Transposon
Name: Tn2.1
Family: Tn3        Group: Tn3
Evidence of Transposition: yes
 Host     

Host Organism:Klebsiella pneumoniae SCM96 Molecular Source:plasmid pSCM96-1
Place of Origin:China Date of Isolation:2018

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG
IRR (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG

 Sequence     
DNA SequenceLength  8979 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCTGAC GCTCAGTGGA ACGAAAACTC ACGTTAAGGG ATTTTGGTCA TGAGATTATC AAAAAGGATC TTCACCTAGA TCCTTTTAAA TTAAAAATGA 100
AGTTTTAAAT CAATCTAAAG TATATATGAC CTAGATTCTA CGTCAGTACT TCAAAAAGCA TAATCAAAGC CTTGATAAAT ATGCATTCCT TCGAAATTCA 200
GCTTTCACCC ATTGGGTGAA AGAAAAGTGC TCAAAAATAT GTTAAATTAT CAGCTTTTAT GACTCGATAT ATGGTAAAAT AATAGTAAGA AAAGTAGTAA 300
AAAGGGGTTC TAATTATGAT TAATAAAATT GATTTCAAAG CTAAGAATCT AACATCAAAT GCAGGTCTTT TTCTGCTCCT TGAGAATGCA AAAAGCAATG 400
GGATTTTTGA TTTTATTGAA AATGACCTCG TATTTGATAA TGACTCAACA AATAAAATCA AGATGAATCA TATAAAGACC ATGCTCTGCG GTCACTTCAT 500
TGGCATTGAT AAGTTAGAAC GTCTAAAGCT ACTTCAAAAT GATCCCCTCG TCAACGAGTT TGATATTTCC GTAAAAGAAC CTGAAACAGT GTCACGGTTT 600
CTAGGAAACT TCAACTTCAA GACAACCCAA ATGTTTAGAG ACATTAATTT TAAAGTCTTT AAAAAACTGC TCACTAAAAG TAAATTGACA TCCATTACGA 700
TTGATATTGA TAGTAGTGTA ATTAACGTAG AAGGTCATCA AGAAGGTGCG TCAAAAGGAT ATAATCCTAA GAAACTGGGA AACCGATGCT ACAATATCCA 800
ATTTGCATTT TGCGACGAAT TAAAAGCATA TGTTACCGGA TTTGTAAGAA GTGGCAATAC TTACACTGCA AACGGTGCTG CGGAAATGAT CAAAGAAATT 900
GTTGCTAACA TCAAATCAGA CGATTTAGAA ATTTTATTTC GAATGGATAG TGGCTACTTT GATGAAAAAA TTATCGAAAC GATAGAATCT CTTGGATGCA 1000
AATATTTAAT TAAAGCCAAA AGTTATTCTA CACTCACCTC ACAAGCAACG AATTCATCAA TTGTATTCGT TAAAGGAGAA GAAGGTAGAG AAACTACAGA 1100
ACTGTATACA AAATTAGTTA AATGGGAAAA AGACAGAAGA TTTGTCGTAT CTCGCGTACT GAAACCAGAA AAAGAAAGAG CACAATTATC ACTTTTAGAA 1200
GGTTCCGAAT ACGACTACTT TGGTAATGAC TCCAACTTAC TGATAGTGTT TTATGTTCAG ATAATGCCCG ATGACTTTGT CATGCAGCTC CACCGATTTT 1300
GAGAACGACA GTGACTTCCG TCCCAGCCTT GCCAGATGTT GTCTCAGATT CAGGTTATGT CGCTCAATGC GCTGAGTGTA ACGCTTGCTG ATTACGTGCA 1400
GCTTTCCCTT CAGGCGGGAT TCATACAGCG GCCAGCCATC CGTCATCCAT ACCACGACCT CAAAGGCCGA CAGCAGGCTC AGAAGACGCT CCAGTGTGGC 1500
