Transposon
Name: Tn21
Family: Tn3        Group: Tn21
Evidence of Transposition: yes
 Host     

Host Organism:Shigella flexneri Molecular Source:plasmid NR1 (R100)
Place of Origin:Japan Date of Isolation:1950s

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  19672 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGCACCT CAGAAAACGG AAAATAAAGC ACGCTAAGGC ATAGCTGACC TTGCCAGGCC TGCTTCGCCC TGTAGTGACG CGATCAACGG GCAGGAAACA 100
TTCCCCTTTC GTGCATGGCA GGCGCACACG AGTTCAGACA GCACGGTTTC CATGCGCGCC AAGTCGGCCA TCTTCTCGCG CACGTCCTTG AGCTTGTGTT 200
CGGCCAGGCT GCTGGCCTCC TCGCAGTGGG TGCCATCGTC GAGCCGCAAC AGCTCGGCAA TCTCGTCCAG ACTGAACCCC AGCCGCTGTG CCGATTTCAC 300
GAATTTCACC CGAACCACGT CCGCCTCCCC ATAGCGGCGG ATGCTGCCGT AAGGCTTGTC CGGTTCCCGC AACAGGCCCT TGCGCTGATA GAAGCGGATT 400
GTCTCCACGT TGACCCCGGC CGCCTTGGCA AAAACGCCAA TGGTCAGGTT TTCCAAATTA TTTTCCATAT CGCTTGACTC CGTACATGAG TACGGAAGTA 500
AGGTTACGCT ATCCAATCCA AATTCAAAAG GGCCAACGTA TGTCTGAACC ACAAAACGGG CGCGGTGCGC TCTTCGCCGG CGGGCTGGCC GCCATTCTTG 600
CATCGACCTG CTGCCTGGGG CCGCTAGTAC TGGTCGCCCT GGGCTTCTCC GGTGCTTGGA TCGGCAACCT GACGGTGCTG GAACCCTATC GACCGTTGTT 700
CATCGGCGCG GCGCTAGTGG CGCTGTTCTT CGCCTGGAAG CGGATTTACC GGCCCGTGCA GGCATGCAAG CCAGGTGAGG TCTGCGCGAT TCCGCAGGTG 800
CGCGCCACCT ACAAGCTGAT TTTCTGGATC GTGGCCGTGC TGGTCCTGGT CGCGCTTGGA TTTCCCTATG TCGTTCCATT TTTCTATTAA CCAGGAGTTC 900
ATCATGAAGA AACTGTTTGC CTCCCTTGCC CTCGCCGCCG CTGTTGCCCC GGTGTGGGCC GCTACCCAGA CCGTCACGCT AGCGGTTCCC GGCATGACTT 1000
GCGCCGCCTG CCCGATCACA GTCAAGAAAG CGCTCTCCAA GGTCGAAGGC GTGAGCAAGG TCGATGTGGG CTTCGAGAAG CGCGAGGCCG TCGTCACTTT 1100
TGACGACACC AAGGCCAGCG TACAGAAGCT GACCAAGGCC ACCGCAGACG CCGGCTATCC GTCCAGCGTC AAGCAGTGAG CCAGCAAGCC AACGACAACA 1200
GCGAGAGCCG CTTCATGGGA CTGATGACAC GCATTGCCGA TAAAACCGGC GCGCTCGGCA GCGTCGTTTC CGCGATGGGC TGCGCCGCCT GCTTTCCAGC 1300
CCTCGCCAGC TTCGGCGCGG CCATCGGGCT GGGCTTCTTG AGCCAGTACG AGGGACTGTT CATCAGCCGC CTGCTGCCGC TGTTTGCCGC GCTGGCCTTC 1400
CTGGCGAACG CGCTGGGTTG GTTCAGTCAT CGGCAATGGC TGCGCAGTCT GCTCGGCATG ATCGGCCCGG CCATCGTGTT TGCGGCCACG GTCTGGCTGC 1500
TCGGCAACTG GTGGACGGCG AACCTGATGT ACGTCGGCCT GGCCTTGATG ATTGGGGTGT CGATCTGGGA CTTCGTGTCG CCGGCGCATC GCCGTTGCGG 1600
ACCGGACGGC TGCGAACTCC CCGCCAAGCG CTTGTGAAAG ACGGCTGACC GTGCGACACG GCGGCCCACA CGAATAAGGA ACGATGGTAT GAGCACTCTC 1700
AAAATCACCG GCATGACTTG CGACTCGTGC GCAGTGCATG TCAAGGACGC CCTGGAGAAA GTGCCCGGCG TGCAATCAGC GGATGTCTCC TACGCCAAGG 1800
GCAGCGCCAA GCTCGCCATT GAGGTCGGCA CGTCACCCGA CGCGCTGACG GCCGCTGTAG CTGGACTCGG TTATCGGGCC ACGCTGGCCG ATGCCCCCTC 1900
AGTTTCGACG CCGGGCGGAT TGCTCGACAA GATGCGCGAT CTGCTGGGCA GAAACGACAA GACGGGTAGC AGCGGCGCAT TGCATATCGC CGTCATCGGC 2000
AGCGGCGGGG CCGCGATGGC AGCGGCGCTG AAGGCCGTCG AGCAAGGCGC ACGTGTCACG CTGATCGAGC GCGGCACCAT CGGCGGCACC TGCGTCAATG 2100
TCGGTTGTGT GCCGTCCAAG ATCATGATCC GCGCCGCCCA TATCGCCCAT CTGCGCCGGG AAAGCCCGTT CGATGGCGGC ATCGCCGCTA CCACGCCGAC 2200
CATCCAGCGC ACGGCGCTGC TGGCCCAGCA GCAGGCCCGC GTCGATGAAC TGCGCCACGC CAAGTACGAA GGCATCTTGG AGGGCAATCC GGCGATCACT 2300
GTGCTGCACG GCTCCGCCCG CTTTAAGGAC AATCGCAACC TGATCGTGCA ACTCAACGAC GGCGGCGAGC GCGTGGTGGC ATTCGACCGC TGCCTGATCG 2400
CCACCGGCGC GAGCCCGGCC GTGCCGCCGA TTCCCGGCCT GAAAGACACT CCGTACTGGA CTTCCACTGA AGCGCTGGTC AGCGAGACGA TTCCTAAGCG 2500
CCTGGCCGTG ATTGGCTCAT CAGTGGTGGC GCTGGAGCTG GCGCAGGCGT TCGCCCGACT CGGAGCGAAG GTGACGATCC TGGCTCGCAG CACGCTGTTC 2600
TTCCGCGAAG ACCCAGCTAT AGGCGAAGCC GTCACGGCCG CATTCCGCAT GGAGGGCATC GAGGTGAGGG AACACACCCA GGCCAGCCAG GTCGCGTATA 2700
TCAATGGTGA AGGGGACGGC GAATTCGTGC TCACCACGGC GCACGGCGAA CTGCGCGCCG ACAAGCTGCT GGTCGCCACC GGCCGCGCGC CCAACACACG 2800
CAAGCTGGCA CTGGATGCGA CGGGCGTCAC GCTCACCCCG CAAGGCGCTA TCGTCATCGA CCCCGGCATG CGTACAAGCG TGGAACACAT CTACGCCGCA 2900
GGCGACTGCA CCGACCAGCC GCAGTTCGTC TATGTGGCGG CAGCGGCCGG CACTCGCGCC GCGATCAACA TGACCGGCGG TGACGCGGCC CTGAACCTGA 3000
CCGCGATGCC GGCCGTGGTG TTCACCGACC CGCAAGTGGC GACCGTAGGC TACAGCGAGG CGGAAGCGCA CCATGACGGC ATCAAAACTG ATAGTCGCAC 3100
GCTAACGCTG GACAACGTGC CGCGCGCGCT CGCCAACTTC GACACGCGCG GCTTCATCAA ACTGGTGGTT GAAGAAGGCA GCGGACGACT GATCGGCGTG 3200
CAGGCAGTGG CCCCGGAAGC GGGCGAACTG ATCCAGACGG CCGCACTGGC GATTCGCAAC CGGATGACGG TGCAGGAACT GGCCGACCAG TTGTTCCCCT 3300
ACCTGACGAT GGTCGAAGGG TTGAAGCTCG CGGCGCAGAC CTTCAACAAG GATGTGAAGC AGCTTTCCTG CTGCGCCGGG TGAGGACAAG GAGGTGTGCG 3400
ATGAGCGCCT ACACGGTATC GCAACTGGCC CATAACGCTG GGGTGAGCGT ACATATCGTG CGCGACTACC TGGTGCGCGG CTTGTTACGG CCGGTGGCCT 3500
GCACCACGGG CGGCTACGGC GTGTTCGACG ATGCGGCCTT GCAACGGCTG TGCTTCGTGC GCGCGGCCTT CGAGGCGGGT ATCGGCCTGG ATGCCCTGGC 3600
GCGGCTGTGC CGTGCGCTCG ACGCAGCGGA CGGCGCACAA GCCGCAGCGC AGCTTGCCGT GCTGCGCCAG TTGGTCGAGC GGCGGCGCGC GGCGTTGGCC 3700
CATCTGGACG CGCAACTGGC CTCCATGCCA GCCGAGCGGG CGCACGAGGA GGCATTGCCG TGAACGCCCC TGACAAACTG CCGCCCGAGA CGCGCCAACC 3800
CGTTTCCGGC TACCTGTGGG GTGCGCTGGC CGTGTTGACC TGCCCCTGCC ATCTGCCGAT TCTCGCCGCC GTGCTGGCCG GGACGACCGC CGGTGCCTTC 3900
CTTGGCGAGC ATTGGGGTGT TGCCGCGCTC GCGCTGACCG GCTTGTTCGT TCTGGCCGTA ACGCGGCTGC TGCGCGCCTT CCGGGGCGGA TCATGACGAG 4000
