Transposon
Name: Tn20
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Escherichia coli
Date of Isolation:1931

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGAGGGAGTGACCATCTCATTAAATAAAGCACGCTAAG
IRR (Length: 38 bp)GGAGGGAGTGACCATCTCATTAAATAAAGCACGCTAAG

 Sequence     
DNA SequenceLength  8644 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGAGGGAGTG ACCATCTCAT TAAATAAAGC ACGCTAAGGC ATAGCTGACC TTGCCAGGCC TGCTTCGCCC TGTAGTGACG CGATCAACGG GCAGGAAACA 100
TTCCCCTTTC GTGCATGGCA GGCGCACACG AGTTCAGACA GCACGGTTTC CATGCGCGCC AAGTCGGCCA TCTTCTCGCG CACGTCCTTG AGCTTGTGTT 200
CGGCCAGGCT GCTGGCCTCC TCGCAGTGGG TGCCATCGTC GAGCCGCAAC AGCTCGGCAA TCTCGTCCAG ACTGAACCCC AGCCGCTGTG CCGATTTCAC 300
GAATTTCACC CGAACCACGT CCGCCTCCCC ATAGCGGCGG ATGCTGCCGT AAGGCTTGTC CGGTTCCCGC AACAGGCCCT TGCGCTGATA GAAGCGGATT 400
GTCTCCACGT TGACCCCGGC CGCCTTGGCA AAAACGCCAA TGGTCAGGTT TTCCAAATTA TTTTCCATAT CGCTTGACTC CGTACATGAG TACGGAAGTA 500
AGGTTACGCT ATCCAATCCA AATTCAAAAG GGCCAACGTA TGTCTGAACC ACAAAACGGG CGCGGTGCGC TCTTCGCCGG CGGGCTGGCC GCCATTCTTG 600
CATCGACCTG CTGCCTGGGG CCGCTAGTAC TGGTCGCCCT GGGCTTCTCC GGTGCTTGGA TCGGCAACCT GACGGTGCTG GAACCCTATC GACCGTTGTT 700
CATCGGCGCG GCGCTAGTGG CGCTGTTCTT CGCCTGGAAG CGGATTTACC GGCCCGTGCA GGCATGCAAG CCAGGTGAGG TCTGCGCGAT TCCGCAGGTG 800
CGCGCCACCT ACAAGCTGAT TTTCTGGATC GTGGCCGTGC TGGTCCTGGT CGCGCTTGGA TTTCCCTATG TCGTTCCATT TTTCTATTAA CCAGGAGTTC 900
ATCATGAAGA AACTGTTTGC CTCCCTTGCC CTCGCCGCCG CTGTTGCCCC GGTGTGGGCC GCTACCCAGA CCGTCACGCT AGCGGTTCCC GGCATGACTT 1000
GCGCCGCCTG CCCGATCACA GTCAAGAAAG CGCTCTCCAA GGTCGAAGGC GTGAGCAAGG TCGATGTGGG CTTCGAGAAG CGCGAGGCCG TCGTCACTTT 1100
TGACGACACC AAGGCCAGCG TACAGAAGCT GACCAAGGCC ACCGCAGACG CCGGCTATCC GTCCAGCGTC AAGCAGTGAG CCAGCAAGCC AACGACAACA 1200
GCGAGAGCCG CTTCATGGGA CTGATGACAC GCATTGCCGA TAAAACCGGC GCGCTCGGCA GCGTCGTTTC CGCGATGGGC TGCGCCGCCT GCTTTCCAGC 1300
CCTCGCCAGC TTCGGCGCGG CCATCGGGCT GGGCTTCTTG AGCCAGTACG AGGGACTGTT CATCAGCCGC CTGCTGCCGC TGTTTGCCGC GCTGGCCTTC 1400
CTGGCGAACG CGCTGGGTTG GTTCAGTCAT CGGCAATGGC TGCGCAGTCT GCTCGGCATG ATCGGCCCGG CCATCGTGTT TGCGGCCACG GTCTGGCTGC 1500
TCGGCAACTG GTGGACGGCG AACCTGATGT ACGTCGGCCT GGCCTTGATG ATTGGGGTGT CGATCTGGGA CTTCGTGTCG CCGGCGCATC GCCGTTGCGG 1600
ACCGGACGGC TGCGAACTCC CCGCCAAGCG CTTGTGAAAG ACGGCTGACC GTGCGACACG GCGGCCCACA CGAATAAGGA ACGATGGTAT GAGCACTCTC 1700
AAAATCACCG GCATGACTTG CGACTCGTGC GCAGTGCATG TCAAGGACGC CCTGGAGAAA GTGCCCGGCG TGCAATCAGC GGATGTCTCC TACGCCAAGG 1800
