Transposon
Name: Tn1Mer       (Synonyms: Tn7738)
Family: Tn3        Group: Tn3
Evidence of Transposition: no
 Host     

Host Organism:Serratia marcescens Molecular Source:plasmid R934
Place of Origin:France

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG
IRR (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG

 Sequence     
DNA SequenceLength  10491 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCTGAC GCTCAGTGGA ACGAAAACTC ACGTTAAGGG ATTTTGGTCA TGAGATTATC AAAAAGGATC TTCACCTAGA TCCTTTTAAA TTAAAAATGA 100
AGTTTTAAAT CAATCTAAAG TATATATGAG TAAACTTGGT CTGACAGTTA CCAATGCTTA ATCAGTGAGG CACCTATCTC AGCGATCTGT CTATTTCGTT 200
CATCCATAGT TGCCTGACTC CCCGTCATGT AGATAACTAC GATACGGGAG GGCTTACCAT CTGGCCCCAG TGCTGCAATG ATACCGCGAG ATCCACGCTC 300
ACCGGCTCCA GATTTATCAG CAATAAACCA GCCAGCCGGA AGGGCCGAGC GCAGAAGTGG TCCTGCAACT TTATCCGCCT CCATCCAGTC TATTAATTGT 400
TGCCGGGAAG CTAGAGTAAG TAGTTCGCCA GTTAATAGTT TGCGCAACGT TGTTGCCATT GCTGCAGGCA TCGTGGTGTC ACGCTCGTCG TTTGGTATGG 500
CTTCATTCAG CTCCGGTTCC CAACGATCAA GGCGGGTTAC ATGATCCCCC ATGTTGTGCA AAAAAGCGGT TAGCTCCTTC GGTCCTCCGA TCGTTGTCAG 600
AAGTAAGTTG GCCGCAGTGT TATCACTCAT GGTTATGGCA GCACTGCATA ATTCTCTTAC TGTCATGCCA TCCGTAAGAT GCTTTTCTGT GACTGGTGAG 700
TACTCAACCA AGTCATTCTG AGAATAGTGT ATGCGGCGAC CGAGTTGCTC TTGCCCGGCG TCAACACGGG ATAATACCGC ACCACATAGC AGAACTTTAA 800
AAGTGCTCAT CATTGGAAAA CGTTCTTCGG GGCGAAAACT CTCAAGGATC TTACCGCTGT TGAGATCCAG CTCGATGTAA CCCACTCGTG CACCCAACTG 900
ATCTTCAGCA TCTTTTACTT TCACCAGCGT TTCTGGGTGA GCAAAAACAG GAAAGCAAAA TGCCGCAAAA AAGGGAATAA GGGCGACACG GAAATGTTGA 1000
ATACTCATAC TCTTCCTTTT TCAATATTAT TGAAGCATTT ATCAGGGTTA TTGTCTCATG AGCGGATACA TATTTGAATG TATTTAGAAA AATAAACAAA 1100
TAGGGGTTCC GCGCACATTT CCCCGAAAAG TGCCACCTGA CGTCTAAGAA ACCATTATTA TCATGACATT AACCTATAAA AATAAGCGTA TCACGAGGCC 1200
CTTTCGTCTT CAAGAATTTT ATAAACCGTG GAGCGGGCAA TACTGAGCTG ATGAGCAATT TCCGTTGCAC CAGTGCCCTT CTGATGAAGC GTCAGCACGA 1300
CGTTCCTGTC CACGGTACGC CTGCGGCCAA ATTTGATTCC TTTCAGCTTT GCTTCCTGTC GGCCCTCATT CGTGCGCTCT AGGATCCTCC GGCGTTCAGC 1400
