Antibiotic Resistance -
aadA (ARO:3002601) In_Tn21.1 11340-12131 Passenger Gene Antibiotic Resistance -
cmlA6 (ARO:3002696) In_Tn21.1 12224-13483 Passenger Gene Antibiotic Resistance -
aadA2 (ARO:3002602) In_Tn21.1 13745-14524 Passenger Gene Antibiotic Resistance -
DUF1010 family protein In_Tn21.1 14542-14832 Passenger Gene Other -
dfrA12 (ARO:3002858) In_Tn21.1 14944-15441 Passenger Gene Antibiotic Resistance -
intI1 In_Tn21.1 15586-16599 Integron Integrase Class 1 +
tnpM Tn21.1 16802-17152 Accessory Gene Inhibitor +
tnpR 5'-end Tn21.1 17278-17300 Accessory Gene Resolvase +
tnpA IS26 17372-18076 Transposase   +
tnpR 3'-end Tn21.1 18129-18666 Accessory Gene Resolvase +
tnpA Tn21.1 18669-21635 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn21.1 435 34-468 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLREPDKPY GSIRRYGEAD VVRVKFVKSA QRLGFSLDEI AELLRLDDGT HCEEASSLAE HKLKDVREKM
ADLARMETVL SELVCACHAR KGNVSCPLIA SLQGEAGLAR SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn21.1 351 540-890 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPQNGRGA LFAGGLAAIL ASTCCLGPLV LVALGFSGAW IGNLTVLEPY RPLFIGAALV ALFFAWKRIY RPVQACKPGE VCAIPQVRAT YKLIFWIVAV
LVLVALGFPY VVPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn21.1 276 904-1179 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFASLAL AAAVAPVWAA TQTVTLAVPG MTCAACPITV KKALSKVEGV SKVDVGFEKR EAVVTFDDTK ASVQKLTKAT ADAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn21.1 423 1215-1637 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   transmembrane protein mercury transport
Target:   Mercury
Protein Sequence:  
MGLMTRIADK TGALGSVVSA MGCAACFPAL ASFGAAIGLG FLSQYEGLFI SRLLPLFAAL AFLANALGWF SHRQWLRSLL GMIGPAIVFA ATVWLLGNWW
TANLMYVGLA LMIGVSIWDF VSPAHRRCGP DGCELPAKRL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn21.1 1695 1689-3383 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MSTLKITGMT CDSCAVHVKD ALEKVPGVQS ADVSYAKGSA KLAIEVGTSP DALTAAVAGL GYRATLADAP SVSTPGGLLD KMRDLLGRND KTGSSGALHI
AVIGSGGAAM AAALKAVEQG ARVTLIERGT IGGTCVNVGC VPSKIMIRAA HIAHLRRESP FDGGIAATTP TIQRTALLAQ QQARVDELRH AKYEGILEGN
PAITVLHGSA RFKDNRNLIV QLNDGGERVV AFDRCLIATG ASPAVPPIPG LKDTPYWTST EALVSETIPK RLAVIGSSVV ALELAQAFAR LGAKVTILAR
STLFFREDPA IGEAVTAAFR MEGIEVREHT QASQVAYING EGDGEFVLTT AHGELRADKL LVATGRAPNT RKLALDATGV TLTPQGAIVI DPGMRTSVEH
IYAAGDCTDQ PQFVYVAAAA GTRAAINMTG GDAALNLTAM PAVVFTDPQV ATVGYSEAEA HHDGIKTDSR TLTLDNVPRA LANFDTRGFI KLVVEEGSGR
LIGVQAVAPE AGELIQTAAL AIRNRMTVQE LADQLFPYLT MVEGLKLAAQ TFNKDVKQLS CCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn21.1 363 3401-3763 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MSAYTVSQLA HNAGVSVHIV RDYLVRGLLR PVACTTGGYG VFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGAQ AAAQLAVLRQ LVERRRAALA