GCAGCGCCAA GCTCGCCATT GAGGTCGGCA CGTCACCCGA CGCGCTGACG GCCGCTGTAG CTGGACTCGG TTATCGGGCC ACGCTGGCCG ATGCCCCCTC 1900
AGTTTCGACG CCGGGCGGAT TGCTCGACAA GATGCGCGAT CTGCTGGGCA GAAACGACAA GACGGGTAGC AGCGGCGCAT TGCATATCGC CGTCATCGGC 2000
AGCGGCGGGG CCGCGATGGC AGCGGCGCTG AAGGCCGTCG AGCAAGGCGC ACGTGTCACG CTGATCGAGC GCGGCACCAT CGGCGGCACC TGCGTCAATG 2100
TCGGTTGTGT GCCGTCCAAG ATCATGATCC GCGCCGCCCA TATCGCCCAT CTGCGCCGGG AAAGCCCGTT CGATGGCGGC ATCGCCGCTA CCACGCCGAC 2200
CATCCAGCGC ACGGCGCTGC TGGCCCAGCA GCAGGCCCGC GTCGATGAAC TGCGCCACGC CAAGTACGAA GGCATCTTGG AGGGCAATCC GGCGATCACT 2300
GTGCTGCACG GCTCCGCCCG CTTTAAGGAC AATCGCAACC TGATCGTGCA ACTCAACGAC GGCGGCGAGC GCGTGGTGGC ATTCGACCGC TGCCTGATCG 2400
CCACCGGCGC GAGCCCGGCC GTGCCGCCGA TTCCCGGCCT GAAAGACACT CCGTACTGGA CTTCCACTGA AGCGCTGGTC AGCGAGACGA TTCCTAAGCG 2500
CCTGGCCGTG ATTGGCTCAT CAGTGGTGGC GCTGGAGCTG GCGCAGGCGT TCGCCCGACT CGGAGCGAAG GTGACGATCC TGGCTCGCAG CACGCTGTTC 2600
TTCCGCGAAG ACCCAGCTAT AGGCGAAGCC GTCACGGCCG CATTCCGCAT GGAGGGCATC GAGGTGAGGG AACACACCCA GGCCAGCCAG GTCGCGTATA 2700
TCAATGGTGA AGGGGACGGC GAATTCGTGC TCACCACGGC GCACGGCGAA CTGCGCGCCG ACAAGCTGCT GGTCGCCACC GGCCGCGCGC CCAACACACG 2800
CAAGCTGGCA CTGGATGCGA CGGGCGTCAC GCTCACCCCG CAAGGCGCTA TCGTCATCGA CCCCGGCATG CGTACAAGCG TGGAACACAT CTACGCCGCA 2900
GGCGACTGCA CCGACCAGCC GCAGTTCGTC TATGTGGCGG CAGCGGCCGG CACTCGCGCC GCGATCAACA TGACCGGCGG TGACGCGGCC CTGAACCTGA 3000
CCGCGATGCC GGCCGTGGTG TTCACCGACC CGCAAGTGGC GACCGTAGGC TACAGCGAGG CGGAAGCGCA CCATGACGGC ATCAAAACTG ATAGTCGCAC 3100
GCTAACGCTG GACAACGTGC CGCGCGCGCT CGCCAACTTC GACACGCGCG GCTTCATCAA ACTGGTGGTT GAAGAAGGCA GCGGACGACT GATCGGCGTG 3200
CAGGCAGTGG CCCCGGAAGC GGGCGAACTG ATCCAGACGG CCGCACTGGC GATTCGCAAC CGGATGACGG TGCAGGAACT GGCCGACCAG TTGTTCCCCT 3300
ACCTGACGAT GGTCGAAGGG TTGAAGCTCG CGGCGCAGAC CTTCAACAAG GATGTGAAGC ATCTTTCCTG CTGCGCCGGG TGAGGACAAG GAGGTGTGCG 3400
ATGAGCGCCT ACACGGTATC GCAACTGGCC CATAACGCTG GGGTGAGCGT ACATATCGTG CGCGACTACC TGGTGCGCGG CTTGTTACGG CCGGTGGCCT 3500
GCACCACGGG CGGCTACGGC GTGTTCGACG ATGCGGCCTT GCAACGGCTG TGCTTCGTGC GCGCGGCCTT CGAGGCGGGT ATCGGCCTGG ATGCCCTGGC 3600
GCGGCTGTGC CGTGCGCTCG ACGCAGCGGA CGGCGCACAA GCCGCAGCGC AGCTTGCCGT GCTGCGCCAG TTGGTCGAGC GGCGGCGCGC GGCGTTGGCC 3700
CATCTGGACG CGCAACTGGC CTCCATGCCA GCCGAGCGGG CGCACGAGGA GGCATTGCCG TGAACGCCCC TGACAAACTG CCGCCCGAGA CGCGCCAACC 3800