CAGAGTGCGT TCACCGAAGA CGTGCGCCAC AACCGTCCTC CGTATCCTGT CATACGCGTA AAACAGCCAG CGCTGACGTG ATTTAGCACC GACGTAGCCC 1600
CACTGTTCGT CCATTTCAGC GCAGACAATC ACATCACTGC CCGGCTGTAT GCGCGAGGTT ACCGACTGCG GCCTGAGTTT TTTAAGTGAC GTAAAATCGT 1700
GTTGAGGCCA ACGCCCATAA TGCGGGCGGT TGCCCGGCAT CCAACACCAT TCATGGCCAT ATCAATGATT TTCTGGTGTG TACCGGGTTG AGAAGCGGTG 1800
TAAGTGAACT GCAGTTGCCA TGTTTTACGG CAGTGAGAGC AGAGATAGCG CTGATGTCCG GCAGTACTTT TACCGTTACG CACCACGCCT TCAGTAGCTG 1900
AGCAGGAGGG ACAACTGATG GAGATGGAAG CCACGGGAGC ACCTCAAAAA CACCATCATA CACTAAATCA GTAAGTTGGC ACCATTACCG ATGCTTTCAT 2000
ATAACCTATT TTTGTTGTTC AAGTTTGATT CCTTGGACTC TTCAGAATAC AGACAGCAAA TAAAGACCTT TCGTTTGAAG TATGTATTTC TTGCAGCAAA 2100
AATAATCAAA ACCGCAAGAT ATGTAATCAT GAAGTTGTCG GAAAACTATC CGTACAAGGG AGTGTATGAA AAATGTCTGG TATAATAAGA ATATCATCAA 2200
TAAAATTGAG TGTTGCTCTG TGGATAACTT GCAGAGTTTA TTAAGTATCA TTGCAGCAAA GATGAAATCA ATGATTTATC AAAAATGATT GAAAGGTGGT 2300
TGTAAATAAT GTTACAATGT GTGAGAAGCA GTCTAAATTC TTCGTGAAAT AGTGATTTTT GAAGCTAATA AAAAACACAC GTGGAATTTA GGTTTCATTC 2400
TGGCGACGTC CGTATTTGCC TTTCGGAAGC ATAAAATCGG ACGCGTTGTG GCTCGCTTCA GGTAAAATAT TGACTATTCA TGTTGTTGTT ATTTCGTCTC 2500
TTTCAGAATA AGGAATCCCA TGGTTAAAAA ATCACTGCGC CAGTTCACGC TGATGGCGAC GGCAACCGTC ACGCTGTTGT TAGGAAGTGT GCCGCTGTAT 2600
GCGCAAACGG CGGACGTACA GCAAAAACTT GCCGAATTAG AGCGGCAGTC GGGAGGCAGA CTGGGTGTGG CATTGATTAA CACAGCAGAT AATTCGCAAA 2700
TACTTTATCG TGCTGATGAG CGCTTTGCGA TGTGCAGCAC CAGTAAAGTG ATGGCCGCGG CCGCGGTGCT GAAGAAAAGT GAAAGCGAAC CGAATCTGTT 2800
AAATCAGCGA GTTGAGATCA AAAAATCTGA CCTTGTTAAC TATAATCCGA TTGCGGAAAA GCACGTCAAT GGGACGATGT CACTGGCTGA GCTTAGCGCG 2900
GCCGCGCTAC AGTACAGCGA TAACGTGGCG ATGAATAAGC TGATTGCTCA CGTTGGCGGC CCGGCTAGCG TCACCGCGTT CGCCCGACAG CTGGGAGACG 3000
AAACGTTCCG TCTCGACCGT ACCGAGCCGA CGTTAAACAC CGCCATTCCG GGCGATCCGC GTGATACCAC TTCACCTCGG GCAATGGCGC AAACTCTGCG 3100
GAATCTGACG CTGGGTAAAG CATTGGGCGA CAGCCAACGG GCGCAGCTGG TGACATGGAT GAAAGGCAAT ACCACCGGTG CAGCGAGCAT TCAGGCTGGA 3200
CTGCCTGCTT CCTGGGTTGT GGGGGATAAA ACCGGCAGCG GTGACTATGG CACCACCAAC GATATCGCGG TGATCTGGCC AAAAGATCGT GCGCCGCTGA 3300
TTCTGGTCAC TTACTTCACC CAGCCTCAAC CTAAGGCAGA AAGCCGTCGC GATGTATTAG CGTCGGCGGC TAAAATCGTC ACCGACGGTT TGTAATAGCG 3400