TTGTGCCACA GCCGACAGGA TGGTGACCAC CATTTGCCCC ATATCACCGT CGGTACTGAT CCCGTCGTCA ATAAACCGAA CCGCGACACC CTGAGCATCA 1500
AACTCTTTTA TCAGTTGGAT CATGTCGGCG GTGTCGCGGC CAAGACGGTC GAGCTTCTTC ACCAGAATGA CATCACCTTC CTCCACCTTC ATCCTCAGCA 1600
AATCCAGCCC TTCCCGATCT GTTGAACTGC CGGATGCCTT GTCGGTAAAG ATGCGGTTAG CTTTTACCCC TGCATCTTTG AGCGCTCTGA TCTGAATATC 1700
GAGGGACTGC TGGCTGGTTG AGACCCGCGC ATAACCAAAA ATTCGCATAA AATGTACCTT AAATCGAATA TCAGACACGA TGTGTCTATT ATGCCAAAAT 1800
GACGATTTAA TGGACACTCA AACGAAGCCG TTTTACTATG TCTGATAATT TATAACATTT CGGACGGTTG CAAAAATGTT ACTAAATGGG GTCGTCTCAG 1900
AATTCGGAAA ATAAAGCACG CTAAGGCGTA GTCACCCCGT GACTCCCCCG CGCCGATGCA GCGAGCTTCG TTCCGTCTTG CAGTGACGCA ATCAGCGGGC 2000
AGGAAACGTT CCCTTTCCGC GCATGGCAGG CGCACACCAG TTCAGACAGC ACGGCCTCCA TGCGTGCCAA GTCGGCCATC TTCTCGCGCA CATCCTTGAG 2100
CTTGTGCTCG GCCAGGCCGC TGGCTTCCTC GCAATGGGTG CCATCCTCCA GCCGCAGTAG CTCGGCGATT TCGTCCAGGC TAAAGCCCAG CCGCTGGGCC 2200
GATTTCACGA ACCGCACTCG TGTTACATCC GCCTCGCCAT AGCGGCGAAT GCTGCCATAG GGCTTGTCTG GCTCCGGCAG CAGGCCCTTG CGCTGGTAGA 2300
ACCGGATGGT CTCCACATTG ACCCCGGCCG CCTTGGCAAA AACGCCAATG GTCAGATTCT CAAAATTAAT TTGCATATCG CTTGACTCCG TACATAACTA 2400
CGGAAGTAAG CTTAAGCTAT CCAAACCAAA TTTGAAAGGA CAAGCGTATG TCTGAACCAC AAAACGGGCG CGGCGCGCTC TTCGCCGGTG GGCTGGCCGC 2500
CATTCTTGCG TCGGCCTGCT GCCTGGGGCC GCTGGTTTTG ATCGCCTTGG GGTTCAGCGG GGCATGGATC GGCAACCTGA CGGTGCTGGA ACCCTATCGC 2600
CCGATCTTCA TCGGCGCAGC GCTGGTCGCG CTGTTTTTCG CCTGGCGGCG CATCTACCGC CCGGCGCAAG CCTGCAAACC GGGTGAGGTC TGCGCGATTC 2700
CCCAAGTGCG AGCTACTTAC AAGCTCATTT TCTGGATCGT GGCCGTGCTG GTCCTGGTCG CGCTCGGATT TCCCTACGTC ATGCCATTTT TCTATTAATC 2800
ACAGGAGTTC ATCATGAAAA AACTGTTTGC CGCCCTCGCC CTCGCTGCCG TTGTTGCCCC CGTGTGGGCC ACCACCCAGA CCGTCACGCT GTCCGTACCG 2900
GGCATGACCT GCTCCACCTG CCCGATCACC GTCAAGAAGG CGATTTCCAA GGTCGAAGGC GTCAGCAAAA TTGACGTGAC CTTCGAGACA CGCGAAGCGG 3000
TTGTCACGTT CGATGATGCC AAGACCAGCG TGCAGAAGCT GACCAAGGCA ACCGGAGACG CGGGCTATCC GTCCAGCGTC AAGCAGTGAG CCACTGAACC 3100
CGAACCTGGG GCGATCATGG GACTGATTAC ACGCATTGCC GACAAGGCTG GCGCGCTTGG CAGCGTTGTT TCCGCGATGG GATGCGCTGC CTGTTTCCCG 3200