CGTTTCCGGC TACCTGTGGG GTGCGCTGGC CGTGTTGACC TGCCCCTGCC ATCTGCCGAT TCTCGCCGCC GTGCTGGCCG GGACGACCGC CGGTGCCTTC 3900
CTTGGCGAGC ATTGGGGTGT TGCCGCGCTC GCGCTGACCG GCTTGTTCGT TCTGGCCGTA ACGCGGCTGC TGCGCGCCTT CCGGGGCGGA TCATGACGAG 4000
TTCGCAGCCC GCCGGATGGA CGGCGGCCGA GTTGGCGCAG GCGGCGGCGC GCGGACAGCT TGACCTGCAT TACCAGCCGC TGGTCGATCT GCGCGATCAC 4100
CGGATCGCTG GCGCGGAAGC GTTGATGCGC TGGCGGCATC CGAGGCTTGG CCTGTTGCCG CCCGGCCAGT TCCTGCCGCT GGCCGAGTCG TTCGGCCTGA 4200
TGCCGGAAAT AGGCGCGTGG GTGCTGGGCG AGGCCTGTCG CCAGATGCAC AAGTGGCAAG GACCGGCATG GCAACCGTTC CGTCTTGCCA TCAATGTGTC 4300
CGCCAGCCAG GTTGGGCCAA CGTTCGACGA CGAGGTAAAG CGGGTGCTGG CCGATATGGC CCTGCCCGCC GAGCTTCTGG AGATCGAACT GACCGAATCG 4400
GTCGCATTCG GCAATCCAGC CCTGTTCGCC AGTTTCGACG CCTTGCGCGC CATCGGCGTG CGCTTCGCCG CCGACGACTT CGGCACCGGC TATTCCTGCC 4500
TGCAACATCT GAAATGCTGC CCCATCACCA CATTGAAAAT CGACCAATCC TTTGTCGCCA GGCTCCCGGA TGATGCCCGT GACCAAACTA TCGTGCGGGC 4600
GGTGATCCAG CTCGCGCACG GGCTGGGCAT GGAGGTGGTA GCCGAGGGTG TGGAAACACC CGACTGCCTT GCGTGGTTGC GGCAGGCGGG TTGCGACACG 4700
GTGCAGGGTT TCCTGTTCGC CAGGCCGATG CCGGCGGCGG CCTTCGTCGG CTTCGTCAAC CAATGGAGGA ACACCACCAT GAACGCCAAT GAACCGAGCA 4800
CCAGTTGCTG CGTGTGCTGC AAGGAAATCC CGCTCGATGC CGCACGTGGA GCATTTCTGC GGGCTGGAGT GCTATCAGCG CTTCCAGGCG CGGGCCAGCA 4900
CTGCGACCGA AACCAGCGTC AAACCGGACG CTTGTGATTC GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAGA TGCCATGTGT AAATTGCGTC 5000
AGGATAGGAT TGAATTTTGA ATTTATTGAC ATATCTCGTT GAAGGTCATA GAGTCTTCCC TGACATTTTG CAGGGAATTC CATGACTGGA CAGCGCATTG 5100
GGTATATCAG GGTCAGCACC TTCGACCAGA ACCCGGAACG GCAACTGGAA GGCGTCAAGG TTGATCGCGC TTTTAGCGAC AAGGCATCCG GCAAGGATGT 5200
CAAGCGTCCG CAACTGGAAG CGCTGATAAG CTTCGCCCGC ACCGGCGACA CCGTGGTGGT GCATAGCATG GATCGCCTGG CGCGCAATCT CGATGATTTG 5300
CGCCGGATCG TGCAAACGCT GACACAACGC GGCGTGCATA TCGAATTCGT CAAGGAACAC CTCAGTTTTA CTGGCGAAGA CTCTCCGATG GCGAACCTGA 5400
TGCTCTCGGT GATGGGCGCG TTCGCCGAGT TCGAGCGCGC CCTGATCCGC GAGCGTCAGC GCGAGGGTAT TGCGCTCGCC AAGCAACGCG GGGCTTACCG 5500
TGGCAGGAAG AAATCCCTGT CGTCTGAGCG TATTGCCGAA CTGCGCCAAC GTGTCGAGGC TGGCGAGCAA AAGGCCAAGC TTGCTCGTGA ATTCGGAATC 5600
AGTCGCGAAA CCCTGTATCA ATACTTGAGA ACGGATCAGT AAATATGCCA CGTCGTTCCA TCCTGTCCGC CGCCGAGCGG GAAAGCCTGC TGGCGTTGCC 5700
GGACTCCAAG GACGACCTGA TCCGACATTA CACATTCAAC GATACCGACC TCTCGATCAT CCGACAGCGG CGCGGGCCAG CCAATCGGCT GGGCTTCGCG 5800
GTGCAGCTCT GTTACCTGCG CTTTCCCGGC GTCATCCTGG GCGTCGATGA ACTACCGTTC CCGCCCTTGT TGAAGCTGGT CGCCGACCAG CTCAAGGTCG 5900