GAAACGGAAT GGGGAAACTC ATTCCGTTTT TGTTTATCGC CTTAGACGGC AAAAGTGCTG TCGCCCACCT GCGCTTGCGC ATACCAGGCC ATAAGCTCCG 3500
TGGTTCCTGG TTCTCCTTCC GCTGGAGCCC AGTGCGCATA GTCATCGGCA GCCACGGGTT GATAGCCACC GTGTTTTACT TCAAAAATTA TGCCACCGGT 3600
ATCCAGCGAC AGCACGGCAT GCCAGGTTCC TGCGGCCATC TCCAGCACCG TACAGGTTTC CCCCAATATC GCCCGATGGG TGACGGTACC CCGATCGTCA 3700
AAATTCAGCA CCACGAAACG ACCCCTTAAT GGCAACAGTA GCTCGAAGGT GTGAGGGTGT CGGTGCGGGC GCACGTAGGT CCCAGGTTCC ATGGCAATAG 3800
CCAGACGTTG GACCGAATCG CTTAATTCTG GATGGAAATT ACGGTGCGCG CGGAGCCGAG GCGATTGCAC AGCCGCTGCG CTCTGTTGCT GCATATCGCT 3900
CATGGTAATT TGTTTCATCA GGATGACCTT GTCGATTAAT GAATTGGGGG GGATTACCGT ATGACGTCAG GGTGACAGAA CCCGCAGAGC AAGTGAAGAA 4000
CTGGGTTTGC CAATTTTTCC CTATCCTGAT TTACTGAAAT GGTATTGACG GTAGTGCTGA TATTCAGGCC ACTTTTTTAG TTGATAAAAG TCTGTAATTC 4100
TTTTTACCGT CTGGGAAAAA TTTACGGTGG TAATCACCCC CCAATTATTT CAGTATGAGT AAACTTGGTC TGACAGTTAC CAATGCTTAA TCAGTGAGGC 4200
ACCTATCTCA GCGATCTGTC TATTTCGTTC ATCCATAGTT GCCTGACTCC CCGTCGTGTA GATAACTACG ATACGGGAGG GCTTACCATC TGGCCCCAGT 4300
GCTGCAATGA TACCGCGAGA CCCACGCTCA CCGGCTCCAG ATTTATCAGC AATAAACCAG CCAGCCGGAA GGGCCGAGCG CAGAAGTGGT CCTGCAACTT 4400
TATCCGCCTC CATCCAGTCT ATTAATTGTT GCCGGGAAGC TAGAGTAAGT AGTTCGCCAG TTAATAGTTT GCGCAACGTT GTTGCCATTG CTGCAGGCAT 4500
CGTGGTGTCA CGCTCGTCGT TTGGTATGGC TTCATTCAGC TCCGGTTCCC AACGATCAAG GCGAGTTACA TGATCCCCCA TGTTGTGCAA AAAAGCGGTT 4600
AGCTCCTTCG GTCCTCCGAT CGTTGTCAGA AGTAAGTTGG CAGCAGTGTT ATCACTCATG GTTATGGCAG CACTGCATAA TTCTCTTACT GTCATGCCAT 4700
CCGTAAGATG CTTTTCTGTG ACTGGTGAGT ACTCAACCAA GTCATTCTGA GAATAGTGTA TGCGGCGACC GAGTTGCTCT TGCCCGGCGT CAACACGGGA 4800
TAATACCGCA CCACATAGCA GAACTTTAAA AGTGCTCATC ATTGGAAAAC GTTCTTCGGG GCGAAAACTC TCAAGGATCT TACCGCTGTT GAGATCCAGT 4900
TCGATGTAAC CCACTCGTGC ACCCAACTGA TCTTCAGCAT CTTTTACTTT CACCAGCGTT TCTGGGTGAG CAAAAACAGG AAGGCAAAAT GCCGCAAAAA 5000
AGGGAATAAG GGCGACACGA AAATGTTGAA TACTCATACT CTTCCTTTTT CAATATTATT GAAGCATTTA CCAGGGTTAT TGTCTCATGA GCGGATACAT 5100
ATTTGAATGT ATTTAGAAAA ATAAACAAAT AGGGGTTCCG CGCACATTTC CCCGAAAAGT GCCACCTGAC GTCTAAGAAA CCATTATTAT CATGACATTA 5200
ACCTATAAAA ATAGGCGTAT CACGAGGCCC TTTCGTCTTC AAGAATTTTA TAAACCGTGG AGCGGGCAAT ACTGAGCTGA TGAGCAATTT CCGTTGCACC 5300