GCTATCGCCA GCCTGGGCGC GGCCATCGGC CTTGGCTTTC TACAGGAATA CGAAGGGTTG TTTATCTCCA AGCTGCTGCC GCTGTTCGCA GTCGTGGCTT 3300
TGCTGGCGAA TGCACTGGGC TGGCTGAGTC ATCGGCAATG GTACCGCAGC CTGCTCGGGA TGGTCGGCCC AGCCATCGTG CTGGCGGCAA TGCTCTTGTT 3400
TTTTGGCAAT TGGTGGACGG CGAACCTCCT CTATGTCGGT CTGGCCTTAA TGATCGGGGT GTCGATCTGG GATCTGCTCT CACCGGCCAA CCGCCGCTGC 3500
GAACTACCAC CCAAACACGG CTAACTGCAT TGGCAGTTGC CGAAACGAAA AGGAACGATG CAATGTATTT GAATATCACC GGAATGACCT GCGACTCGTG 3600
CGCGACACAT GTCAAGGACG CCCTGGAGAA AGTGCCGGGC GTGCTGTCGG CGCTCGTGTC CTACCCGAAA GGCTCCGCGC AACTCGCCAC CGATCCCGGC 3700
ACCTCGCCAG AGGCGCTGAC CGCCGCTGTG GCCGGCCTCG GCTACAAGGC CACACCCGCC GATGCCCCAT CCACTTCAGC GCGGGGCAGA CTGCTTGGCA 3800
AGGCGCTGGG ATGGCTGGGC GGTGGCGACA AGGCTGGTGG TGATGGGGAC GGACTGCACG TCGCCGTTAT TGGCAGCGGC GGAGCCGCGA TGGCGGCGGC 3900
GCTGAAGGCC GTCGAGCAAG GTGCGAACGT CACGCTGATC GAGCGCGGCA CCATCGGCGG TACTTGCGTC AATGTCGGCT GCGTGCCGTC CAAGATCATG 4000
ATCCGCGCTG CCCATATCGC CCATTTGCGC CGTGAAAGCC CATTCGACAG TGGCATCGCG GCGACTGTGC CTGCGATTGA TCGCAGCAAA CTACTGGCCC 4100
AGCAGCAGGC GCGCGTCGAT GAGCTGCGCC ACGCCAAGTA CGAAGGCATC CTGGACAGCA ACCCGGCCAT CACCGTGCTG CATGGTGAAG CGCGTTTCAA 4200
GGACGACCAG AGCCTTGCCG TCCGTTTAAA CGATGGCGGC GAGCGTGTGG TGGCGTTCGA CCGCTGCCTG GTCGCCACGG GTGCCAGCCC GGCCGTGCCG 4300
CCGATTCCGG GCCTGAAAGA GTCACCCTAC TGGACTTCCA CCGAGGCCCT GGTCAGCGAC ACCATTCCCG AGCGCCTGGC CGTGATCGGC TCGTCTGTGG 4400
TGGCGCTGGA ACTGGCGCAA GCCTTTGCCC GGCTGGGCAG CAAAGTGACG ATCCTAGCAC GCAGCACGCT GTTCTTCCGC GAAGACCCGG CCATCGGCGA 4500
GGCCGTTACA GCCGCGTTCC GTGCCGAAGG GATCAAGGTA TTGGAACACA CGCAAGCCAG CCAGGTCGCG CATGTGGACG GCGAATTCGT GCTGACCACC 4600
GGGTACGGTG AAATACGCGC CGACCAGCTG CTGGTCGCCA CTGGCAGGGC ACCGAACACG CGCAGCCTGG CATTGGAAGC GGCGGGAGTC GCTGCCAATG 4700
CGCAGGGGGC CATCGTCATC GACAAGGGCA TGCGCACCAG TACGCCACAC ATTTATGCGG CTGGCGACTG CACCGACCAG CCTCAGTTCG TCTATGTGGC 4800
GGCAGCGGCC GGCACCCGTG CTGCGATCAA CATGACTGGC GGCGATGCGG CCCTGGACCT GACCGCAATG CCGGCCGTGG TGTTCACCGA CCCGCAGGTC 4900
GCCACCGTGG GCTACAGCGA GGCGGAAGCA CATCACGACG GGATCGAGAC CGACAGTCGC ACCTTGACCT TGGACAACGT GCCGCGTGCG CTTGCCAACT 5000