GCGTCGAAAG CTGGAACGAG TACGGCCAGC GGGAGCAGAC CCGGCGCGAG CACCTGAGCG AGCTGCAAAC CGTGTTCGGT TTCCGGCCCT TCACCATGAG 6000
CCATTACCGG CAGGCCGTCC AGATGCTGAC CGAGCTGGCG ATGCAAACCG ACAAAGGCAT CGTGCTGGCC AGCGCCTTGA TCGGGCACCT GCGGCGGCAG 6100
TCGGTCATTC TGCCCGCCCT CAACGCCGTC GAGCGGGCGA GTGCCGAGGC GATCACCCGT GCTAACCGGC GCATCTACGA CGCCTTGGCC GAACCACTGG 6200
CGGACGCGCA TCGCCGCCGC CTCGACGATC TGCTCAAGCG CCGGGACAAC GGCAAGACGA CCTGGTTGGC TTGGTTGCGC CAGTCTCCGG CCAAGCCAAA 6300
TTCGCGGCAT ATGCTGGAAC ACATCGAACG CCTCAAGGCA TGGCAGGCAC TCGATCTGCC TACCGGCATC GAGCGGCTGG TTCACCAGAA CCGCCTGCTC 6400
AAGATTGCCC GCGAGGGCGG CCAGATGACA CCCGCCGACC TGGCCAAATT TGAGCCGCAA CGGCGCTACG CCACTCTCGT GGCGCTGGCC ACCGAGGGCA 6500
TGGCCACCGT CACCGACGAA ATCATCGACC TGCACGACCG CATCCTGGGT AAGCTGTTTA ACGCTGCCAA GAATAAGCAT CAGCAGCAGT TCCAGGCGTC 6600
AGGCAAGGCC ATCAACGCCA AGGTACGTCT GTACGGGCGC ATCGGTCAGG CGCTGATCGA CGCCAAGCAA TCAGGCCGCG ATGCGTTTGC CGCCATCGAG 6700
GCCGTCATGT CCTGGGATTC CTTTGCCGAG AGCGTCACCG AGGCGCAGAA GCTCGCGCAA CCCGATGACT TCGATTTCCT GCATCGCATC GGCGAGAGCT 6800
ACGCCACCCT GCGCCGCTAT GCACCGGAAT TCCTTGCCGT GCTCAAGCTG CGGGCCGCGC CCGCCGCCAA AAACGTGCTT GATGCCATTG AGGTGCTGCG 6900
CGGCATGAAC ACCGACAACG CCCGCAAGCT GCCAGCCGAT GCACCGACCG GCTTCATCAA GCCGCGCTGG CAGAAACTGG TGATGACCGA CGCCGGCATC 7000
GACCGGCCCT ACTACGAACT GTGCGCGCTG TCCGAGTTGA AGAACTCCCT GCGCTCGGGC GACATCTGGG TGCAGGGTTC ACGCCAGTTC AAGGACTTCG 7100
AGGACTACCT GGTACCGCCC GAGAAGTTCA CCAGCCTCAA GCAGTCCAGC GAATTGCCGC TGGCCGTGGC CACCGACTGC GAACAATATC TGCATGAGCG 7200
GCTGACGCTG CTGGAAGCAC AACTTGCCAC CGTCAACCGC ATGGCGGCAG CCAACGACCT GCCGGATGCC ATCATCACCG AGTCGGGCTT GAAGATCACG 7300
CCGCTGGATG CGGCGGTGCC CGACACCGCG CAGGCGCTGA TAGACCAGAC AGCCATGGTC CTGCCGCACG TCAAGATCAC CGAACTGCTG CTCGAAGTCG 7400
ATGAGTGGAC GGGCTTCACC CGGCACTTCA CGCACTTGAA ATCGGGCGAT CTGGCCAAGG ACAAGAACCT GTTGTTGACC ACGATCCTGG CCGACGCGAT 7500
CAACCTGGGC CTGACCAAGA TGGCCGAGTC CTGCCCCGGC ACGACCTACG CGAAGCTCGC TTGGCTGCAA GCCTGGCATA CCCGCGACGA AACGTACTCG 7600
ACAGCGTTGG CTGAACTGGT CAACGCTCAG TTTCGGCATC CCTTTGCCGG GCACTGGGGC GATGGCACCA CATCATCATC GGACGGACAG AATTTCCGAA 7700
CCGCTAGCAA GGCAAAGAGC ACGGGGCACA TCAACCCAAA ATATGGCAGC AGCCCAGGAC GGACTTTCTA CACCCACATC TCCGACCAAT ACGCGCCATT 7800
CCACACCAAG GTGGTCAATG TCGGCCTGCG CGACTCAACC TACGTGCTCG ACGGCCTGCT GTACCACGAA TCCGACCTGC GGATCGAGGA GCACTACACC 7900