AGTGCCCTTC TGATGAAGCG TCAGCACGAC GTTCCTGTCC ACGGTACGCC TGCGGCCAAA TTTGATTCCT TTCAGCTTTG CTTCCTGTCG GCCCTCATTC 5400
GTGCGTTCTA GGATCCTCCG GCGTTCAGCC TGTGCCACAG CCGACAGGAT GGTGACCACC ATTTGCCCCA TATCACCGTC GGTACTGATC CCGTCATCAA 5500
TGAACCGGAC TGCCACGCCC TGAGCGTCAA ATTCCTTTAT CAGTTGGATC ATATCGGCAG TGTCGCGGCC AAGACGGTCG AGCTTCTTAA CCAGAATGAC 5600
ATCACCTTCC TCCACCTTCA TCCTCAGCAA ATCCAGCCCT TCCCGGTCTG TTGAACTGCC GGATGCCTTA TCGGTAAATA TACGGTTTGC TTTCACACCT 5700
GCGTCTTTGA GTGCTCTGAC CTGAAGATCA AGAGACTGCT GACTGGTTGA GACCCGAGCG TAACCAAAAA GTCGCATAAA AATGTACCTT AAATCGAATA 5800
TCGGACAACT CATGTCTATT ATTACAAATT TACGATTTAA TAGACATATT AATGTAACAG TTTTACGATG TCCGATAATT TATAACATTT CGTACGGTTG 5900
GAAAAATGTT ACTAAATGCC CGTCAGGCAG GGAGGCCGAT ATGCCCGTTG ACTTTCTGAC CACTGAGCAG ACTGAAAGCT ATGGCAGATT CACCGGTGAA 6000
CCGGATGAGC TTCAGCTGGC ACGATATTTT CACCTTGATG AAGCAGACAA GGAATTTATC GGAAAAAGCA GAGGTGATCA CAACCGTCTG GGCATTGCCC 6100
TGCAAATTGG ATGTGTCCGT TTTCTGGGCA CCTTCCTCAC CGATATGAAT CATATTCCTT CCGGCGTCCG GCATTTTACC GCCAGACAGC TCGGGATTCG 6200
TGATATCACC GTTCTTGCAG AATACGGTCA GAGGGAAAAT ACCCGCCGTG AGCATGCAGC GCTGATACGT CAGCACTATC AGTATCGTGA ATTTGCCTGG 6300
CCCTGGACAT TTCGCCTTAC CCGTCTTTTA TATACCCGGA GCTGGATAAG CAACGAACGT CCTGGCCTGC TTTTCGATCT GGCGACAGGG TGGCTTATGC 6400
AACATCGTAT TATTCTCCCC GGAGCCACTA CGCTGACCCG GTTGATTTCA GAGGTAAGGG AAAAGGCGAC GTTGCGCCTG TGGAACAAAC TGGCACTGAT 6500
ACCGTCAGCC GAACAGCGTT CACAGCTGGA GATGCTGCTG GGGCCAACTG ATTGCAGCCG CCTGTCTTTA CTGGAATCAC TGAAAAAGGG CCCTGTGACC 6600
ATCAGTGGTC CGGCGTTTAA TGAAGCAATT GAACGCTGGA AAACTCTGAA CGATTTTGGC CTGCATGCTG AAAACCTGAG TACACTCCCG GCTGTGCGCC 6700
TGAAAAATCT CGCACGTTAT GCTGGTATGA CTTCGGTGTT CAATATTGCC AGGATGTCAC CGCAGAAAAG GATGGCGGTT CTGGTTGCCT TTGTCCTTGC 6800
ATGGGAAACG CTGGCGCTGG ATGATGCATT GGACGTTCTG GACGCCATGC TGGCCGTTAT CATCCGTGAC GCCAGAAAGA TTGGGCAGAA AAAACGGCTC 6900
CGCTCGCTGA AGGATCTGGA TAAATCTGCA TTGGCGCTCG CCAGCGCATG TTCGTACCTG CTGAAAGAAG AAACACCGGA CGAATCGATT CGTGCTGAGG 7000
TGTTCAGCTA CATCCCAAGG CAAAAGCTGG CTGAAATCAT CACGCTTGTC CGTGAAATTG CCCGGCCCTC AGACGATAAT TTTCATGAAG AAATGGTGGA 7100