TTCGCAGCCC GCCGGATGGA CGGCGGCCGA GTTGGCGCAG GCGGCGGCGC GCGGACAGCT TGACCTGCAT TACCAGCCGC TGGTCGATCT GCGCGATCAC 4100
CGGATCGCTG GCGCGGAAGC GTTGATGCGC TGGCGGCATC CGAGGCTTGG CCTGTTGCCG CCCGGCCAGT TCCTGCCGCT GGCCGAGTCG TTCGGCCTGA 4200
TGCCGGAAAT AGGCGCGTGG GTGCTGGGCG AGGCCTGTCG CCAGATGCAC AAGTGGCAAG GACCGGCATG GCAACCGTTC CGTCTTGCCA TCAATGTGTC 4300
CGCCAGCCAG GTTGGGCCAA CGTTCGACGA CGAGGTAAAG CGGGTGCTGG CCGATATGGC CCTGCCCGCC GAGCTTCTGG AGATCGAACT GACCGAATCG 4400
GTCGCATTCG GCAATCCAGC CCTGTTCGCC AGTTTCGACG CCTTGCGCGC CATCGGCGTG CGCTTCGCCG CCGACGACTT CGGCACCGGC TATTCCTGCC 4500
TGCAACATCT GAAATGCTGC CCCATCACCA CATTGAAAAT CGACCAATCC TTTGTCGCCA GGCTCCCGGA TGATGCCCGT GACCAAACTA TCGTGCGGGC 4600
GGTGATCCAG CTCGCGCACG GGCTGGGCAT GGATGTCATT TTCAGAAGAC GACTGCACCA GTTGATTGGG CGTAATGGCT GTTGTGCAGC CAGCTCCTGA 4700
CAGTTCAATA TCAGAAGTGA TCTGCACCAA TCTCGACTAT GCTCAATACT CGTGTGCACC AAAGCGAGGT GAGCATGGCG ACGGACACCC CACGGATTCC 4800
AGAACAAGGC GTGGCCACTC TGCCTGATGA GGCTTGGGAG CGTGCGCGCC GTCGTGCGGA GATCATCAGT CCGTTGGCGC AGTCGGAGAC GGTCGGGCAC 4900
GAAGCGGCCG ATATGGCGGC TCAGGCGCTG GGCTTGTCTC GGCGCCAGGT ATACGTTCTG ATCCGGCGTG CCCGGCAAGG CAGCGGCCTC GTGACGGATC 5000
TGGTGCCCGG CCAGTCCGGT GGAGGTAAAG GTAAGGGGCG CTTGCCGGAA CCGGTCGAGC GCGTCATCCA CGAGCTACTG CAAAAGCGGT TCCTGACCAA 5100
GCAGAAGCGC AGCCTAGCGG CCTTTCACCG CGAAGTCACT CAGGTGTGCA AGGCTCAAAA ACTGCGAGTG CCGGCGCGCA ATACCGTGGC CTTACGGATC 5200
GCTAGCCTTG ACCCGCGCAA GGTCATCCGC CGGCGGGAAG GCCAGGATGC CGCTCGTGAC CTACAAGGTG TGGGCGGCGA GCCTCCTGCC GTGACCGCGC 5300
CGCTGGAGCA GGTGCAGATA GACCATACGG TCATCGACCT GATCGTGGTC GATGACCGCG ACCGGCAACC TATTGGCCGC CCGTACCTGA CCCTCGCCAT 5400
CGACGTGTTC ACCCGCTGCG TGCTCGGCAT GGTCGTCACG CTGGAAGCGC CGTCTGCCGT TTCGGTTGGC CTGTGCCTCG TGCATGTCGC CTGCGACAAG 5500
CGCCCTTGGC TGGAAGGACT GAACGTGGAA ATGGATTGGC AGATGAGCGG CAAGCCCTTG CTGCTCTACC TAGACAACGC GGCCGAGTTC AAGAGCGAGG 5600
CCCTGCGCCG GGGTTGCGAG CAGCATGGCA TCCGGCTGGA CTATCGCCCG CTGGGACAGC CGCACTATGG CGGCATCGTG GAACGGATCA TCGGCACGGC 5700
GATGCAGATG ATTCACGACG AACTGCCGGG AACGACCTTC TCCAACCCTG ACCAGCGCGG CGACTACGAT TCCGAAAACA AGGCCGCCCT GACGCTGCGC 5800
GAGCTAGAGC GCTGGCTCAC ATTGGCGGTC GGCACCTACC ACGGTTCGGT GCACAACGGC CTGCTCCAAC CGCCGGCCGC GCGCTGGGCC GAGGCCGTGG 5900
CGCGTGTCGG CGTACCGGCC GTCGTCACAC GCGCTACTTC GTTCCTGGTC GATTTTCTGC CGATCCTCCG GCGCACGCTG ACCCGCACCG GCTTTGTCAT 6000
CGACCACATC CACTACTACG CCGATGCGCT CAAGCCGTGG ATTGCGCGGC GTGAACGCTG GCCGTCCTTT CTGATCCGGC GCGATCCGCG CGACATCAGC 6100
CGTATCTGGG TCCTGGAACC GGAGGGACAG CATTACCTGG AAATTCCCTA CCGTACCTTG TCGCATCCGG CTGTCACCCT CTGGGAACAA CGGCAGGCGC 6200
TGGCGAAACT GCGGCAGCAA GGGCGCGAAC AGGTGGATGA GTCGGCGCTG TTCCGCATGA TCGGCCAGAT GCGTGAGATT GTGACCAGCG CGCAGAAGGC 6300
CACACGCAAG GCGCGGCGTG ACGCGGATCG CCGCCAGCAC CTCAAGACAT CAGCTCGGCC GGACAAGCCC GTTCCGCCGG ATACGGATAT TGCCGACCCG 6400
CAGGCAGACA ACTTGCCACC CGCCAAACCG TTCGACCAGA TTGAGGAGTG GTAGCCGTGG ACGAATATCC CATCATCGAC CTGTCCCACC TGCTGCCGGC 6500
GGCCCAGGGC TTGGCCCGTC TTCCGGCGGA CGAGCGCATC CAGCGCCTTC GCGCCGACCG CTGGATCGGC TATCCGCGCG CAGTCGAGGC GCTGAACCGG 6600
CTGGAAGCCC TTTATGCGTG GCCAAACAAG CAACGCATGC CCAACCTGCT GCTGGTTGGC CCGACCAACA ATGGCAAGTC GATGATCGTC GAGAAGTTCC 6700
GCCGCACCCA CCCGGCCAGC TCCGACGCCG ACCAGGAGCA CATCCCGGTG TTGGTCGTGC AGATGCCGTC CGAGCCGTCC GTGATCCGCT TCTACGTCGC 6800
GCTGCTCGCC GCGATGGGCG CGCCGCTGCG CCCACGCCCA CGGTTGCCGG AAATGGAGCA ACTGGCTCTG GCACTGCTGC GCAAGGTCGG CGTGCGCATG 6900
CTGGTGATCG ACGAGCTGCA CAACGTGCTG GCCGGCAACA GCGTCAACCG CCGGGAATTC CTCAACCTGC TGCGCTTCCT CGGCAACGAA CTGCGCATCC 7000
CGTTGGTTGG GGTAGGCACG CGCGACGCCT ACCTAGCCAT CCGCTCCGAT GACCAGTTGG AAAATCGCTT CGAGCCGATG ATGCTGCCGG TATGGGAGGC 7100
CAACGACGAT TGCTGCTCAC TGCTGGCCAG CTTCGCCGCT TCGCTCCCGC TGCGCCGGCC TTCCCCAATT GCCACGCTGG ACATGGCTCG CTACCTGCTC 7200
ACACGCAGCG AGGGCACCAT AGGGGAACTG GCGCACTTGC TGATGGCGGC GGCCATCGTC GCCGTGGAGA GCGGCGAGGA AGCGATCAAC CATCGCACAC 7300
TCAGCATGGC CTGTTGAGTT GCATCTAAAA TTGACCCACT GGGGGTGCGG ACGATTTCTT GGACGGTTTA TACGGACATC AATCCGACCG CATGACGATA 7400
CTCGATGGGA CTACGCCCGC CAAGCGACAC TTTGATGCGG CGCTCGTTGT ACCAGTGGAT ATAGGCATCG ATTCGCGTCA TGAGGTCTTT CAGCGTCACG 7500
TGCTGCCAAT TCCTCGGGTA GATTAGTTCG GTCTTCAATC GTCCGAAAAA GCCCTCGCAT GCAGCATTGT CTGGCGAGCA GCCCTTTTTG GACATCGACC 7600
GCGTTAATTG GGCATTTTCA GTGCGGCGGA TCCACGCAGG CCAGCGATAA TGCGAGCCCC TGTCCGAATG GATAACCGGA TGCTCACCGG GTCGCAGTGT 7700
CCGTACCGCG TGATCCAGCA TGGTATTGAC CAGGTTCGCA TCCGGGCTGG TGCCGATATT CCAGGCCACC ACCAGCCCAT CGAAGCAATC GACGATCGGC 7800
GAGACGTAGA CCTTCCCTGC CGGAATGTGT ATTTCCGTCA GATCGGTCAA CCATTTCGTA TTCGGCGCCG ACGCGTGAAA GTCGCGATTC AGCAGATTCG 7900
GGACCGCTGG TGTCGGGTCG CCAGCATACG CCGAGAAGCG CCGGCGGCGC GGTGTTCTCA CGACCAGACG CTCTTGCGCC ATCAAGCGAC GCACGACCTT 8000
CTCGGACACA CGCATGCCAC CAAGGCGCAA GGCACTATCA ATGCGTCGAT AGCCATAGCA GCGGTAGTTG TCCTCGAAGA TAGTCCGAAT GACCTCACGC 8100
ACCTGCGTGT ACTTGTCGGG CCGCGTCTGC CGCAGGCGTT GATAGAAGTA TGTGCTGCGC GCCAGCTTCA GGCCGCACAA CAGATTGGCT AATGGAAACG 8200
TGACTCTGAG GGCATCAACC ACCTTCGTTT TTTCTCGGCT TGTCAGTTCG AGGGGGTTGA TGCCCATGTC TTTTTTTATC AATTCACTCG CCTTCTCCAG 8300