GACACGGCGG GCTTCACCGA TCACGTCTTC GCCCTGATGC ACCTCTTGGG CTTCCGCTTC GCGCCGCGCA TCCGCGACCT GGGCGACACC AAGCTCTACA 8000
TCCCGAAGGG CGATGCCGCC TATGACGCGC TCAAGCCGAT GATCGGCGGC ACGCTCAACA TCAAGCACGT CCGCGCCCAT TGGGACGAAA TCCTGCGGCT 8100
GGCCACCTCG ATCAAGCAGG GCACGGTGAC GGCCTCGCTG ATGCTCAGGA AACTCGGCAG CTACCCGCGC CAGAACGGCT TGGCCGTCGC GCTGCGCGAG 8200
TTGGGCCGCA TCGAGCGCAC GCTGTTCATC CTCGACTGGC TGCAAAGCGT CGAGCTACGC CGCCGCGTGC ATGCCGGGCT GAACAAGGGC GAGGCGCGCA 8300
ATGCGCTGGC CCGTGCCGTG TTCTTCAACC GCCTTGGTGA AATCCGTGAC CGCAGTTTCG AGCAGCAGCG CTACCGGGCC AGCGGCCTCA ACCTGGTGAC 8400
GGCGGCCATC GTGCTGTGGA ACACGGTCTA CCTGGAGCGT GCGGCGCATG CGTTGCGCGG CAATGGTCAT GCCGTCGATG ACTCGCTATT GCAGTACCTG 8500
TCGCCACTCG GCTGGGAGCA CATCAACCTG ACCGGTGATT ACCTATGGCG CAGCAGCGCC AAGATCGGCG CGGGGAAGTT CAGGCCGCTA CGGCCTCTGC 8600
AACCGGCTTA GCGTGCTTTA TTTAATGAGA TGGTCACTCC CTCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 4941-5071 131 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAGA TGCCATGTGT AAATTGCGTC
AGGATAGGAT TGAATTTTGA ATTTATTGAC ATATCTCGTT GAAGGTCATA GAGTCTTCCC
TGACATTTTG C
res_site_I 4941-4979 39 GCCGCCGTCA GGTTGAGGCA TACCCTAACC TGATGTCAG
res_site_II 4993-5036 44 ATTGCGTCAG GATAGGATTG AATTTTGAAT TTATTGACAT ATCT
res_site_III 5040-5071 32 TGAAGGTCAT AGAGTCTTCC CTGACATTTT GC

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
merR Tn20 34-468 Passenger Gene Heavy Metal Resistance -
merT Tn20 540-890 Passenger Gene Heavy Metal Resistance +
merP Tn20 904-1179 Passenger Gene Heavy Metal Resistance +
merC Tn20 1215-1637 Passenger Gene Heavy Metal Resistance +
merA Tn20 1689-3383 Passenger Gene Heavy Metal Resistance +
merD Tn20 3401-3763 Passenger Gene Heavy Metal Resistance +
merE Tn20 3760-3996 Passenger Gene Heavy Metal Resistance +
urfM Tn20 3993-4937 Passenger Gene Other +
tnpR Tn20 5082-5642 Accessory Gene Resolvase +
tnpA Tn20 5645-8611 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn20 435 34-468 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MENNLENLTI GVFAKAAGVN VETIRFYQRK GLLREPDKPY GSIRRYGEAD VVRVKFVKSA QRLGFSLDEI AELLRLDDGT HCEEASSLAE HKLKDVREKM
ADLARMETVL SELVCACHAR KGNVSCPLIA SLQGEAGLAR SAMP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn20 351 540-890 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   cytosolic mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPQNGRGA LFAGGLAAIL ASTCCLGPLV LVALGFSGAW IGNLTVLEPY RPLFIGAALV ALFFAWKRIY RPVQACKPGE VCAIPQVRAT YKLIFWIVAV