GCAGTACGGG CGCGTTCGTC GTTTCCTGCC CCATCTGCTG AATACCGTTA AATTTTCATC CGCACCTGCC GGGGTTACCA CTCTGAATGC CTGTGACTAC 7200
CTCAGCCGGG AGTTCAGCTC ACGGCGGCAG TTTTTTGACG ACGCACCAAC GGAAATTATC AGTCGGTCAT GGAAACGGCT GGTGATTAAC AAGGAAAAAC 7300
ATATCACCCG CAGGGGATAC ACGCTCTGCT TTCTCAGTAA ACTGCAGGAT AGTCTGAGGC GGAGGGATGT CTACGTTACC GGCAGTAACC GGTGGGGAGA 7400
TCCTCGTGCA AGATTACTAC AGGGTGCTGA CTGGCAGGCA AACCGGATTA AGGTTTATCG TTCTTTGGGG CACCCGACAG ACCCGCAGGA AGCAATAAAA 7500
TCTCTGGGTC ATCAGCTTGA TAGTCGTTAC AGACAGGTTG CTGCACGTCT TTGCGAAAAT GAGGCTGTCG AACTCGATGT TTCTGGCCCG AAGCCCCGGT 7600
TGACAATTTC TCCCCTCGCC AGTCTTGATG AGCCGGACAG TCTGAAACGA CTGAGCAAAA TGATCAGTGA TCTACTCCCT CCGGTGGATT TAACGGAGTT 7700
GCTGCTCGAA ATTAACGCCC ATACCGGATT TGCTGATGAG TTTTTCCATG CTAGTGAAGC CAGTGCCAGA GTTGATGATC TGCCCGTCAG CATCAGCGCC 7800
GTGCTGATGG CTGAAGCCTG CAATATCGGT CTGGAACCAC TGATCAGATC AAATGTTCCT GCACTGACCC GACACCGGCT GAACTGGACA AAAGCGAACT 7900
ATCTGCGGGC TGAAACTATC ACCAGCGCTA ATGCCAGACT GGTTGATTTT CAGGCAACGC TGCCACTGGC ACAGATATGG GGTGGAGGAG AAGTGGCATC 8000
TGCAGATGGA ATGCGCTTTG TTACGCCAGT CAGAACAATC AATGCCGGAC CGAACCGCAA ATACTTTGGT AATAACAGAG GGATCACCTG GTACAACTTT 8100
GTGTCCGATC AGTATTCCGG CTTTCATGGC ATCGTTATAC CGGGGACGCT GAGGGACTCT ATCTTTGTGC TGGAAGGTCT TCTGGAACAG GAGACCGGGC 8200
TGAATCCAAC CGAAATTATG ACCGATACAG CAGGTGCCAG CGAACTTGTC TTTGGCCTTT TCTGGCTGCT GGGATACCAG TTTTCTCCAC GCCTGGCTGA 8300
TGCCGGTGCT TCGGTTTTCT GGCGAATGGA CCATGATGCC GACTATGGCG TGCTGAATGA TATTGCCAGA GGGCAATCAG ATCCCCGAAA AATAGTCCTT 8400
CAGTGGGACG AAATGATCCG GACCGCTGGC TCCCTGAAGC TGGGCAAAGT ACAGGCTTCA GTGCTGGTCC GTTCATTGCT GAAAAGTGAA CGTCCTTCCG 8500
GACTGACTCA GGCAATCATT GAAGTGGGGC GCATCAACAA AACGCTGTAT CTGCTTAATT ATATTGATGA TGAAGATTAC CGCCGGCGCA TTCTGACCCA 8600
GCTTAATCGG GGAGAAAGTC GCCATGCCGT TGCCAGAGCC ATCTGTCACG GTCAAAAAGG TGAGATAAGA AAACGATATA CCGACGGTCA GGAAGATCAA 8700
CTGGGCGCAC TGGGGCTGGT CACTAACGCC GTCGTGTTAT GGAACACTAT TTATATGCAG GCAGCCCTGG ATCATCTCCG GGCGCAGGGT GAAACACTGA 8800
ATGATGAAGA TATCGCACGC CTCTCCCCGC TTTGCCACGG ACATATCAAT ATGCTCGGCC ATTATTCCTT CACGCTGGCA GAACTGGTGA CCAAAGGACA 8900
TCTGAGACCA TTAAAAGAGG CGTCAGAGGC AGAAAACGTT GCTTAACGTG AGTTTTCGTT CCACTGAGCG TCAGACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 5780-5900 121 AAATGTACCT TAAATCGAAT ATCGGACAAC TCATGTCTAT TATTACAAAT TTACGATTTA
