Transposon
Name: Tn2
Family: Tn3        Group: Tn3
Evidence of Transposition: Yes
 Host     

Molecular Source:plasmid RSF1030
Date of Isolation:1975

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG
IRR (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG

 Sequence     
DNA SequenceLength  4950 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCTGAC GCTCAGTGGA ACGAAAACTC ACGTTAAGGG ATTTTGGTCA TGAGATTATC AAAAAGGATC TTCACCTAGA TCCTTTTAAA TTAAAAATGA 100
AGTTTTAAAT CAATCTAAAG TATATATGAG TAAACTTGGT CTGACAGTTA CCAATGCTTA ATCAGTGAGG CACCTATCTC AGCGATCTGT CTATTTCGTT 200
CATCCATAGT TGCCTGACTC CCCGTCGTGT AGATAACTAC GATACGGGAG GGCTTACCAT CTGGCCCCAG TGCTGCAATG ATACCGCGAG ACCCACGCTC 300
ACCGGCTCCA GATTTATCAG CAATAAACCA GCCAGCCGGA AGGGCCGAGC GCAGAAGTGG TCCTGCAACT TTATCCGCCT CCATCCAGTC TATTAATTGT 400
TGCCGGGAAG CTAGAGTAAG TAGTTCGCCA GTTAATAGTT TGCGCAACGT TGTTGCCATT GCTGCAGGCA TCGTGGTGTC ACGCTCGTCG TTTGGTATGG 500
CTTCATTCAG CTCCGGTTCC CAACGATCAA GGCGAGTTAC ATGATCCCCC ATGTTGTGCA AAAAAGCGGT TAGCTCCTTC GGTCCTCCGA TCGTTGTCAG 600
AAGTAAGTTG GCAGCAGTGT TATCACTCAT GGTTATGGCA GCACTGCATA ATTCTCTTAC TGTCATGCCA TCCGTAAGAT GCTTTTCTGT GACTGGTGAG 700
TACTCAACCA AGTCATTCTG AGAATAGTGT ATGCGGCGAC CGAGTTGCTC TTGCCCGGCG TCAACACGGG ATAATACCGC ACCACATAGC AGAACTTTAA 800
AAGTGCTCAT CATTGGAAAA CGTTCTTCGG GGCGAAAACT CTCAAGGATC TTACCGCTGT TGAGATCCAG TTCGATGTAA CCCACTCGTG CACCCAACTG 900
ATCTTCAGCA TCTTTTACTT TCACCAGCGT TTCTGGGTGA GCAAAAACAG GAAGGCAAAA TGCCGCAAAA AAGGGAATAA GGGCGACACG AAAATGTTGA 1000
ATACTCATAC TCTTCCTTTT TCAATATTAT TGAAGCATTT ACCAGGGTTA TTGTCTCATG AGCGGATACA TATTTGAATG TATTTAGAAA AATAAACAAA 1100
TAGGGGTTCC GCGCACATTT CCCCGAAAAG TGCCACCTGA CGTCTAAGAA ACCATTATTA TCATGACATT AACCTATAAA AATAGGCGTA TCACGAGGCC 1200
CTTTCGTCTT CAAGAATTTT ATAAACCGTG GAGCGGGCAA TACTGAGCTG ATGAGCAATT TCCGTTGCAC CAGTGCCCTT CTGATGAAGC GTCAGCACGA 1300
CGTTCCTGTC CACGGTACGC CTGCGGCCAA ATTTGATTCC TTTCAGCTTT GCTTCCTGTC GGCCCTCATT CGTGCGTTCT AGGATCCTCC GGCGTTCAGC 1400
CTGTGCCACA GCCGACAGGA TGGTGACCAC CATTTGCCCC ATATCACCGT CGGTACTGAT CCCGTCATCA ATGAACCGGA CTGCCACGCC CTGAGCGTCA 1500
AATTCCTTTA TCAGTTGGAT CATATCGGCA GTGTCGCGGC CAAGACGGTC GAGCTTCTTA ACCAGAATGA CATCACCTTC CTCCACCTTC ATCCTCAGCA 1600
AATCCAGCCC TTCCCGGTCT GTTGAACTGC CGGATGCCTT ATCGGTAAAT ATACGGTTTG CTTTCACACC TGCGTCTTTG AGTGCTCTGA CCTGAAGATC 1700