LVLVALGFPY VVPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn20 276 904-1179 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFASLAL AAAVAPVWAA TQTVTLAVPG MTCAACPITV KKALSKVEGV SKVDVGFEKR EAVVTFDDTK ASVQKLTKAT ADAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn20 423 1215-1637 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   transmembrane protein mercury transport
Target:   Mercury
Protein Sequence:  
MGLMTRIADK TGALGSVVSA MGCAACFPAL ASFGAAIGLG FLSQYEGLFI SRLLPLFAAL AFLANALGWF SHRQWLRSLL GMIGPAIVFA ATVWLLGNWW
TANLMYVGLA LMIGVSIWDF VSPAHRRCGP DGCELPAKRL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn20 1695 1689-3383 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion reductase
Target:   Mercury
Protein Sequence:  
MSTLKITGMT CDSCAVHVKD ALEKVPGVQS ADVSYAKGSA KLAIEVGTSP DALTAAVAGL GYRATLADAP SVSTPGGLLD KMRDLLGRND KTGSSGALHI
AVIGSGGAAM AAALKAVEQG ARVTLIERGT IGGTCVNVGC VPSKIMIRAA HIAHLRRESP FDGGIAATTP TIQRTALLAQ QQARVDELRH AKYEGILEGN
PAITVLHGSA RFKDNRNLIV QLNDGGERVV AFDRCLIATG ASPAVPPIPG LKDTPYWTST EALVSETIPK RLAVIGSSVV ALELAQAFAR LGAKVTILAR
STLFFREDPA IGEAVTAAFR MEGIEVREHT QASQVAYING EGDGEFVLTT AHGELRADKL LVATGRAPNT RKLALDATGV TLTPQGAIVI DPGMRTSVEH
IYAAGDCTDQ PQFVYVAAAA GTRAAINMTG GDAALNLTAM PAVVFTDPQV ATVGYSEAEA HHDGIKTDSR TLTLDNVPRA LANFDTRGFI KLVVEEGSGR
LIGVQAVAPE AGELIQTAAL AIRNRMTVQE LADQLFPYLT MVEGLKLAAQ TFNKDVKHLS CCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merD MerD Tn20 363 3401-3763 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   secondary regulatory protein
Target:   Mercury
Protein Sequence:  
MSAYTVSQLA HNAGVSVHIV RDYLVRGLLR PVACTTGGYG VFDDAALQRL CFVRAAFEAG IGLDALARLC RALDAADGAQ AAAQLAVLRQ LVERRRAALA
HLDAQLASMP AERAHEEALP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merE MerE Tn20 237 3760-3996 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Comment:   similar to urf-1 in pKLH2 (GenBank AF213017), pKLH272 (Genbank Y08992), pMER610 (GenBank Y08993), pKLH210 (GenBank Y10102), Tn5036 (Genbank Y09025), orf1 in Tn501 (GenBank Z00027), and urf-1 in Tn5041 (GenBank X98999)
Protein Sequence:  
MNAPDKLPPE TRQPVSGYLW GALAVLTCPC HLPILAAVLA GTTAGAFLGE HWGVAALALT GLFVLAVTRL LRAFRGGS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
urfM UrfM Tn20 945 3993-4937 +
Class:   Passenger Gene
Sub Class:   Other