AATTGCATTC TCCATGCGAA GCCGCTGGTT CTGGCTCTCC AGTTCGGCCA GTTCCCTGAG TAGTGCCTCA TGCCGCTGCT CGAGCGAGGT GTCACCTTTC 8400
TTCTTTGTCA TGGGTTTTAG GGGCACTTTG CCAAGTAATC GATGCTGCCA GTTATACAAC GTTGGTCGCG ATACACCGAC AGTGTCGGCC ACATCCTTTG 8500
CCGAACCTAC GCGCAGGTTC AGTGCAATGA CGGCTTGCTG CTTCTCGAGG CGAGAGCGGG CGACTGTGGG AGCGCTGCTG CCGACGACCG TCCTAGCGAA 8600
TTCAGGGCGT AAATCACGGA TCCAGGCACG CAAGGCCTCG CGGCTTGGGT AGCCCAGGCT TCGGATTGTG TGACTCAGGC AGTAGCCTTG TTCGATATAG 8700
TGATCTACTG CCCGTTGCTT TTGCTCATCG GTGTACTGCC GTTTTATCCG TTGATAGCCT CGGCGAAGAT CCTGATTCCG TTCGAATTCT GCCAACCAGG 8800
CCTTCAGCGA GTTCTTGGTG GGGTATCCCA GCTGCCGTAG TGTGGCGCTC ATCCGGCGCC CAAGCTTCAG GTACAACCTC ACGGCTCGAA GGCGATCTTC 8900
ATACGAATAC ATGAACTACT CCTAAAGTAG TCCAAGATTT TGTCCGCACC CCAACTTAGG GTAAAGATTT GCGTCGAAAT TTGACCCACG TATGACACTG 9000
TTTCCCGTCT GGATATGGCG GGAGAAATCA AGGAGTGATA AACGTGGCGA TATTGAGCGC AATTCGACGC TGGCATTTTC GCGATGGTGC GTCGATTCGG 9100
GAAATAGCCC GACGAAGCGG CCTGTCCAGG AACACCGTTC GCAAGTATTT GCAAAGCAAG GTGGTTGAAC CGCAGTACCC AGCGCGAGAC AGCGTTGGCA 9200
AGTTAAGTCC TTTTGAGCCC AAGTTAAGGC AGTGGCTCTC CACCGAGCAC AAAAAGACAA AGAAGCTGCG CAGAAACCTG CGCAGCATGT ACCGGGATTT 9300
GGTCGCTTTG GGCTTTACCG GGTCTTATGA CCGAGTGTGT GCCTTTGCCC GACAGTGGAA AGATTCCGAA CAGTTCAAGG CGCAAACCTC GGGCAAGGGT 9400
TGTTTCATCC CCTTGCGCTT TGCTTGTGGC GAAGCCTTCC AATTCGATTG GAGTGAGGAC TTTGCCCGCA TAGCGGGCAA ACAGGTCAAA CTTCAGATTG 9500
CCCAGTTTAA GTTGGCCCAC AGCCGGGCCT TTGTGCTTCG GGCTTACTAC CAGCAAAAAC ATGAAATGCT GTTTGATGCC CACTGGCATG CCTTTCAAAT 9600
CTTCGGTGGC ATTCCCAAGC GCGGCATCTA CGACAACATG AAGACCGCTG TGGATTCGGT GGGGCGTGGC AAAGAGCGCA GGGTCAATCA GCGGTTCACT 9700
GCCATGGTCA GCCACTACCT GTTTGATGCG CAGTTCTGTA ATCCAGCATC GGGTTGGGAG AAAGGCCAGA TTGAGAAGAA CGTGCAGGAT TCCCGCCAAC 9800
GCCTGTGGCA AGGGGCACCA GACTTTCAAA GCCTTGCTGA TTTGAATGTG TGGCTTGAGC ATCGCTGCAA AGCGCTGTGG TCTGAGCTGC GCCACCCCGA 9900
ATTGGACCAA ACCGTGCAAG AGGCCTTTGC CGATGAACAA GGCGAGTTGA TGGCGCTACC CAATGCCTTT GATGCATTCG TGGAGCAAAC CAAGCGAGTC 10000
ACTTCAACCT GCCTTGTTCA CCACGAGGGC AATCGCTACA GCGTTCCTGC CAGTTACGCC AACAGGGCCA TCAGCCTTCG GATTTATGCA GACAAGCTGG 10100
TGATGGCTGC CGAAGGCCAA CACATTGCCG AGCATCCAAG ATTGTTTGGC AGTGGCCACG CTCGGCGTGG CCACACACAA TACGACTGGC ACCATTACTT 10200
GTCTGTGCTT CAGAAGAAAC CTGGGGCGTT GCGCAATGGT GCGCCATTTG CTGAATTGCC ACCCGCGTTC AAGAAGCTTC AATCCATCTT GCTGCAACGC 10300
CCCGGCGGTG ACCGTGACAT GGTGGAAATT CTGGCCCTTG TATTGCACCA CGATGAAGGT GCGGTACTCA GTGCTGTGGA ATTGGCATTG GAGTGTGGCA 10400
AGCCATCGAA GGAGCATGTG CTTAATCTGT TGGGACGTTT GACCGAAGAA CCTCCACCCA AACCGATTCC AATTCCCAAG GGGTTAAGGC TGACATTGGA 10500
ACCACAGGCC AACGTGAACC GCTATGACAG TTTAAGGAGA GCCCATGATG CAGCATGAAG GCCATGTGAG AATCCTCAAA TCCTTGAAAC TCTTTGGCAT 10600
GGCACACGCC ATTGAGGAGT TGGGCAATCA GAATTCACCA GCATTTAATC AAGCCTTGCC CATGCTGGAC AGCTTGATTA AAGCTGAAGT GGCAGAGCGT 10700
GAAGTACGTT CGGTGAACTA TCAATTGCGG GTGGCCAAGT TCCCCGTGTA TCGGGACTTG GTGGGCTTTG ACTTCAGTCA AAGCCTGGTT AATGAGGCCA 10800
CGGTCAAACA ATTGCACCGG TGCGACTTCA TGGAACAAGC CCAGAACGTG GTGCTGATTG GTGGGCCAGG CACAGGCAAG ACTCACCTGG CCACAGCCAT 10900
TGGTACACAA GCAGTGATGC ACTTGAACCG ACGGGTGCGT TTCTTCTCCA CCGTGGATTT GGTCAATGCA CTGGAGCAAG AGAAATCATC TGGGCGTCAG 11000
GGACAAATCG CAAACCGTCT GTTGTATGCC GATTTGGTGA TTCTGGATGA GCTGGGATAT TTGCCTTTTA GCCAAACCGG TGGGGCACTG CTGTTTCACC 11100
TGCTCTCAAA GCTGTACGAA AAAACCAGCG TGATACTGAC CACCAACTTG AGCTTCTCGG AATGGAGCCG AGTGTTTGGC GATGAAAAGA TGACAACAGC 11200
GTTGTTGGAC CGACTAACCC ACCACTGCCA CATCCTGGAA ACCGGCAATG AAAGTTACCG CTTCAAACAC AGTTCAACTC AGAATAAGCA GGAGGAAAAA 11300
CAGACCCGCA AACTGAAAAT CGAGACATAA TTCTGACAAC AAGGGGTGGG TCAAAATTCA ATGCAAATCC CGGGTCAAAT TTGGGTGCAA ATCAACAGAT 11400
ATCGACAACC TCTCGCGCAA CCAAGACATC GCGGTCGGAC TGCAAGTGAT CTTGAAGCCA CGGGCCCGTC CCACCCCGAC ATGGACCTCG ATGCCCGAAC 11500
GGACGTTAGA TTTCGAGTTC TAGGCGTTCT GCGATGAAGG TTGGATCCCA GCCGGGATTG AAAGTGTCGA CGTGGGTGAA TCCGAGCCGC TCGTATAGGC 11600
CACGCAGGTT CGGGTGGCAG TCGAGCCGCA GCTTGGCGCA CCCCTGCGTT CGCGCGGCAT GGCGGCAAGC CTCGATCAGC GCGGAGCTGA CACCCCGGCC 11700
CGCATGTGTC CGTCGCACCG CGAGCTTGTG CAGATATGCG GCCTCCCCCT TGAGGGCGTC GGGCCAGAAC TCGGGATCCT CGGCCGACAA GGTGCAACAG 11800
CCGACGATGC CGTCGCTGCA ACTCGCGACT AGGAGCTCGG ATCTCAGGAC GAAGGTCTCC GCGAATGTCC GGTCGATCCG CGCGACGTCC CAGGCGGGCG 11900
TTCCCTTGGC GGACATCCAC GCCGCAGCGT CGTGCATCAG CCGCACAACC TCGTCGATAT CACCCGAGCA GGCGACCCGA ACGTTCGGAG GCTCCTCGCT 12000
GTCCATTCGC TCCCCTGGCG CGGTATGAAC CGCCGCCTCA TAGTGCAGTT TGATCCTGAC GAGCCCAGCA TGTCTGCGCC CACCTTCGCG GAACCTGACC 12100
AGGGTCCGCT AGCGGGCGGC CGGAAGGTGA ATGCTAGGCA TGATCTAACC CTCGGTCTCT GGCGTCGCGA CTGCGAAATT TCGCGAGGGT TTCCGAGAAG 12200
GTGATTGCGC TTCGCAGATC TCCAGGCGCG TGGGTGCGGA CGTAGTCAGC GCCATTGCCG ATCGCGTGAA GTTCCGCCGC AAGGCTCGCT GGACCCAGAT 12300
CCTTTACAGG AAGGCCAACG GTGGCGCCCA AGAAGGATTT CCGCGACACC GAGACCAATA GCGGAAGCCC CAACGCCGAC TTCAGCTTTT GAAGGTTCGA 12400
CAGCACGTGC AGCGATGTTT CCGGTGCGGG GCTCAAGAAA AATCCCATCC CCGGATCGAG GATGAGCCGG TCGGCAGCGA CCCCGCTCCG TCGCAAGGCG 12500