AAGAGACTGC TGACTGGTTG AGACCCGAGC GTAACCAAAA AGTCGCATAA AAATGTACCT TAAATCGAAT ATCGGACAAC TCATGTCTAT TATTACAAAT 1800
TTACGATTTA ATAGACATAT TAATGTAACA GTTTTACGAT GTCCGATAAT TTATAACATT TCGTACGGTT GGAAAAATGT TACTAAATGC CCGTCAGGCA 1900
GGGAGGCCGA TATGCCCGTT GACTTTCTGA CCACTGAGCA GACTGAAAGC TATGGCAGAT TCACCGGTGA ACCGGATGAG CTTCAGCTGG CACGATATTT 2000
TCACCTTGAT GAAGCAGACA AGGAATTTAT CGGAAAAAGC AGAGGTGATC ACAACCGTCT GGGCATTGCC CTGCAAATTG GATGTGTCCG TTTTCTGGGC 2100
ACCTTCCTCA CCGATATGAA TCATATTCCT TCCGGCGTCC GGCATTTTAC CGCCAGACAG CTCGGGATTC GTGATATCAC CGTTCTTGCA GAATACGGTC 2200
AGAGGGAAAA TACCCGCCGT GAGCATGCAG CGCTGATACG TCAGCACTAT CAGTATCGTG AATTTGCCTG GCCCTGGACA TTTCGCCTTA CCCGTCTTTT 2300
ATATACCCGG AGCTGGATAA GCAACGAACG TCCTGGCCTG CTTTTCGATC TGGCGACAGG GTGGCTTATG CAACATCGTA TTATTCTCCC CGGAGCCACT 2400
ACGCTGACCC GGTTGATTTC AGAGGTAAGG GAAAAGGCGA CGTTGCGCCT GTGGAACAAA CTGGCACTGA TACCGTCAGC CGAACAGCGT TCACAGCTGG 2500
AGATGCTGCT GGGGCCAACT GATTGCAGCC GCCTGTCTTT ACTGGAATCA CTGAAAAAGG GCCCTGTGAC CATCAGTGGT CCGGCGTTTA ATGAAGCAAT 2600
TGAACGCTGG AAAACTCTGA ACGATTTTGG CCTGCATGCT GAAAACCTGA GTACACTCCC GGCTGTGCGC CTGAAAAATC TCGCACGTTA TGCTGGTATG 2700
ACTTCGGTGT TCAATATTGC CAGGATGTCA CCGCAGAAAA GGATGGCGGT TCTGGTTGCC TTTGTCCTTG CATGGGAAAC GCTGGCGCTG GATGATGCAT 2800
TGGACGTTCT GGACGCCATG CTGGCCGTTA TCATCCGTGA CGCCAGAAAG ATTGGGCAGA AAAAACGGCT CCGCTCGCTG AAGGATCTGG ATAAATCTGC 2900
ATTGGCGCTC GCCAGCGCAT GTTCGTACCT GCTGAAAGAA GAAACACCGG ACGAATCGAT TCGTGCTGAG GTGTTCAGCT ACATCCCAAG GCAAAAGCTG 3000
GCTGAAATCA TCACGCTTGT CCGTGAAATT GCCCGGCCCT CAGACGATAA TTTTCATGAA GAAATGGTGG AGCAGTACGG GCGCGTTCGT CGTTTCCTGC 3100
CCCATCTGCT GAATACCGTT AAATTTTCAT CCGCACCTGC CGGGGTTACC ACTCTGAATG CCTGTGACTA CCTCAGCCGG GAGTTCAGCT CACGGCGGCA 3200
GTTTTTTGAC GACGCACCAA CGGAAATTAT CAGTCGGTCA TGGAAACGGC TGGTGATTAA CAAGGAAAAA CATATCACCC GCAGGGGATA CACGCTCTGC 3300
TTTCTCAGTA AACTGCAGGA TAGTCTGAGG CGGAGGGATG TCTACGTTAC CGGCAGTAAC CGGTGGGGAG ATCCTCGTGC AAGATTACTA CAGGGTGCTG 3400
ACTGGCAGGC AAACCGGATT AAGGTTTATC GTTCTTTGGG GCACCCGACA GACCCGCAGG AAGCAATAAA ATCTCTGGGT CATCAGCTTG ATAGTCGTTA 3500
CAGACAGGTT GCTGCACGTC TTTGCGAAAA TGAGGCTGTC GAACTCGATG TTTCTGGCCC GAAGCCCCGG TTGACAATTT CTCCCCTCGC CAGTCTTGAT 3600
GAGCCGGACA GTCTGAAACG ACTGAGCAAA ATGATCAGTG ATCTACTCCC TCCGGTGGAT TTAACGGAGT TGCTGCTCGA AATTAACGCC CATACCGGAT 3700