HLDAQLASMP AERAHEEALP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn21.1 237 3760-3996 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Comment:   similar to urf-1 in pKLH2 (GenBank AF213017), pKLH272 (Genbank Y08992), pMER610 (GenBank Y08993), pKLH210 (GenBank Y10102), Tn5036 (Genbank Y09025), orf1 in Tn501 (GenBank Z00027), and urf-1 in Tn5041 (GenBank X98999)
Protein Sequence:  
MNAPDKLPPE TRQPVSGYLW GALAVLTCPC HLPILAAVLA GTTAGAFLGE HWGVAALALT GLFVLAVTRL LRAFRGGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM 5'-end N Tn21.1 671 3993-4663 +
Class:   Passenger Gene
Sub Class:   Other
Comment:   urfM ORF interrupted by insertion of In2
Protein Sequence:  
MTSSQPAGWT AAELAQAAAR GQLDLHYQPL VDLRDHRIAG AEALMRWRHP RLGLLPPGQF LPLAESFGLM PEIGAWVLGE ACRQMHKWQG PAWQPFRLAI
NVSASQVGPT FDDEVKRVLA DMALPAELLE IELTESVAFG NPALFASFDA LRAIGVRFAA DDFGTGYSCL QHLKCCPITT LKIDQSFVAR LPDDARDQTI
VRAVIQLAHG LGMDVIFRRR LHQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA 5'-end TniA 5'-end In_Tn21.1 1305 4739-6043 +
Class:   Transposase
Function:   integrase
Transpoase Chemistry:   DDE
Comment:   Contains the first 429 amino acids of tniA (In2)||probably truncated by insertion of IS26
Protein Sequence:  
MLNTRVHQSE VSMATDTPRI PEQGVATLPD EAWERARRRA EIISPLAQSE TVGHEAADMA AQALGLSRRQ VYVLIRRARQ GSGLVTDLVP GQSGGGKGKG
RLPEPVERVI HELLQKRFLT KQKRSLAAFH REVTQVCKAQ KLRVPARNTV ALRIASLDPR KVIRRREGQD AARDLQGVGG EPPAVTAPLE QVQIDHTVID
LIVVDDRDRQ PIGRPYLTLA IDVFTRCVLG MVVTLEAPSA VSVGLCLVHV ACDKRPWLEG LNVEMDWQMS GKPLLLYLDN AAEFKSEALR RGCEQHGIRL
DYRPLGQPHY GGIVERIIGT AMQMIHDELP GTTFSNPDQR GDYDSENKAA LTLRELERWL TLAVGTYHGS VHNGLLQPPA ARWAEAVARV GVPAVVTRAT
SFLVDFLPIL RRTLTRTGFV IDHIHYYADG HCCK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA IS26 705 6090-6794 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MNPFKGRHFQ RDIILWAVRW YCKYGISYRE LQEMLAERGV NVDHSTIYRW VQRYAPEMEK RLRWYWRNPS DLCPWHMDET YVKVNGRWAY LYRAVDSRGR
TVDFYLSSRR NSKAAYRFLG KILNNVKKWQ IPRFINTDKA PAYGRALALL KREGRCPSDV EHRQIKYRNN VIECDHGKLK RIIGATLGFK SMKTAYATIK
GIEVMRALRK GQASAFYYGD PLGEMRLVSR VFEM

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
SDR family oxidoreductase SDR family oxidoreductase In_Tn21.1 864 7252-8115 +
Class:   Passenger Gene
Sub Class:   Other
Sequence Family:  WP_000612791.1
Protein Sequence:  
MIPNSENKRV WFITGASKGL GYAFTCAALK AGDKVVAVAR TIDNLAKLEE TYQESLLPLN LDVTDREAVF STVETAVKHF GRLDIVVNNA GIMTMGMIEE
LNESDARKLM DTNFFGALWV CQAVMPYLRS QRSGHIIQIT SIGAIISGPM SGIYSASKFA LEGMSEALAK EAEHFGVKLT MVEPGGYWTD LYTSMSYSNP
LDSYGTLRDE LAKQYSEDSV DSDPSLAAEA LMKLVASNNP PLRLILGSMV YDLAMDTLKA RMATWEEWEA VSRASEKAIP APERYGV

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
GrpB domain protein GrpB domain protein In_Tn21.1 246 8153-8398 +
Class:   Passenger Gene
Sub Class:   Other
Sequence Family:  GrpB (Pfam:PF04229)
Protein Sequence:  
MKIEIMEYNP DWTKNFEEEK IKLLHFFGSH AVAIEHIGST AIPNQRAKPV IDIFIGVSPF AELPFISAFL MQRSITTLRQ I