GAAACCCGCG CCTCGAAGAA CCGCACAATC TCGTCGAGCG CGTCTTCGGG TCGAAGGTGA CCGGTGCGGG TGGCGATGCC ATCCCGCTGC GCTGAGTGCA 12600
TAACCACCAG CCTGCAGTCC GCCTCAGCAA TATCGGGATA GAGCGCAGGG TCAGGAAATC CTTGGATATC GTTCAGGTAG CCCACGCCGC GCTTGAGCGC 12700
ATAGCGCTGG GTTTCCGGTT GGAAGCTGTC GATTGAAACA CGGTGCATCT GATCGGACAG GGCGTCTAAG AGCGGCGCAA TACGTCTGAT CTCATCGGCC 12800
GGCGATACAG GCCTCGCGTC CGGATGGCTG GCGGCCGGTC CGACATCCAC GACGTCTGAT CCGACTCGCA GCATTTCGAT CGCCGCGGTG ACAGCGCCGG 12900
CGGGGTCTAG CCGCCGGCTC TCATCGAAGA AGGAGTCCTC GGTGAGATTC AGAATGCCGA ACACCGTCAC CATGGCGTCG GCCTCCGCAG CGACTTCCAC 13000
GATGGGGATC GGGCGAGCAA AAAGGCAGCA ATTATGAGCC CCATACCTAC AAAGCCCCAC GCATCAAGCT TTTGCCCATG AAGCAACCAG GCAATGGCTG 13100
TAATTATGAC GACGCCGAGT CCCGACCAGA CTGCATAAGC AACACCGACA GGGATGGATT TCAGAACCAG AGAAAGAAAA TAAAATGCGA TGCCATAACC 13200
GATTATGACA ACGGCGGAAG GGGCAAGCTT AGTAAAGCCC TCGCTAGATT TTAATGCGGA TGTTGCGATT ACTTCGCCAA CTATTGCGAT AACAAGAAAA 13300
AGCCAGCCTT TCATGATATA TCTCCCAATT TGTGTAGGGC TTATTATGCA CGCTTAAAAA TAATAAAAGC AGACTTGACC TGATAGTTTG GCTGTGAGCA 13400
ATTATGTGCT TAGTGCATCT AACGCTTGAG TTAAGCCGCG CCGCGAAGCG GCGTCGGCTT GAACGAATTG TTAGACATTA TTTGCCGACT ACCTTGGTGA 13500
TCTCGCCTTT CACGTAGTGG ACAAATTCTT CCAACTGATC TGCGCGCGAG GCCAAGCGAT CTTCTTCTTG TCCAAGATAA GCCTGTCTAG CTTCAAGTAT 13600
GACGGGCTGA TACTGGGCCG GCAGGCGCTC CATTGCCCAG TCGGCAGCGA CATCCTTCGG CGCGATTTTG CCGGTTACTG CGCTGTACCA AATGCGGGAC 13700
AACGTAAGCA CTACATTTCG CTCATCGCCA GCCCAGTCGG GCGGCGAGTT CCATAGCGTT AAGGTTTCAT TTAGCGCCTC AAATAGATCC TGTTCAGGAA 13800
CCGGATCAAA GAGTTCCTCC GCCGCTGGAC CTACCAAGGC AACGCTATGT TCTCTTGCTT TTGTCAGCAA GATAGCCAGA TCAATGTCGA TCGTGGCTGG 13900
CTCGAAGATA CCTGCAAGAA TGTCATTGCG CTGCCATTCT CCAAATTGCA GTTCGCGCTT AGCTGGATAA CGCCACGGAA TGATGTCGTC GTGCACAACA 14000
ATGGTGACTT CTACAGCGCG GAGAATCTCG CTCTCTCCAG GGGAAGCCGA AGTTTCCAAA AGGTCGTTGA TCAAAGCTCG CCGCGTTGTT TCATCAAGCC 14100
TTACGGTCAC CGTAACCAGC AAATCAATAT CACTGTGTGG CTTCAGGCCG CCATCCACTG CGGAGCCGTA CAAATGTACG GCCAGCAACG TCGGTTCGAG 14200
ATGGCGCTCG ATGACGCCAA CTACCTCTGA TAGTTGAGTC GATACTTCGG CGATCACCGC TTCCCTCATG ATGTTTAACT TTGTTTTAGG GCGACTGCCC 14300
TGCTGCGTAA CATCGTTGCT GCTCCATAAC ATCAAACATC GACCCACGGC GTAACGCGCT TGCTGCTTGG ATGCCCGAGG CATAGACTGT ACCCCAAAAA 14400
AACAGTCATA ACAAGCCATG AAAACCGCCA CTGCGCCGTT ACCACCGCTG CGTTCGGTCA AGGTTCTGGA CCAGTTGCGT GAGCGCATAC GCTACTTGCA 14500
TTACAGCTTA CGAACCGAAC AGGCTTATGT CCACTGGGTT CGTGCCTTCA TCCGTTTCCA CGGTGTGCGT CACCCGGCAA CCTTGGGCAG CAGCGAAGTC 14600
GAGGCATTTC TGTCCTGGCT GGCGAACGAG CGCAAGGTTT CGGTCTCCAC GCATCGTCAG GCATTGGCGG CCTTGCTGTT CTTCTACGGC AAGGTGCTGT 14700
GCACGGATCT GCCCTGGCTT CAGGAGATCG GAAGACCTCG GCCGTCGCGG CGCTTGCCGG TGGTGCTGAC CCCGGATGAA GTGGTTCGCA TCCTCGGTTT 14800
TCTGGAAGGC GAGCATCGTT TGTTCGCCCA GCTTCTGTAT GGAACGGGCA TGCGGATCAG TGAGGGTTTG CAACTGCGGG TCAAGGATCT GGATTTCGAT 14900
CACGGCACGA TCATCGTGCG GGAGGGCAAG GGCTCCAAGG ATCGGGCCTT GATGTTACCC GAGAGCTTGG CACCCAGCCT GCGCGAGCAG CTGTCGCGTG 15000
CACGGGCATG GTGGCTGAAG GACCAGGCCG AGGGCCGCAG CGGCGTTGCG CTTCCCGACG CCCTTGAGCG GAAGTATCCG CGCGCCGGGC ATTCCTGGCC 15100
GTGGTTCTGG GTTTTTGCGC AGCACACGCA TTCGACCGAT CCACGGAGCG GTGTCGTGCG TCGCCATCAC ATGTATGACC AGACCTTTCA GCGCGCCTTC 15200
AAACGTGCCG TAGAACAAGC AGGCATCACG AAGCCCGCCA CACCGCACAC CCTCCGCCAC TCGTTCGCGA CGGCCTTGCT CCGCAGCGGT TACGACATTC 15300
GAACCGTGCA GGATCTGCTC GGCCATTCCG ACGTCTCTAC GACGATGATT TACACGCATG TGCTGAAAGT TGGCGGTGCC GGAGTGCGCT CACCGCTTGA 15400
TGCGCTGCCG CCCCTCACTA GTGAGAGGTA GGGCAGCGCA AGTCAATCCT GGCGGATTCA CTACCCCTGC GCGAAGGCCA TCGGTGCCGC ATCGAACGGC 15500
CGGTTGCGGA AAGTCCTCCC TGCGTCCGCT GATGGCCGGC AGCAGCCCGT CGTTGCCTGA TGGATCCAAC CCCTCCGCTG CTATAGTGCA GTCGGCTTCT 15600
GACGTTCAGT GCAGCCGTCT TCTGAAAACG ACAATGGAGG TGGTAGCCGA GGGTGTGGAA ACACCCGACT GCCTTGCGTG GTTGCGGCAG GCGGGTTGCG 15700
ACACGGTGCA GGGTTTCCTG TTCGCCAGGC CGATGCCGGC GGCGGCCTTC GTCGGCTTCG TCAACCAATG GAGGAACACC ACCATGAACG CCAATGAACC 15800
GAGCACCAGT TGCTGCGTGT GCTGCAAGGA AATCCCGCTC GATGCCGCCT TCACGCCGGA AGGGGCCGAG TACGTGGAGC ATTTCTGCGG GCTGGAGTGC 15900
TATCAGCGCT TCCAGGCGCG GGCCAGCACT GCGACCGAAA CCAGCGTCAA ACCGGACGCT TGTGATTCGC CGCCGTCAGG TTGAGGCATA CCCTAACCTG 16000
ATGTCAGATG CCATGTGTAA ATTGCGTCAG GATAGGATTG AATTTTGAAT TTATTGACAT ATCTCGTTGA AGGTCATAGA GTCTTCCCTG ACATTTTGCA 16100
GGGAATTCCA TGACTGGACA GCGCATTGGG TATATCAGGG TCAGCACCTT CGACCAGAAC CCGGAACGGC AACTGGAAGG CGTCAAGGTT GATCGCGCTT 16200
TTAGCGACAA GGCATCCGGC AAGGATGTCA AGCGTCCGCA ACTGGAAGCG CTGATAAGCT TCGCCCGCAC CGGCGACACC GTGGTGGTGC ATAGCATGGA 16300
TCGCCTGGCG CGCAATCTCG ATGATTTGCG CCGGATCGTG CAAACGCTGA CACAACGCGG CGTGCATATC GAATTCGTCA AGGAACACCT CAGTTTTACT 16400
GGCGAAGACT CTCCGATGGC GAACCTGATG CTCTCGGTGA TGGGCGCGTT CGCCGAGTTC GAGCGCGCCC TGATCCGCGA GCGTCAGCGC GAGGGTATTG 16500
CGCTCGCCAA GCAACGCGGG GCTTACCGTG GCAGGAAGAA ATCCCTGTCG TCTGAGCGTA TTGCCGAACT GCGCCAACGT GTCGAGGCTG GCGAGCAAAA 16600
GACCAAGCTT GCTCGTGAAT TCGGAATCAG TCGCGAAACC CTGTATCAAT ACTTGAGAAC GGATCAGTAA ATATGCCACG TCGTTCCATC CTGTCCGCCG 16700