TTGCTGATGA GTTTTTCCAT GCTAGTGAAG CCAGTGCCAG AGTTGATGAT CTGCCCGTCA GCATCAGCGC CGTGCTGATG GCTGAAGCCT GCAATATCGG 3800
TCTGGAACCA CTGATCAGAT CAAATGTTCC TGCACTGACC CGACACCGGC TGAACTGGAC AAAAGCGAAC TATCTGCGGG CTGAAACTAT CACCAGCGCT 3900
AATGCCAGAC TGGTTGATTT TCAGGCAACG CTGCCACTGG CACAGATATG GGGTGGAGGA GAAGTGGCAT CTGCAGATGG AATGCGCTTT GTTACGCCAG 4000
TCAGAACAAT CAATGCCGGA CCGAACCGCA AATACTTTGG TAATAACAGA GGGATCACCT GGTACAACTT TGTGTCCGAT CAGTATTCCG GCTTTCATGG 4100
CATCGTTATA CCGGGGACGC TGAGGGACTC TATCTTTGTG CTGGAAGGTC TTCTGGAACA GGAGACCGGG CTGAATCCAA CCGAAATTAT GACCGATACA 4200
GCAGGTGCCA GCGAACTTGT CTTTGGCCTT TTCTGGCTGC TGGGATACCA GTTTTCTCCA CGCCTGGCTG ATGCCGGTGC TTCGGTTTTC TGGCGAATGG 4300
ACCATGATGC CGACTATGGC GTGCTGAATG ATATTGCCAG AGGGCAATCA GATCCCCGAA AAATAGTCCT TCAGTGGGAC GAAATGATCC GGACCGCTGG 4400
CTCCCTGAAG CTGGGCAAAG TACAGGTTTC AGTGCTGGTC CGTTCATTGC TGAAAAGTGA ACGTCCTTCC GGACTGACTC AGGCAATCAT TGAAGTGGGG 4500
CGCATCAACA AAACGCTGTA TCTGCTTAAT TATATTGATG ATGAAGATTA CCGCCGGCGC ATTCTGACCC AGCTTAATCG GGGAGAAAGT CGCCATGCCG 4600
TTGCCAGAGC CATCTGTCAC GGTCAAAAAG GTGAGATAAG AAAACGATAT ACCGACGGTC AGGAAGATCA ACTGGGCACA CTGGGGCTGG TCACTAACGC 4700
CGTCGTGTTA TGGAACACTA TTTATATGCA GGCAGCCCTG GATCATCTCC GGGCGCAGGG TGAAACACTG AATGATGAAG ATATCGCACG CCTCTCCCCG 4800
CTTTGCCACG GACATATCAA TATGCTCGGC CATTATTCCT TCACGCTGGC AGAACTGGTG ACCAAAGGAC ATCTGAGACC ATTAAAAGAG GCGTCAGAGG 4900
CAGAAAACGT TGCTTAACGT GAGTTTTCGT TCCACTGAGC GTCAGACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 1751-1871 121 AAATGTACCT TAAATCGAAT ATCGGACAAC TCATGTCTAT TATTACAAAT TTACGATTTA
ATAGACATAT TAATGTAACA GTTTTACGAT GTCCGATAAT TTATAACATT TCGTACGGTT
G
res_site_III 1754-1776 23 TGTACCTTAA ATCGAATATC GGA
res_site_II 1784-1817 34 TGTCTATTAT TACAAATTTA CGATTTAATA GACA
res_site_I 1840-1868 29 TGTCCGATAA TTTATAACAT TTCGTACGG

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
bla TEM-1 (ARO:3000873) Tn2 148-1008 Passenger Gene Antibiotic Resistance -
tnpR Tn2 1191-1748 Accessory Gene Resolvase -
tnpA Tn2 1912-4917 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla TEM-1 (ARO:3000873) Bla TEM-1 Tn2 861 148-1008 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   penam (ARO:3000008)||monobactam (ARO:0000004)||cephalosporin (ARO:0000032)||penem (ARO:3003706)