ATAGACATAT TAATGTAACA GTTTTACGAT GTCCGATAAT TTATAACATT TCGTACGGTT
G
res_site_III 5783-5805 23 TGTACCTTAA ATCGAATATC GGA
res_site_II 5813-5846 34 TGTCTATTAT TACAAATTTA CGATTTAATA GACA
res_site_I 5869-5897 29 TGTCCGATAA TTTATAACAT TTCGTACGG

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
tnp N-ter ISEcp1::IS1F 316-1221 Transposase   +
insAB IS1F 1237-1934 Transposase   -
insB IS1F 1237-1740 Transposase   -
insA IS1F 1659-1934 Accessory Gene   -
bla CTX-M-3 (ARO:3001866) Tn2.1 2520-3395 Passenger Gene Antibiotic Resistance +
wbuC family Tn2.1 3442-3918 Passenger Gene Other -
bla TEM-1 (ARO:3000873) Tn2.1 4177-5037 Passenger Gene Antibiotic Resistance -
tnpR Tn2.1 5220-5777 Accessory Gene Resolvase -
tnpA Tn2.1 5941-8946 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnp N-ter Tnp N-ter ISEcp1::IS1F 906 316-1221 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   tnp split by insertion of ISF1
Protein Sequence:  
MINKIDFKAK NLTSNAGLFL LLENAKSNGI FDFIENDLVF DNDSTNKIKM NHIKTMLCGH FIGIDKLERL KLLQNDPLVN EFDISVKEPE TVSRFLGNFN
FKTTQMFRDI NFKVFKKLLT KSKLTSITID IDSSVINVEG HQEGASKGYN PKKLGNRCYN IQFAFCDELK AYVTGFVRSG NTYTANGAAE MIKEIVANIK
SDDLEILFRM DSGYFDEKII ETIESLGCKY LIKAKSYSTL TSQATNSSIV FVKGEEGRET TELYTKLVKW EKDRRFVVSR VLKPEKERAQ LSLLEGSEYD
YF

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
insAB InsAB IS1F 698 1237-1934 -
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   fusion protein from -1 programmed frameshifting between insA and insB
Protein Sequence:  
VASISISCPS CSATEGVVRN GKSTAGHQRY LCSHCRKTWQ LQFTYTASQP GTHQKIIDMA MNGVGCRATA RIMGVGLNTI LRHLKNSGRS R*PRAYSRAV
M*LSALKWTN SGATSVLNHV SAGCFTRMTG YGGRLWRTSS VNALWPHWSV F*ACCRPLRS WYG*RMAGRC MNPA*RESCT *SASVTLSAL SDIT*I*DNI
WQGWDGSHCR SQNRWSCMTK SSGII*T*NT IS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
insB InsB IS1F 504 1237-1740 -
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   downstream catalytic domain
Protein Sequence:  
MPGNRPHYGR WPQHDFTSLK KLRPQSVTSR IQPGSDVIVC AEMDEQWGYV GAKSRQRWLF YAYDRIRRTV VAHVFGERTL ATLERLLSLL SAFEVVVWMT