CCGAGCGGGA AAGCCTGCTG GCGTTGCCGG ACTCCAAGGA CGACCTGATC CGACATTACA CATTCAACGA TACCGACCTC TCGATCATCC GACAGCGGCG 16800
CGGGCCAGCC AATCGGCTGG GCTTCGCGGT GCAGCTCTGT TACCTGCGCT TTCCCGGCGT CATCCTGGGC GTCGATGAAC TACCGTTCCC GCCCTTGTTG 16900
AAGCTGGTCG CCGACCAGCT CAAGGTCGGC GTCGAAAGCT GGAACGAGTA CGGCCAGCGG GAGCAGACCC GGCGCGAGCA CCTGAGCGAG CTGCAAACCG 17000
TGTTCGGTTT CCGGCCCTTC ACCATGAGCC ATTACCGGCA GGCCGTCCAG ATGCTGACCG AGCTGGCGAT GCAAACCGAC AAAGGCATCG TGCTGGCCAG 17100
CGCCTTGATC GGGCACCTGC GGCGGCAGTC GGTCATTCTG CCCGCCCTCA ACGCCGTCGA GCGGGCGAGT GCCGAGGCGA TCACCCGTGC TAACCGGCGC 17200
ATCTACGACG CCTTGGCCGA ACCACTGGCG GACGCGCATC GCCGCCGCCT CGACGATCTG CTCAAGCGCC GGGACAACGG CAAGACGACC TGGTTGGCTT 17300
GGTTGCGCCA GTCTCCGGCC AAGCCAAATT CGCGGCATAT GCTGGAACAC ATCGAACGCC TCAAGGCATG GCAGGCACTC GATCTGCCTA CCGGCATCGA 17400
GCGGCTGGTT CACCAGAACC GCCTGCTCAA GATTGCCCGC GAGGGCGGCC AGATGACACC CGCCGACCTG GCCAAATTCG AGCCGCAACG GCGCTACGCC 17500
ACTCTCGTGG CGCTGGCCAC CGAGGGCATG GCCACCGTCA CCGACGAAAT CATCGACCTG CACGACCGCA TCCTGGGTAA GCTGTTTAAC GCTGCCAAGA 17600
ATAAGCATCA GCAGCAGTTC CAGGCGTCAG GCAAGGCCAT CAACGCCAAG GTACGTCTGT ACGGGCGCAT CGGTCAGGCG CTGATCGACG CCAAGCAATC 17700
AGGCCGCGAT GCGTTTGCCG CCATCGAGGC CGTCATGTCC TGGGATTCCT TTGCCGAGAG CGTCACCGAG GCGCAGAAGC TCGCGCAACC CGATGACTTC 17800
GATTTCCTGC ATCGCATCGG CGAGAGCTAC GCCACCCTGC GCCGCTATGC ACCGGAATTC CTTGCCGTGC TCAAGCTGCG GGCCGCGCCC GCCGCCAAAA 17900
ACGTGCTTGA TGCCATTGAG GTGCTGCGCG GCATGAACAC CGACAACGCC CGCAAGCTGC CAGCCGATGC ACCGACCGGC TTCATCAAGC CGCGCTGGCA 18000
GAAACTGGTG ATGACCGACG CCGGCATCGA CCGGCGCTAC TACGAACTGT GCGCGCTGTC CGAGTTGAAG AACTCCCTGC GCTCGGGCGA CATCTGGGTG 18100
CAGGGTTCAC GCCAGTTCAA GGACTTCGAG GACTACCTGG TACCGCCCGA GAAGTTCACC AGCCTCAAGC AGTCCAGCGA ATTGCCGCTG GCCGTGGCCA 18200
CCGACTGCGA ACAATATCTG CATGAGCGGC TGACGCTGCT GGAAGCACAA CTTGCCACCG TCAACCGCAT GGCGGCAGCC AACGACCTGC CGGATGCCAT 18300
CATCACCGAG TCGGGCTTGA AGATCACGCC GCTGGATGCG GCGGTGCCCG ACACCGCGCA GGCGCTGATA GACCAGACAG CCATGGTCCT GCCGCACGTC 18400
AAGATCACCG AACTGCTGCT CGAAGTCGAT GAGTGGACGG GCTTCACCCG GCACTTCACG CACTTGAAAT CGGGCGATCT GGCCAAGGAC AAGAACCTGT 18500
TGTTGACCAC GATCCTGGCC GACGCGATCA ACCTGGGCCT GACCAAGATG GCCGAGTCCT GCCCCGGCAC GACCTACGCG AAGCTCGCTT GGCTGCAAGC 18600
CTGGCATACC CGCGACGAAA CGTACTCGAC AGCGTTGGCT GAACTGGTCA ACGCTCAGTT TCGGCATCCC TTTGCCGGGC ACTGGGGCGA TGGCACCACA 18700
TCATCATCGG ACGGACAGAA TTTCCGAACC GCTAGCAAGG CAAAGAGCAC GGGGCACATC AACCCAAAAT ATGGCAGCAG CCCAGGACGG ACTTTCTACA 18800
CCCACATCTC CGACCAATAC GCGCCATTCC ACACCAAGGT GGTCAATGTC GGCCTGCGCG ACTCAACCTA CGTGCTCGAC GGCCTGCTGT ACCACGAATC 18900
CGACCTGCGG ATCGAGGAGC ACTACACCGA CACGGCGGGC TTCACCGATC ACGTCTTCGC CCTGATGCAC CTCTTGGGCT TCCGCTTCGC GCCGCGCATC 19000
CGCGACCTGG GCGACACCAA GCTCTACATC CCGAAGGGCG ATGCCGCCTA TGACGCGCTC AAGCCGATGA TCGGCGGCAC GCTCAACATC AAGCACGTCC 19100
GCGCCCATTG GGACGAAATC CTGCGGCTGG CCACCTCGAT CAAGCAGGGC ACGGTGACGG CCTCGCTGAT GCTCAGGAAA CTCGGCAGCT ACCCGCGCCA 19200
GAACGGCTTG GCCGTCGCGC TGCGCGAGTT GGGCCGCATC GAGCGCACGC TGTTCATCCT CGACTGGCTG CAAAGCGTCG AGCTACGCCG CCGCGTGCAT 19300
GCCGGGCTGA ACAAGGGCGA GGCGCGCAAT GCGCTGGCCC GTGCCGTGTT CTTCAACCGC CTTGGTGAAA TCCGTGACCG CAGTTTCGAG CAGCAGCGCT 19400
ACCGGGCCAG CGGCCTCAAC CTGGTGACGG CGGCCATCGT GCTGTGGAAC ACGGTCTACC TGGAGCGTGC GGCGCATGCG TTGCGCGGCA ATGGTCATGC 19500
CGTCGATGAC TCGCTATTGC AGTACCTGTC GCCACTCGGC TGGGAGCACA TCAACCTGAC CGGTGATTAC CTATGGCGCA GCAGCGCCAA GATCGGCGCG 19600
GGGAAGTTCA GGCCGCTACG GCCTCTGCAA CCGGCTTAGC GTGCTTTATT TTCCGTTTTC TGAGACGACC CC

 Recombination Sites     

Name Coordinates Gene Sequence
attC cmlA6 3'-end 4666-4671 6 TTGGGC
attC qacE2 3'-end 7323-7328 6 ATCTAA
attC qacEdelta1_sul1 core 12106-12139 34 CCGCTAGCGG GCGGCCGGAA GGTGAATGCT AGGC
attI 14279-14334 56 CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCA
res 15969-16099 131 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAGA TGCCATGTGT AAATTGCGTC
AGGATAGGAT TGAATTTTGA ATTTATTGAC ATATCTCGTT GAAGGTCATA GAGTCTTCCC
TGACATTTTG C
res_site_I 15969-16007 39 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAG
res_site_II 16021-16064 44 ATTGCGTCAG GATAGGATTG AATTTTGAAT TTATTGACAT ATCT
res_site_III 16068-16099 32 TGAAGGTCAT AGAGTCTTCC CTGACATTTT GC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn21 34-468 Passenger Gene Heavy Metal Resistance -
merT Tn21 540-890 Passenger Gene Heavy Metal Resistance +
merP Tn21 904-1179 Passenger Gene Heavy Metal Resistance +
merC Tn21 1215-1637 Passenger Gene Heavy Metal Resistance +
merA Tn21 1689-3383 Passenger Gene Heavy Metal Resistance +
merD Tn21 3401-3763 Passenger Gene Heavy Metal Resistance +
merE Tn21 3760-3996 Passenger Gene Heavy Metal Resistance +
urfM 5'-end Tn21 3993-4663 Passenger Gene Other +
urfM 5'-end Tn21 3993-4663 Passenger Gene Other +
tniA In2 4775-6454 Transposase   +
tniB delta1 In2 6457-7317 Accessory Gene   +
tnp IS1353 7368-8912 Transposase   -
istA IS1326::IS1353 9035-10558 Transposase   +
istB IS1326::IS1353 10545-11330 Accessory Gene ATPase Transposition Helper +