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
sul3 (ARO:3000413) Sul3 In_Tn21.1 792 8867-9658 +
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Target:   sulfone antibiotic (ARO:3003401)||sulfonamide antibiotic (ARO:3000282)
Sequence Family:  sulfonamide resistant sul (ARO:3004238)
Comment:   perfect match to reference sequence for ARO:3000413
Protein Sequence:  
MSKIFGIVNI TTDSFSDGGL YLDTDKAIEH ALHLVEDGAD VIDLGAASSN PDTTEVGVVE EIKRLKPVIK ALKEKGISIS VDTFKPEVQS FCIEQKVDFI
NDIQGFPYPE IYSGLAKSDC KLVLMHSVQR IGAATKVETN PEEVFTSMME FFKERIAALV EAGVKRERII LDPGMGFFLG SNPETSILVL KRFPEIQEAF
NLQVMIAVSR KSFLGKITGT DVKSRLAPTL AAEMYAYKKG ADYLRTHDVK SLSDALKISK ALG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp IS256 family Tnp IS256 family In_Tn21.1 609 9983-10591 +
Class:   Transposase
Function:   tranposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MEFYPSCIEK GMRSERALKL AIAEMYVKGV STRRVSDIVE ILCGTEVSSS QVSRLAKELD EEITSWKAQP VGQIQYLVLD ATYESVRVGS HVVKQALLVA
IGVDYSGNRH ILDAEVANSE AEVNWRSFLE GLVRRGMHGL RMITSDDHSG LRAAIDAVFP GILWQRCQFH LQQNAHSYVT KKDEIPLIAA DIRKVFNRNM
SR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacL (ARO:3005098) QacL In_Tn21.1 333 10838-11170 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   quaternary ammonium salts
Sequence Family:  small multidrug resistance (SMR) antibiotic efflux pump (ARO:0010003)
Comment:   subunit of the qac multidrug efflux pump||strict match to reference sequence for ARO:3005098 (bitscore: 202)
Protein Sequence:  
MKNWLFLAIA IFGEVVATSA LKSSHGFTKL VPSVVVVAGY GLAFYFLSLA LKSIPVGIAY AVWAGLGIVL VAAIAWIFHG QKLDLWAFVG MGLIVSGVAV
LNLLSKVSAH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aadA (ARO:3002601) AadA In_Tn21.1 792 11340-12131 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Transpoase Chemistry:   aminoglycoside nucleotidyltransferase
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  ANT(3'') (ARO:3004275)
Comment:   perfect match to reference sequence for ARO:3002601||Synonyms: aadA1-pm aadA, aadA1, aad(3'')(9)
Protein Sequence:  
MREAVIAEVS TQLSEVVGVI ERHLEPTLLA VHLYGSAVDG GLKPHSDIDL LVTVTVRLDE TTRRALINDL LETSASPGES EILRAVEVTI VVHDDIIPWR
YPAKRELQFG EWQRNDILAG IFEPATIDID LAILLTKARE HSVALVGPAA EELFDPVPEQ DLFEALNETL TLWNSPPDWA GDERNVVLTL SRIWYSAVTG
KIAPKDVAAD WAMERLPAQY QPVILEARQA YLGQEEDRLA SRADQLEEFV HYVKGEITKV VGK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
cmlA6 (ARO:3002696) CmlA6 In_Tn21.1 1260 12224-13483 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   phenicol antibiotic (ARO:3000387)
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Comment:   strict match to reference sequence for ARO:3002696 (bitscore: 819)
Protein Sequence:  
MSSKNFSWRY SLAATVLLLS PFDLLASLGM DMYLPAVPFM PNALGTTAST IQLTLTTYLV MIGAGQLLFG PLSDRLGRRP VLLGGGLAYV VASMGLALTS
SAEVFLGLRI LQACGASACL VSTFATVRDI YAGREESNVI YGILGSMLAM VPAVGPLLGA LVDMWLGWRA IFAFLGLGMI AASAAAWRFW PETRVQRVAG