TCGACACACG CGGCTTCATC AAGCTGGTCA TCGAGGAAGG TAGCGGACGG CTCATCGGCG TGCAAGCGGT GGCCCCGGAA GCGGGTGAAC TGATCCAGAC 5100
GGCGGTGCTC GCCATTCGCA ACCGTATGAC CGTGCAGGAA CTGGCCGACC AATTGTTCCC CTACCTGACC ATGGTCGAAG GGCTGAAGCT CGCGGCGCAG 5200
ACCTTCAGCA AGGACGTGAA GCAGCTTTCG TGCTGCGCCG GATGAGGAAA AGGAGGTGTT CAATGAGCGC CTGAAATCCT GGCAAGCACT TGATCTGCCC 5300
GCAGGCATCG AGCGGCAGGT TCACCAGAAC CGCCTGCTCA AAATCGCTCG TGAAGGTGGC CAGATGACGC TTGCTGATCT GGCAAAGTTC GAGGTGCAAC 5400
GACGCTATGC CACGCTGGTA GCGCTGGCCA TCGAAGGCAT GGCCACCGTC ACCGATGAAA TCATCGACCT TCACGATCGC ATCATCGGCA AGCTGTTCAA 5500
CGCGGCCAAG AACAAGCATC AGCAGCAGTT CCAGGCTTCC GGCAAGGCGA TCAACGACAA GGTGCGGATG TATGGGCGCA TCGGTCAAGC GTTGATTGAG 5600
GCCAAGCAAA GCGGCAGCGA TCCGTTCGCC GCCATCGAGG CCGTTATGCC CTGGGACACC TTCGCCGCCA GCGTCACCGA AGCGCAAACA TTGGCGCGGC 5700
CTGCCGACTT TGATTTCCTG CACCACATCG GTGAAAGCTA TGCCACGCTA CGCCGCTACG CGCCGCAGTT CCTGGGCGTG CTCAAATTGC GGGCTGTGCT 5800
CGATGCCATC GACATGCTGC GCGGCATGAA CAGCGACAGC GCGTGCAAGG TGCCCGCCGA TGCGCCAACC GCATTCATCA AGCCGCGCTG GGCAAAGCTG 5900
GTTCTGACCG ACGACGGCAT CGACCGGCGT TACTACGAGT TATGCGCCCT GTCGGAGCTG AAGAACGCGC TGCGCTCCGG TGATGTCTGG GTGCAGGGTT 6000
CTCGCCAGTT CAAGGACTTC GACGAATACC TGGTGCCGGT CGAGAAGTTC GCCACTTTGA AGCTGGCCAG CGAATTGCCG CTGGACGCGG CAGTACCAGA 6100
CGCCGCGCAA GCCATGATCG ACCAGACAGC TATGCTGCTG CCGCACCTCA AAATCACCGA GTTGCTGATG GAGGTCGATG AATGGACGGG CTTCACCCGC 6200
CACTTCACAC ACCTGAAGAC CAGCGACACG GCCAAGGACA AAACCTTGCT GTTGACGACG ATCCTGGCCG ACGCGATCAA CCTGGGTCTG ACCAAAATGG 6300
CCGAGTCCTG CCCTGGCACC ACCTACGCCA AGCTGTCTTG GCTGCAAGCC TGGCACATCC GCGATGAAAC CTATTCGACG GCGCTGGCCG AGCTGGTGAA 6400
TGCGCAGTTT CGGCAACCCT TCGCCGGCAA CTGGGATGAC GGCACCACGT CATCGTCGGA CGGCCAGAAC TTCAGAACCG GCAGCAAAGC AGAAAGCACT 6500
GGTCATATCA ACCCGAAGTA TGGAAGCAGT CCAGGACGGA CTTTCTACAC CCATATCTCC GACCAGTACG CGCCCTTCAG TGCCAAGGTG GTCAACGTGG 6600
GCATTCGTGA TTCAACTTAC GTGCTTGATG GCCTGCTGTA CCACGAGTCG GACTTGCGCA TCGAGGAACA CTACACCGAC ACGGCAGGCT TCACCGATCA 6700
CGTGTTTGGC TTGATGCATT TGCTGGGATT TCGCTTCGCG CCGCGTATCC GTGACTTGGG CGAAACCAAG CTATTCATCC CCAAGGGCGA TGCCGCCTAT 6800