GNAT_fam In2 11506-12006 Passenger Gene Antibiotic Resistance -
sul1 (ARO:3000410) In2 12134-12973 Passenger Gene Antibiotic Resistance -
qacEdelta1 (ARO:3005010) In2 12967-13314 Passenger Gene Antibiotic Resistance -
aadA (ARO:3002601) In2 13478-14269 Passenger Gene Antibiotic Resistance -
intI1 In2 14418-15431 Integron Integrase Class 1 +
tnpM Tn21 15634-15984 Accessory Gene Inhibitor +
tnpR Tn21 16110-16670 Accessory Gene Resolvase +
tnpA Tn21 16673-19639 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn21 435 34-468 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLREPDKPY GSIRRYGEAD VVRVKFVKSA QRLGFSLDEI AELLRLDDGT HCEEASSLAE HKLKDVREKM
ADLARMETVL SELVCACHAR KGNVSCPLIA SLQGEAGLAR SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn21 351 540-890 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPQNGRGA LFAGGLAAIL ASTCCLGPLV LVALGFSGAW IGNLTVLEPY RPLFIGAALV ALFFAWKRIY RPVQACKPGE VCAIPQVRAT YKLIFWIVAV
LVLVALGFPY VVPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn21 276 904-1179 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFASLAL AAAVAPVWAA TQTVTLAVPG MTCAACPITV KKALSKVEGV SKVDVGFEKR EAVVTFDDTK ASVQKLTKAT ADAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn21 423 1215-1637 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   transmembrane protein mercury transport
Target:   Mercury
Protein Sequence:  
MGLMTRIADK TGALGSVVSA MGCAACFPAL ASFGAAIGLG FLSQYEGLFI SRLLPLFAAL AFLANALGWF SHRQWLRSLL GMIGPAIVFA ATVWLLGNWW
TANLMYVGLA LMIGVSIWDF VSPAHRRCGP DGCELPAKRL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn21 1695 1689-3383 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MSTLKITGMT CDSCAVHVKD ALEKVPGVQS ADVSYAKGSA KLAIEVGTSP DALTAAVAGL GYRATLADAP SVSTPGGLLD KMRDLLGRND KTGSSGALHI
AVIGSGGAAM AAALKAVEQG ARVTLIERGT IGGTCVNVGC VPSKIMIRAA HIAHLRRESP FDGGIAATTP TIQRTALLAQ QQARVDELRH AKYEGILEGN
PAITVLHGSA RFKDNRNLIV QLNDGGERVV AFDRCLIATG ASPAVPPIPG LKDTPYWTST EALVSETIPK RLAVIGSSVV ALELAQAFAR LGAKVTILAR
STLFFREDPA IGEAVTAAFR MEGIEVREHT QASQVAYING EGDGEFVLTT AHGELRADKL LVATGRAPNT RKLALDATGV TLTPQGAIVI DPGMRTSVEH
IYAAGDCTDQ PQFVYVAAAA GTRAAINMTG GDAALNLTAM PAVVFTDPQV ATVGYSEAEA HHDGIKTDSR TLTLDNVPRA LANFDTRGFI KLVVEEGSGR
LIGVQAVAPE AGELIQTAAL AIRNRMTVQE LADQLFPYLT MVEGLKLAAQ TFNKDVKQLS CCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn21 363 3401-3763 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MSAYTVSQLA HNAGVSVHIV RDYLVRGLLR PVACTTGGYG VFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGAQ AAAQLAVLRQ LVERRRAALA
HLDAQLASMP AERAHEEALP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn21 237 3760-3996 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Comment:   similar to urf-1 in pKLH2 (GenBank AF213017), pKLH272 (Genbank Y08992), pMER610 (GenBank Y08993), pKLH210 (GenBank Y10102), Tn5036 (Genbank Y09025), orf1 in Tn501 (GenBank Z00027), and urf-1 in Tn5041 (GenBank X98999)
Protein Sequence:  
MNAPDKLPPE TRQPVSGYLW GALAVLTCPC HLPILAAVLA GTTAGAFLGE HWGVAALALT GLFVLAVTRL LRAFRGGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM 5'-end N Tn21 671 3993-4663 +
Class:   Passenger Gene
Sub Class:   Other
Comment:   urfM ORF interrupted by insertion of In2
Protein Sequence:  
MTSSQPAGWT AAELAQAAAR GQLDLHYQPL VDLRDHRIAG AEALMRWRHP RLGLLPPGQF LPLAESFGLM PEIGAWVLGE ACRQMHKWQG PAWQPFRLAI
NVSASQVGPT FDDEVKRVLA DMALPAELLE IELTESVAFG NPALFASFDA LRAIGVRFAA DDFGTGYSCL QHLKCCPITT LKIDQSFVAR LPDDARDQTI
VRAVIQLAHG LGMDVIFRRR LHQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM 5'-end N Tn21 671 3993-4663 +
Class:   Passenger Gene
Sub Class:   Other
Comment:   urfM ORF interrupted by insertion of In2
Protein Sequence:  
MTSSQPAGWT AAELAQAAAR GQLDLHYQPL VDLRDHRIAG AEALMRWRHP RLGLLPPGQF LPLAESFGLM PEIGAWVLGE ACRQMHKWQG PAWQPFRLAI
NVSASQVGPT FDDEVKRVLA DMALPAELLE IELTESVAFG NPALFASFDA LRAIGVRFAA DDFGTGYSCL QHLKCCPITT LKIDQSFVAR LPDDARDQTI
VRAVIQLAHG LGMDVIFRRR LHQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA In2 1680 4775-6454 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   can be extended upstream by 12 amino acids| identical to tniA (Tn1721 and In2)| 25% amino acid sequence identity to TnsB from Tn7
Protein Sequence:  
MATDTPRIPE QGVATLPDEA WERARRRAEI ISPLAQSETV GHEAADMAAQ ALGLSRRQVY VLIRRARQGS GLVTDLVPGQ SGGGKGKGRL PEPVERVIHE
LLQKRFLTKQ KRSLAAFHRE VTQVCKAQKL RVPARNTVAL RIASLDPRKV IRRREGQDAA RDLQGVGGEP PAVTAPLEQV QIDHTVIDLI VVDDRDRQPI
GRPYLTLAID VFTRCVLGMV VTLEAPSAVS VGLCLVHVAC DKRPWLEGLN VEMDWQMSGK PLLLYLDNAA EFKSEALRRG CEQHGIRLDY RPLGQPHYGG
IVERIIGTAM QMIHDELPGT TFSNPDQRGD YDSENKAALT LRELERWLTL AVGTYHGSVH NGLLQPPAAR WAEAVARVGV PAVVTRATSF LVDFLPILRR
TLTRTGFVID HIHYYADALK PWIARRERWP SFLIRRDPRD ISRIWVLEPE GQHYLEIPYR TLSHPAVTLW EQRQALAKLR QQGREQVDES ALFRMIGQMR
EIVTSAQKAT RKARRDADRR QHLKTSARPD KPVPPDTDIA DPQADNLPPA KPFDQIEEW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB delta1 TniB delta1 In2 861 6457-7317 +
Class:   Accessory Gene
Function:   probable ATP-binding protein.