LQWSQLLLPV KCLNFWLYTL CYAAGMGSFF VFFSIAPGLM MGRQGVSQLG FSLLFATVAI AMVFTARFMG RVIPKWGSPS VLRMGMGCLI AGAVLLAITE
IWALQSVLGF IAPMWLVGIG VATAVSVAPN GALRGFDHVA GTVTAVYFCL GGVLLGSIGT LIISLLPRNT AWPVVVYCLT LATVVLGLSC VSRVKGSRGQ
GEHDVVALQS AESTSNPNR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aadA2 (ARO:3002602) AadA2 In_Tn21.1 780 13745-14524 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  ANT(3'') (ARO:3004275)
Comment:   strict match to reference sequence for ARO:3002602 (bitscore: 520)
Protein Sequence:  
VTIEISNQLS EVLSVIERHL ESTLLAVHLY GSAVDGGLKP YSDIDLLVTV AVKLDETTRR ALLNDLMEAS AFPGESETLR AIEVTLVVHD DIIPWRYPAK
RELQFGEWQR NDILAGIFEP AMIDIDLAIL LTKAREHSVA LVGPAAEEFF DPVPEQDLFE ALRETLKLWN SQPDWAGDER NVVLTLSRIW YSAITGKIAP
KDVAADWAIK RLPAQYQPVL LEAKQAYLGQ KEDHLASRAD HLEEFIRFVK GEIIKSVGK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
DUF1010 family protein DUF1010 family protein In_Tn21.1 291 14542-14832 -
Class:   Passenger Gene
Sub Class:   Other
Sequence Family:  DUF1010 (Pfam:PF06231)
Protein Sequence:  
MFIQTAFSFS GVIQCLFCLF SGLRLHGLRR FSVFLASSPC VASASSYRFC SAVPPRWRSV FSRLAPVAKF KLSVLASGSN ISVKPTRILR SAYLAR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
dfrA12 (ARO:3002858) DfrA12 In_Tn21.1 498 14944-15441 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Target:   diaminopyrimidine antibiotic (ARO:3000171)
Sequence Family:  trimethoprim resistant dihydrofolate reductase dfr (ARO:3001218)
Comment:   100% identity with reference sequence for ARO:3002858 (bitscore: 339)||Synonyms:
Protein Sequence:  
MNSESVRIYL VAAMGANRVI GNGPNIPWKI PGEQKIFRRL TEGKVVVMGR KTFESIGKPL PNRHTLVISR QANYRATGCV VVSTLSHAIA LASELGNELY
VAGGAEIYTL ALPHAHGVFL SEVHQTFEGD AFFPMLNETE FELVSTETIQ AVIPYTHSVY ARRNG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 In_Tn21.1 1014 15586-16599 +
Class:   Integron Integrase
Sub Class:   Class 1
Function:   Integrase
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LPTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpM TnpM Tn21.1 351 16802-17152 +
Class:   Accessory Gene
Sub Class:   Inhibitor
Function:   transposition regulator; reported to enhance Tn21 transposition and suppress resolution of cointegrate replicons in vivo
Comment:   3'-end of urfM ORF, which is interrupted by insertion of In2||inhibits tranposition probably by inhibiting resolution
Protein Sequence:  
MEVVAEGVET PDCLAWLRQA GCDTVQGFLF ARPMPAAAFV GFVNQWRNTT MNANEPSTSC CVCCKEIPLD AAFTPEGAEY VEHFCGLECY QRFQARASTA
TETSVKPDAC DSPPSG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR 5'-end N Tn21.1 23 17278-17300 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   tnpR ORF interrupted by IS26 insertion
Protein Sequence:  
MTGQRIG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA IS26 705 17372-18076 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MNPFKGRHFQ RDIILWAVRW YCKYGISYRE LQEMLAERGV NVDHSTIYRW VQRYAPEMEK RLRWYWRNPS DLCPWHMDET YVKVNGRWAY LYRAVDSRGR