Sequence Family:  TEM beta-lactamase (ARO:3000014)
Comment:   100 % identity with reference sequence ARO:3000873 (bitscore
Protein Sequence:  
MSIQHFRVAL IPFFAAFCLP VFAHPETLVK VKDAEDQLGA RVGYIELDLN SGKILESFRP EERFPMMSTF KVLLCGAVLS RVDAGQEQLG RRIHYSQNDL
VEYSPVTEKH LTDGMTVREL CSAAITMSDN TAANLLLTTI GGPKELTAFL HNMGDHVTRL DRWEPELNEA IPNDERDTTM PAAMATTLRK LLTGELLTLA
SRQQLIDWME ADKVAGPLLR SALPAGWFIA DKSGAGERGS RGIIAALGPD GKPSRIVVIY TTGSQATMDE RNRQIAEIGA SLIKHW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn2 558 1191-1748 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MRLFGYARVS TSQQSLDLQV RALKDAGVKA NRIFTDKASG SSTDREGLDL LRMKVEEGDV ILVKKLDRLG RDTADMIQLI KEFDAQGVAV RFIDDGISTD
GDMGQMVVTI LSAVAQAERR RILERTNEGR QEAKLKGIKF GRRRTVDRNV VLTLHQKGTG ATEIAHQLSI ARSTVYKILE DERAS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn2 3006 1912-4917 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Comment:   identical to tnpA (Tn1)
Protein Sequence:  
MPVDFLTTEQ TESYGRFTGE PDELQLARYF HLDEADKEFI GKSRGDHNRL GIALQIGCVR FLGTFLTDMN HIPSGVRHFT ARQLGIRDIT VLAEYGQREN
TRREHAALIR QHYQYREFAW PWTFRLTRLL YTRSWISNER PGLLFDLATG WLMQHRIILP GATTLTRLIS EVREKATLRL WNKLALIPSA EQRSQLEMLL
GPTDCSRLSL LESLKKGPVT ISGPAFNEAI ERWKTLNDFG LHAENLSTLP AVRLKNLARY AGMTSVFNIA RMSPQKRMAV LVAFVLAWET LALDDALDVL
DAMLAVIIRD ARKIGQKKRL RSLKDLDKSA LALASACSYL LKEETPDESI RAEVFSYIPR QKLAEIITLV REIARPSDDN FHEEMVEQYG RVRRFLPHLL
NTVKFSSAPA GVTTLNACDY LSREFSSRRQ FFDDAPTEII SRSWKRLVIN KEKHITRRGY TLCFLSKLQD SLRRRDVYVT GSNRWGDPRA RLLQGADWQA
NRIKVYRSLG HPTDPQEAIK SLGHQLDSRY RQVAARLCEN EAVELDVSGP KPRLTISPLA SLDEPDSLKR LSKMISDLLP PVDLTELLLE INAHTGFADE
FFHASEASAR VDDLPVSISA VLMAEACNIG LEPLIRSNVP ALTRHRLNWT KANYLRAETI TSANARLVDF QATLPLAQIW GGGEVASADG MRFVTPVRTI
NAGPNRKYFG NNRGITWYNF VSDQYSGFHG IVIPGTLRDS IFVLEGLLEQ ETGLNPTEIM TDTAGASELV FGLFWLLGYQ FSPRLADAGA SVFWRMDHDA
DYGVLNDIAR GQSDPRKIVL QWDEMIRTAG SLKLGKVQVS VLVRSLLKSE RPSGLTQAII EVGRINKTLY LLNYIDDEDY RRRILTQLNR GESRHAVARA
ICHGQKGEIR KRYTDGQEDQ LGTLGLVTNA VVLWNTIYMQ AALDHLRAQG ETLNDEDIAR LSPLCHGHIN MLGHYSFTLA ELVTKGHLRP LKEASEAENV
A

 References     

Heffron F, Sublett R, Hedges RW, Jacob A, Falkow S. Origin of the TEM-beta-lactamase gene found on plasmids. J Bacteriol. 1975 Apr;122(1):250-6. doi: 10.1128/JB.122.1.250-256.1975. PubMed ID: 1091625