Comment:   probably truncated by insertion of IS1326::IS1353
Protein Sequence:  
MDEYPIIDLS HLLPAAQGLA RLPADERIQR LRADRWIGYP RAVEALNRLE ALYAWPNKQR MPNLLLVGPT NNGKSMIVEK FRRTHPASSD ADQEHIPVLV
VQMPSEPSVI RFYVALLAAM GAPLRPRPRL PEMEQLALAL LRKVGVRMLV IDELHNVLAG NSVNRREFLN LLRFLGNELR IPLVGVGTRD AYLAIRSDDQ
LENRFEPMML PVWEANDDCC SLLASFAASL PLRRPSPIAT LDMARYLLTR SEGTIGELAH LLMAAAIVAV ESGEEAINHR TLSMAC

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp Tnp IS1353 1545 7368-8912 -
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MYSYEDRLRA VRLYLKLGRR MSATLRQLGY PTKNSLKAWL AEFERNQDLR RGYQRIKRQY TDEQKQRAVD HYIEQGYCLS HTIRSLGYPS REALRAWIRD
LRPEFARTVV GSSAPTVARS RLEKQQAVIA LNLRVGSAKD VADTVGVSRP TLYNWQHRLL GKVPLKPMTK KKGDTSLEQR HEALLRELAE LESQNQRLRM
ENAILEKASE LIKKDMGINP LELTSREKTK VVDALRVTFP LANLLCGLKL ARSTYFYQRL RQTRPDKYTQ VREVIRTIFE DNYRCYGYRR IDSALRLGGM
RVSEKVVRRL MAQERLVVRT PRRRRFSAYA GDPTPAVPNL LNRDFHASAP NTKWLTDLTE IHIPAGKVYV SPIVDCFDGL VVAWNIGTSP DANLVNTMLD
HAVRTLRPGE HPVIHSDRGS HYRWPAWIRR TENAQLTRSM SKKGCSPDNA ACEGFFGRLK TELIYPRNWQ HVTLKDLMTR IDAYIHWYNE RRIKVSLGGR
SPIEYRHAVG LMSV

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istA IstA IS1326::IS1353 1524 9035-10558 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MINVAILSAI RRWHFRDGAS IREIARRSGL SRNTVRKYLQ SKVVEPQYPA RDSVGKLSPF EPKLRQWLST EHKKTKKLRR NLRSMYRDLV ALGFTGSYDR
VCAFARQWKD SEQFKAQTSG KGCFIPLRFA CGEAFQFDWS EDFARIAGKQ VKLQIAQFKL AHSRAFVLRA YYQQKHEMLF DAHWHAFQIF GGIPKRGIYD
NMKTAVDSVG RGKERRVNQR FTAMVSHYLF DAQFCNPASG WEKGQIEKNV QDSRQRLWQG APDFQSLADL NVWLEHRCKA LWSELRHPEL DQTVQEAFAD
EQGELMALPN AFDAFVEQTK RVTSTCLVHH EGNRYSVPAS YANRAISLRI YADKLVMAAE GQHIAEHPRL FGSGHARRGH TQYDWHHYLS VLQKKPGALR
NGAPFAELPP AFKKLQSILL QRPGGDRDMV EILALVLHHD EGAVLSAVEL ALECGKPSKE HVLNLLGRLT EEPPPKPIPI PKGLRLTLEP QANVNRYDSL
RRAHDAA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istB IstB IS1326::IS1353 786 10545-11330 +
Class:   Accessory Gene
Sub Class:   ATPase Transposition Helper
Function:   stimulates transposition
Protein Sequence:  
MMQHEGHVRI LKSLKLFGMA HAIEELGNQN SPAFNQALPM LDSLIKAEVA EREVRSVNYQ LRVAKFPVYR DLVGFDFSQS LVNEATVKQL HRCDFMEQAQ
NVVLIGGPGT GKTHLATAIG TQAVMHLNRR VRFFSTVDLV NALEQEKSSG RQGQIANRLL YADLVILDEL GYLPFSQTGG ALLFHLLSKL YEKTSVILTT
NLSFSEWSRV FGDEKMTTAL LDRLTHHCHI LETGNESYRF KHSSTQNKQE EKQTRKLKIE T

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
GNAT_fam GNAT_fam In2 501 11506-12006 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  GNAT
Protein Sequence:  
MDSEEPPNVR VACSGDIDEV VRLMHDAAAW MSAKGTPAWD VARIDRTFAE TFVLRSELLV ASCSDGIVGC CTLSAEDPEF WPDALKGEAA YLHKLAVRRT
HAGRGVSSAL IEACRHAART QGCAKLRLDC HPNLRGLYER LGFTHVDTFN PGWDPTFIAE RLELEI

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
sul1 (ARO:3000410) Sul1 In2 840 12134-12973 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target replacement (ARO:0001002)
Transpoase Chemistry:   dihydropteroate synthase
Target:   sulfonamide antibiotic (ARO:3000282)||sulfone antibiotic (ARO:3003401)
Sequence Family:  sulfonamide resistant sul (ARO:3004238)
Comment:   perfect match to reference sequence for ARO:3000410
Protein Sequence:  
MVTVFGILNL TEDSFFDESR RLDPAGAVTA AIEMLRVGSD VVDVGPAASH PDARPVSPAD EIRRIAPLLD ALSDQMHRVS IDSFQPETQR YALKRGVGYL
NDIQGFPDPA LYPDIAEADC RLVVMHSAQR DGIATRTGHL RPEDALDEIV RFFEARVSAL RRSGVAADRL ILDPGMGFFL SPAPETSLHV LSNLQKLKSA
LGLPLLVSVS RKSFLGATVG LPVKDLGPAS LAAELHAIGN GADYVRTHAP GDLRSAITFS ETLAKFRSRD ARDRGLDHA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacEdelta1 (ARO:3005010) QacEdelta1 In2 348 12967-13314 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   acridine dye (ARO:3000054)||quaternary ammonium salts
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Comment:   subunit of the qac multidrug efflux pump||perfect match to reference sequence for ARO:3005010 (bitscore:219)
Protein Sequence:  
MKGWLFLVIA IVGEVIATSA LKSSEGFTKL APSAVVIIGY GIAFYFLSLV LKSIPVGVAY AVWSGLGVVI ITAIAWLLHG QKLDAWGFVG MGLIIAAFLL
ARSPSWKSLR RPTPW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aadA (ARO:3002601) AadA In2 792 13478-14269 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Transpoase Chemistry:   aminoglycoside nucleotidyltransferase
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  ANT(3'') (ARO:3004275)
Comment:   perfect match to reference sequence for ARO:3002601||Synonyms: aadA1-pm, aadA, aadA1, aad(3'')(9)
Protein Sequence:  
MREAVIAEVS TQLSEVVGVI ERHLEPTLLA VHLYGSAVDG GLKPHSDIDL LVTVTVRLDE TTRRALINDL LETSASPGES EILRAVEVTI VVHDDIIPWR
YPAKRELQFG EWQRNDILAG IFEPATIDID LAILLTKARE HSVALVGPAA EELFDPVPEQ DLFEALNETL TLWNSPPDWA GDERNVVLTL SRIWYSAVTG
KIAPKDVAAD WAMERLPAQY QPVILEARQA YLGQEEDRLA SRADQLEEFV HYVKGEITKV VGK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 In2 1014 14418-15431 +
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDQL RERIRYLHYS LRTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpM TnpM Tn21 351 15634-15984 +
Class:   Accessory Gene
Sub Class:   Inhibitor
Function:   transposition regulator; reported to enhance Tn21 transposition and suppress resolution of cointegrate replicons in vivo
Comment:   3'-end of urfM ORF, which is interrupted by insertion of In2||inhibits tranposition probably by inhibiting resolution
Protein Sequence:  
MEVVAEGVET PDCLAWLRQA GCDTVQGFLF ARPMPAAAFV GFVNQWRNTT MNANEPSTSC CVCCKEIPLD AAFTPEGAEY VEHFCGLECY QRFQARASTA
TETSVKPDAC DSPPSG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn21 561 16110-16670 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   identical to tnpR (TnAs3 )
Protein Sequence:  
MTGQRIGYIR VSTFDQNPER QLEGVKVDRA FSDKASGKDV KRPQLEALIS FARTGDTVVV HSMDRLARNL DDLRRIVQTL TQRGVHIEFV KEHLSFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKSLSSER IAELRQRVEA GEQKTKLARE FGISRETLYQ YLRTDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn21 2967 16673-19639 +
Class:   Transposase
Function:   transposition, DNA-mediated (GO:0006313)
Transpoase Chemistry:   DDE
Comment:   identical to TnAs3 tnpA
Protein Sequence:  
MPRRSILSAA ERESLLALPD SKDDLIRHYT FNDTDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEL PFPPLLKLVA DQLKVGVESW NEYGQREQTR
REHLSELQTV FGFRPFTMSH YRQAVQMLTE LAMQTDKGIV LASALIGHLR RQSVILPALN AVERASAEAI TRANRRIYDA LAEPLADAHR RRLDDLLKRR
DNGKTTWLAW LRQSPAKPNS RHMLEHIERL KAWQALDLPT GIERLVHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LATEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLY GRIGQALIDA KQSGRDAFAA IEAVMSWDSF AESVTEAQKL AQPDDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKN VLDAIEVLRG MNTDNARKLP ADAPTGFIKP RWQKLVMTDA GIDRRYYELC ALSELKNSLR SGDIWVQGSR QFKDFEDYLV PPEKFTSLKQ
SSELPLAVAT DCEQYLHERL TLLEAQLATV NRMAAANDLP DAIITESGLK ITPLDAAVPD TAQALIDQTA MVLPHVKITE LLLEVDEWTG FTRHFTHLKS
GDLAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHTRDET YSTALAELVN AQFRHPFAGH WGDGTTSSSD GQNFRTASKA KSTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGLRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERAAHALRGN GHAVDDSLLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
In2-AF071413 In2 Integron 4634-15633 11000
IS1326_IS1353-AF071413 IS1326 Insertion Sequence 7312-11397 4086
IS1353-AF071413 IS1353 Insertion Sequence 7340-8953 1614