DGWPLYESRL KGKLHVISKR YTQRIERHNL NLRQHLARLG RKSLSFSKSV ELHDKVIGHY LNIKHYQ

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
insA InsA IS1F 276 1659-1934 -
Class:   Accessory Gene
Comment:   regulatory protein
Protein Sequence:  
VASISISCPS CSATEGVVRN GKSTAGHQRY LCSHCRKTWQ LQFTYTASQP GTHQKIIDMA MNGVGCRATA RIMGVGLNTI LRHLKNSGRS R

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla CTX-M-3 (ARO:3001866) Bla CTX-M-3 Tn2.1 876 2520-3395 +
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   cephalosporin (ARO:0000032)
Sequence Family:  CTX-M beta-lactamase (ARO:3000016)
Comment:   strict match to reference sequence for ARO:3001866 (bitscore: 594)||Synonyms:
Protein Sequence:  
MVKKSLRQFT LMATATVTLL LGSVPLYAQT ADVQQKLAEL ERQSGGRLGV ALINTADNSQ ILYRADERFA MCSTSKVMAA AAVLKKSESE PNLLNQRVEI
KKSDLVNYNP IAEKHVNGTM SLAELSAAAL QYSDNVAMNK LIAHVGGPAS VTAFARQLGD ETFRLDRTEP TLNTAIPGDP RDTTSPRAMA QTLRNLTLGK
ALGDSQRAQL VTWMKGNTTG AASIQAGLPA SWVVGDKTGS GDYGTTNDIA VIWPKDRAPL ILVTYFTQPQ PKAESRRDVL ASAAKIVTDG L

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
wbuC family WbuC family Tn2.1 477 3442-3918 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   cupin fold metalloprotein
Protein Sequence:  
MKQITMSDMQ QQSAAAVQSP RLRAHRNFHP ELSDSVQRLA IAMEPGTYVR PHRHPHTFEL LLPLRGRFVV LNFDDRGTVT HRAILGETCT VLEMAAGTWH
AVLSLDTGGI IFEVKHGGYQ PVAADDYAHW APAEGEPGTT ELMAWYAQAQ VGDSTFAV

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla TEM-1 (ARO:3000873) Bla TEM-1 Tn2.1 861 4177-5037 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   penam (ARO:3000008)||monobactam (ARO:0000004)||cephalosporin (ARO:0000032)||penem (ARO:3003706)
Sequence Family:  TEM beta-lactamase (ARO:3000014)
Comment:   100 % identity with reference sequence ARO:3000873 (bitscore
Protein Sequence:  
MSIQHFRVAL IPFFAAFCLP VFAHPETLVK VKDAEDQLGA RVGYIELDLN SGKILESFRP EERFPMMSTF KVLLCGAVLS RVDAGQEQLG RRIHYSQNDL
VEYSPVTEKH LTDGMTVREL CSAAITMSDN TAANLLLTTI GGPKELTAFL HNMGDHVTRL DRWEPELNEA IPNDERDTTM PAAMATTLRK LLTGELLTLA
SRQQLIDWME ADKVAGPLLR SALPAGWFIA DKSGAGERGS RGIIAALGPD GKPSRIVVIY TTGSQATMDE RNRQIAEIGA SLIKHW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn2.1 558 5220-5777 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase (GO:0000150)