TVDFYLSSRR NSKAAYRFLG KILNNVKKWQ IPRFINTDKA PAYGRALALL KREGRCPSDV EHRQIKYRNN VIECDHGKLK RIIGATLGFK SMKTAYATIK
GIEVMRALRK GQASAFYYGD PLGEMRLVSR VFEM

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR 3'-end N Tn21.1 538 18129-18666 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   tnpR ORF interrupted by IS26 insertion
Protein Sequence:  
YQGQHLRPEP GTATGRRQG* SRF*RQGIRQ GCQASATGSA DKLRPHRRHR GGA*HGSPGA QSR*FAPDRA NADTTRRAYR IRQGTPQFYW RRLSDGEPDA
LGDGRVRRVR ARPDPRASAR GYCARQATRG LPWQEEIPVV *AYCRTAPTC RGWRAKDQAC S*IRNQSRNP VSILENGSV

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn21.1 2967 18669-21635 +
Class:   Transposase
Function:   transposition, DNA-mediated (GO:0006313)
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRSILSAA ERESLLALPD SKDDLIRHYT FNDTDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEL PFPPLLKLVA DQLKVGVESW NEYGQREQTR
REHLSELQTV FGFRPFTMSH YRQAVQMLTE LAMQTDKGIV LASALIGHLR RQSVILPALN AVERASAEAI TRANRRIYDA LAEPLADAHR RRLDDLLKRR
DNGKTTWLAW LRQSPAKPNS RHMLEHIERL KAWQALDLPT GIERLVHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LATEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLY GRIGQALIDA KQSGRDAFAA IEAVMSWDSF AESVTEAQKL AQPDDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKN VLDAIEVLRG MNTDNARKLP ADAPTGFIKP RWQKLVMTDA GIDRRYYELC ALSELKNSLR SGDIWVQGSR QFKDFEDYLV PPEKFTSLKQ
SSELPLAVAT DCEQYLHERL TLLEAQLATV NRMAAANDLP DAIITESGLK ITPLDAAVPD TAQALIDQTA MVLPHVKITE LLLEVDEWTG FTRHFTHLKS
GDLAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHTRDET YSTALAELVN AQFRHPFAGH WGDGTTSSSD GQNFRTASKA KSTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGLRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERAAHALRGN GHAVDDSLLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
In_Tn21.1-MH257753 In Integron 4634-16801 12168
IS26-MH257753 IS26 Insertion Sequence 6027-6846 820
IS26-MH257753 IS26 Insertion Sequence 17309-18128 820

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
repeat i4 Tn5053 10-28 TCAGAAAACG GAAAATAAA
IRt In_Tn21.1 4634-4666 TGTCATTTTC AGAAGACGAC TGCACCAGTT GAT
repeat t1 In_Tn21.1 4642-4660 TCAGAAGACG ACTGCACCA
repeat t2 In_Tn21.1 4682-4700 AACACGTCGG TCGAGGACT
repeat t3 In_Tn21.1 4711-4730 TCAGAAGTGA TCTGCACCAA
repeat t4 In_Tn21.1 4743-4761 TCAATACTCG TGTGCACCA
IRL IS26 6027-6040 GGCACTGTTG CAAA
IRR IS26 6833-6846 AAACGTTGTC ACGG
repeat i4 In_Tn21.1 16682-16700 AGGAGGGACG CAGGCGACT
repeat i3 In_Tn21.1 16710-16728 CGTCGGGCAG CAACGGACT
repeat i2 In_Tn21.1 16752-16770 ATCACGTCAG CCGAAGACT
IRi In_Tn21.1 16769-16801 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 In_Tn21.1 16775-16793 GTCACGTCGG CAGAAGACT
IRL IS26 17309-17322 GGCACTGTTG CAAA
IRR IS26 18115-18128 AAACGTTGTC ACGG
IRR Tn21.1 21628-21668 GCCGAATCGC ACGAAATAAA AGGCAAAAGA CTCTGCTGGG G