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
repeat i4 Tn5053 10-28 TCAGAAAACG GAAAATAAA
IRt In2 4634-4666 TGTCATTTTC AGAAGACGAC TGCACCAGTT GAT
repeat t1 In2 4642-4660 TCAGAAGACG ACTGCACCA
repeat t2 In2 4682-4700 AACACGTCGG TCGAGGACT
repeat t3 In2 4711-4730 TCAGAAGTGA TCTGCACCAA
repeat t4 In2 4743-4761 TCAATACTCG TGTGCACCA
IRL IS1326::IS1353 7312-7337 TGTTGAGTTG CATCTAAAAT TGACCC
IRR IS1353 7340-7352 TGGGGGTGCG GAC
IRL IS1353 8942-8953 CAGGCGTGGG GT
IRR IS1326::IS1353 11372-11397 CCCAGTTTAA ACCCACGTTT AGTTGT
repeat i4 In2 15514-15532 AGGAGGGACG CAGGCGACT
repeat i3 In2 15542-15560 CGTCGGGCAG CAACGGACT
repeat i2 In2 15584-15602 ATCACGTCAG CCGAAGACT
IRi In2 15601-15633 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 In2 15607-15625 GTCACGTCGG CAGAAGACT
IRR Tn21 19635-19672 GAATCGCACG AAATAAAAGG CAAAAGACTC TGCTGGGG

 References     

1.NAKAYA R, NAKAMURA A, MURATA Y. Resistance transfer agents in Shigella. Biochem Biophys Res Commun. 1960 Dec;3:654-9. doi: 10.1016/0006-291x(60)90081-4. PubMed ID: 13727669
2.Kopecko DJ, Brevet J, Cohen SN. Involvement of multiple translocating DNA segments and recombinational hotspots in the structural evolution of bacterial plasmids. J Mol Biol. 1976 Dec;108(2):333-60. PubMed ID: 796463
3.Diver WP, Grinsted J, Fritzinger DC, Brown NL, Altenbuchner J, Rogowsky P, Schmitt R. DNA sequences of and complementation by the tnpR genes of Tn21, Tn501 and Tn1721. Mol Gen Genet. 1983;191(2):189-93. PubMed ID: 6312271
4.Zheng ZX, Chandler M, Hipskind R, Clerget M, Caro L. Dissection of the r-determinant of the plasmid R100.1: the sequence at the extremities of Tn21. Nucleic Acids Res. 1981 Dec 11;9(23):6265-78. doi: 10.1093/nar/9.23.6265. PubMed ID: 6275355
5.Barrineau P, Gilbert P, Jackson WJ, Jones CS, Summers AO, Wisdom S. The DNA sequence of the mercury resistance operon of the IncFII plasmid NR1. J Mol Appl Genet. 1984;2(6):601-19. PubMed ID: 6530603
6.Misra TK, Brown NL, Fritzinger DC, Pridmore RD, Barnes WM, Haberstroh L, Silver S. Mercuric ion-resistance operons of plasmid R100 and transposon Tn501: the beginning of the operon including the regulatory region and the first two structural genes. Proc Natl Acad Sci U S A. 1984 Oct;81(19):5975-9. doi: 10.1073/pnas.81.19.5975. PubMed ID: 6091128
7.Misra TK, Brown NL, Haberstroh L, Schmidt A, Goddette D, Silver S. Mercuric reductase structural genes from plasmid R100 and transposon Tn501: functional domains of the enzyme. Gene. 1985;34(2-3):253-62. PubMed ID: 2989109
8.Rogowsky P, Halford SE, Schmitt R. Definition of three resolvase binding sites at the res loci of Tn21 and Tn1721. EMBO J. 1985 Aug;4(8):2135-41. PubMed ID: 2998784
9.Hyde DR, Tu CP. tnpM: a novel regulatory gene that enhances Tn21 transposition and suppresses cointegrate resolution. Cell. 1985 Sep;42(2):629-38. PubMed ID: 2992807
10.Brown NL, Misra TK, Winnie JN, Schmidt A, Seiff M, Silver S. The nucleotide sequence of the mercuric resistance operons of plasmid R100 and transposon Tn501: further evidence for mer genes which enhance the activity of the mercuric ion detoxification system. Mol Gen Genet. 1986 Jan;202(1):143-51. doi: 10.1007/BF00330531. PubMed ID: 3007931
11.Ward E, Grinsted J. The nucleotide sequence of the tnpA gene of Tn21. Nucleic Acids Res. 1987 Feb 25;15(4):1799-806. doi: 10.1093/nar/15.4.1799. PubMed ID: 3029727
12.Sundström L, Rådström P, Swedberg G, Sköld O. Site-specific recombination promotes linkage between trimethoprim. Mol Gen Genet. 1988 Aug;213(2-3):191-201. doi: 10.1007/BF00339581. PubMed ID: 3054482
13.Schmidt FR, Nucken EJ, Henschke RB. Structure and function of hot spots providing signals for site-directed specific recombination and gene expression in Tn21 transposons. Mol Microbiol. 1989 Nov;3(11):1545-55. PubMed ID: 2559298
14.Stokes HW, Hall RM. A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons. Mol Microbiol. 1989 Dec;3(12):1669-83. doi: 10.1111/j.1365-2958.1989.tb00153.x. PubMed ID: 2560119
15.Guerineau F, Brooks L, Mullineaux P. Expression of the sulfonamide resistance gene from plasmid R46. Plasmid. 1990 Jan;23(1):35-41. PubMed ID: 2190244
16.Mercier J, Lachapelle J, Couture F, Lafond M, Vézina G, Boissinot M, Levesque RC. Structural and functional characterization of tnpI, a recombinase locus in Tn21 and related beta-lactamase transposons. J Bacteriol. 1990 Jul;172(7):3745-57. doi: 10.1128/jb.172.7.3745-3757.1990. PubMed ID: 2163386
17.Allmeier H, Cresnar B, Greck M, Schmitt R. Complete nucleotide sequence of Tn1721: gene organization and a novel gene product with features of a chemotaxis protein. Gene. 1992 Feb 1;111(1):11-20. PubMed ID: 1312499
18.Summers AO. Untwist and shout: a heavy metal-responsive transcriptional regulator. J Bacteriol. 1992 May;174(10):3097-101. doi: 10.1128/jb.174.10.3097-3101.1992. PubMed ID: 1577681
19.Lévesque C, Brassard S, Lapointe J, Roy PH. Diversity and relative strength of tandem promoters for the antibiotic-resistance genes of several integrons. Gene. 1994 May 3;142(1):49-54. doi: 10.1016/0378-1119(94)90353-0. PubMed ID: 8181756
20.Rådström P, Sköld O, Swedberg G, Flensburg J, Roy PH, Sundström L. Transposon Tn5090 of plasmid R751, which carries an integron, is related to Tn7, Mu, and the retroelements. J Bacteriol. 1994 Jun;176(11):3257-68. doi: 10.1128/jb.176.11.3257-3268.1994. PubMed ID: 8195081
21.Recchia GD, Stokes HW, Hall RM. Characterisation of specific and secondary recombination sites recognised by the integron DNA integrase. Nucleic Acids Res. 1994 Jun 11;22(11):2071-8. doi: 10.1093/nar/22.11.2071. PubMed ID: 8029014
22.Hall RM, Brown HJ, Brookes DE, Stokes HW. Integrons found in different locations have identical 5' ends but variable 3' ends. J Bacteriol. 1994 Oct;176(20):6286-94. doi: 10.1128/jb.176.20.6286-6294.1994. PubMed ID: 7929000
23.Recchia GD, Hall RM. Gene cassettes: a new class of mobile element. Microbiology. 1995 Dec;141 ( Pt 12):3015-27. doi: 10.1099/13500872-141-12-3015. PubMed ID: 8574395
24.Brown HJ, Stokes HW, Hall RM. The integrons In0, In2, and In5 are defective transposon derivatives. J Bacteriol. 1996 Aug;178(15):4429-37. doi: 10.1128/jb.178.15.4429-4437.1996. PubMed ID: 8755869
25.Collis CM, Kim MJ, Stokes HW, Hall RM. Binding of the purified integron DNA integrase Intl1 to integron. Mol Microbiol. 1998 Jul;29(2):477-90. doi: 10.1046/j.1365-2958.1998.00936.x. PubMed ID: 9720866
26.Gravel A, Fournier B, Roy PH. DNA complexes obtained with the integron integrase IntI1 at the attI1 site. Nucleic Acids Res. 1998 Oct 1;26(19):4347-55. doi: 10.1093/nar/26.19.4347. PubMed ID: 9742234
27.Liebert CA, Hall RM, Summers AO. Transposon Tn21, flagship of the floating genome. Microbiol Mol Biol Rev. 1999 Sep;63(3):507-22. PubMed ID: 10477306
28.Partridge SR, Hall RM. In34, a complex In5 family class 1 integron containing orf513 and dfrA10. Antimicrob Agents Chemother. 2003 Jan;47(1):342-9. doi: 10.1128/aac.47.1.342-349.2003. PubMed ID: 12499211
29.Kholodii G, Mindlin S, Petrova M, Minakhina S. Tn5060 from the Siberian permafrost is most closely related to the ancestor of Tn21 prior to integron acquisition. FEMS Microbiol Lett. 2003 Sep 26;226(2):251-5. doi: 10.1016/S0378-1097(03)00559-7. PubMed ID: 14553919