Function:   possible diguanylate phosphodiesterase
Sequence Family:  EAL (Pfam:PF00563)||DUF3330 (Pfam:PF11809)
Comment:   similar to urfM from E.coli
Protein Sequence:  
MTSSQPAGWT AAELAQAAAR GQLDLHYQPL VDLRDHRIAG AEALMRWRHP RLGLLPPGQF LPLAESFGLM PEIGAWVLGE ACRQMHKWQG PAWQPFRLAI
NVSASQVGPT FDDEVKRVLA DMALPAELLE IELTESVAFG NPALFASFDA LRAIGVRFAA DDFGTGYSCL QHLKCCPITT LKIDQSFVAR LPDDARDQTI
VRAVIQLAHG LGMEVVAEGV ETPDCLAWLR QAGCDTVQGF LFARPMPAAA FVGFVNQWRN TTMNANEPST SCCVCCKEIP LDAARGAFLR AGVLSALPGA
GQHCDRNQRQ TGRL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn20 561 5082-5642 +
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   identical to TnAs3 tnpR
Protein Sequence:  
MTGQRIGYIR VSTFDQNPER QLEGVKVDRA FSDKASGKDV KRPQLEALIS FARTGDTVVV HSMDRLARNL DDLRRIVQTL TQRGVHIEFV KEHLSFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKSLSSER IAELRQRVEA GEQKAKLARE FGISRETLYQ YLRTDQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn20 2967 5645-8611 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRSILSAA ERESLLALPD SKDDLIRHYT FNDTDLSIIR QRRGPANRLG FAVQLCYLRF PGVILGVDEL PFPPLLKLVA DQLKVGVESW NEYGQREQTR
REHLSELQTV FGFRPFTMSH YRQAVQMLTE LAMQTDKGIV LASALIGHLR RQSVILPALN AVERASAEAI TRANRRIYDA LAEPLADAHR RRLDDLLKRR
DNGKTTWLAW LRQSPAKPNS RHMLEHIERL KAWQALDLPT GIERLVHQNR LLKIAREGGQ MTPADLAKFE PQRRYATLVA LATEGMATVT DEIIDLHDRI
LGKLFNAAKN KHQQQFQASG KAINAKVRLY GRIGQALIDA KQSGRDAFAA IEAVMSWDSF AESVTEAQKL AQPDDFDFLH RIGESYATLR RYAPEFLAVL
KLRAAPAAKN VLDAIEVLRG MNTDNARKLP ADAPTGFIKP RWQKLVMTDA GIDRPYYELC ALSELKNSLR SGDIWVQGSR QFKDFEDYLV PPEKFTSLKQ
SSELPLAVAT DCEQYLHERL TLLEAQLATV NRMAAANDLP DAIITESGLK ITPLDAAVPD TAQALIDQTA MVLPHVKITE LLLEVDEWTG FTRHFTHLKS
GDLAKDKNLL LTTILADAIN LGLTKMAESC PGTTYAKLAW LQAWHTRDET YSTALAELVN AQFRHPFAGH WGDGTTSSSD GQNFRTASKA KSTGHINPKY
GSSPGRTFYT HISDQYAPFH TKVVNVGLRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG DTKLYIPKGD AAYDALKPMI
GGTLNIKHVR AHWDEILRLA TSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNALAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERAAHALRGN GHAVDDSLLQ YLSPLGWEHI NLTGDYLWRS SAKIGAGKFR PLRPLQPA

 References     

Essa AM, Julian DJ, Kidd SP, Brown NL, Hobman JL. Mercury resistance determinants related to Tn21, Tn1696, and Tn5053 in enterobacteria from the preantibiotic era. Antimicrob Agents Chemother. 2003 Mar;47(3):1115-9. doi: 10.1128/aac.47.3.1115-1119.2003. PubMed ID: 12604550