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MRLFGYARVS TSQQSLDLQV RALKDAGVKA NRIFTDKASG SSTDREGLDL LRMKVEEGDV ILVKKLDRLG RDTADMIQLI KEFDAQGVAV RFIDDGISTD
GDMGQMVVTI LSAVAQAERR RILERTNEGR QEAKLKGIKF GRRRTVDRNV VLTLHQKGTG ATEIAHQLSI ARSTVYKILE DERAS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn2.1 3006 5941-8946 +
Class:   Transposase
Function:   transposase activity (GO:0004803)
Transpoase Chemistry:   DDE
Comment:   identical to tnpA (Tn1)
Protein Sequence:  
MPVDFLTTEQ TESYGRFTGE PDELQLARYF HLDEADKEFI GKSRGDHNRL GIALQIGCVR FLGTFLTDMN HIPSGVRHFT ARQLGIRDIT VLAEYGQREN
TRREHAALIR QHYQYREFAW PWTFRLTRLL YTRSWISNER PGLLFDLATG WLMQHRIILP GATTLTRLIS EVREKATLRL WNKLALIPSA EQRSQLEMLL
GPTDCSRLSL LESLKKGPVT ISGPAFNEAI ERWKTLNDFG LHAENLSTLP AVRLKNLARY AGMTSVFNIA RMSPQKRMAV LVAFVLAWET LALDDALDVL
DAMLAVIIRD ARKIGQKKRL RSLKDLDKSA LALASACSYL LKEETPDESI RAEVFSYIPR QKLAEIITLV REIARPSDDN FHEEMVEQYG RVRRFLPHLL
NTVKFSSAPA GVTTLNACDY LSREFSSRRQ FFDDAPTEII SRSWKRLVIN KEKHITRRGY TLCFLSKLQD SLRRRDVYVT GSNRWGDPRA RLLQGADWQA
NRIKVYRSLG HPTDPQEAIK SLGHQLDSRY RQVAARLCEN EAVELDVSGP KPRLTISPLA SLDEPDSLKR LSKMISDLLP PVDLTELLLE INAHTGFADE
FFHASEASAR VDDLPVSISA VLMAEACNIG LEPLIRSNVP ALTRHRLNWT KANYLRAETI TSANARLVDF QATLPLAQIW GGGEVASADG MRFVTPVRTI
NAGPNRKYFG NNRGITWYNF VSDQYSGFHG IVIPGTLRDS IFVLEGLLEQ ETGLNPTEIM TDTAGASELV FGLFWLLGYQ FSPRLADAGA SVFWRMDHDA
DYGVLNDIAR GQSDPRKIVL QWDEMIRTAG SLKLGKVQAS VLVRSLLKSE RPSGLTQAII EVGRINKTLY LLNYIDDEDY RRRILTQLNR GESRHAVARA
ICHGQKGEIR KRYTDGQEDQ LGALGLVTNA VVLWNTIYMQ AALDHLRAQG ETLNDEDIAR LSPLCHGHIN MLGHYSFTLA ELVTKGHLRP LKEASEAENV
A

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
ISEcp1::IS1 split-Tn2.1-CP028717 ISEcp1::IS1 split Insertion Sequence 130, 1990-1221, 1990 1092
ISEcp1_IS1F-CP028717 ISEcp1 Insertion Sequence 130-2392 2263
IS1F-X52538 IS1F Insertion Sequence 1222-1989 768

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRL ISEcp1 130-143 CCTAGATTCT ACGT
IRR IS1F 1222-1244 GGTAATGACT CCAACTTACT GAT
IRL IS1F 1967-1989 TAGTCATTCA ACCGTGGTAA TGG
IRR ISEcp1 2379-2392 TGCACCTTAA ATCC