GACGCGCTCA AGCCGATGAT TAGCAGCGAC AGGCTGAACA TCAAGCAAAT ACGCGCCCAT TGGGATGAAA TTCTGCGGCT GGCCACCTCC ATCAAGCAAG 6900
GCACGGTAAC GGCTTCGCTG ATGCTGCGCA AACTCGGCAG CTACCCGCGC CAGAACGGCT TGGCCGTGGC TTTGCGCGAG CTGGGGCGCA TCGAGCACAC 7000
GCTGTTCATT TTGGATTGGC TGCAAAGCGT GGAGCTGCGC CGCCGCGTCC ATGCGGGGCT GAATAAGGGC GAGGCGCGCA ACGCGCTGGC CAGGGCGGTC 7100
TTCTTCTACC GATTGGGTGA AATCCGCGAC CGCAGTTTTG AGCAGCAGCG CTACCGGGCC AGCGGCCTCA ATCTGGTGAC GGCGGCCATC GTGTTGTGGA 7200
ACACGGTATA TCTGGAGCGT GCCACCAGTG CTTTGCGTGG CAACGGCACG GCGCTGGACG ACACATTGTT GCAATATCTG TCGCCGCTGG GGTGGGAGCA 7300
CATCAACCTG ACCGGCGATT ACCTATGGCG CAGCAGCGCC AAGGTCGGTG CGGGGAAGTT TAGGCCATTG CGACCGCTGC CACCGGCTTA GCGTGCTTTA 7400
TTTTCCGTTT TCTGAGACGA CCCCTAAATG CCCGTCAGGC AGGGAGGCCG ATATGCCCGT TGACTTTCTG ACCACTGAGC AGACTGAAAG CTATGGCAGA 7500
TTCACCGGTG AACCGGATGA GCTTCAGCTG GCACGATATT TTCATCTTGA TGAAGCAGAC AAGGAATTTA TCGGAAAAAG CAGAGGTGAT CACAACCGTC 7600
TGGGCATTGC CCTGCAAATT GGATGTGTCC GTTTTCTGGG CACCTTCCTC ACCGATATGA ATCATATTCC TTCCGGCGTC CGGCATTTTA CCGCCAGACA 7700
GCTCGGGATT CGTGATATCA CCGTTCTTGC AGAATACGGT CAGAGGGAAA ATACCCGCCG TGAGCATGCA GCGCTGATAC GTCAGCACTA TCAGTATCGT 7800
GAATTTGCCT GGCCCTGGAC ATTTCGCCTT ACCCGTCTTT TATATACCCG GAGCTGGATA AGCAACGAAC GTCCTGGCCT GCTTTTCGAT CTGGCGACAG 7900
GGTGGCTTAT GCAACATCGT ATTATTCTCC CCGGAGCCAC TACGCTGACC CGGTTGATTT CAGAGGTAAG GGAAAAGGCG ACGTTGCGCC TGTGGAACAA 8000
ACTGGCACTG ATACCGTCAG CCGAACAACG TTCACAGCTG GAGATGCTGC TGGGGCCAAC TGATTGCAGC CGCCTGTCTT TACTGGAATC ACTGAAAAAA 8100
GGCCCTGTGA CCATCAGTGG TCCGGCGTTT AATGAAGCAA TTGAACGCTG GAAAACTCTG AACGATTTTG GCTTGCATGC TGACAACCTG AGTACACTCC 8200
CGGCTGTGCG CCTGAAAAAT CTCGCACGTT ATGCTGGTAT GACTTCGGTG TTCAATATTG CCAGGATGTC ACCGCAGAAA AGGATGGCGG TTCTGGTTGC 8300
CTTTGTCCTT GCATGGGAAA CGCTGGCGTT GGATGATGCA CTGGACGTTC TGGACGCCAT GCTGGCCGTT ATCATCCGTG ACGCCAGAAA GATTGGGCAG 8400
AAAAAACGGC TCCGCTCGCT GAAGGATCTG GATAAATCTG CATTGGCGCT CGCCAGCGCA TGTTCGTACC TGCTGAAAGA AGAAACACCG GACGAATCGA 8500
TTCGTGCTGA GGTGTTCAGC TACATCCCCA GGCAAAAGCT GGCTGAAATC ATCACGCTTG TCCGTGAAAT TGCCCGGCCC TCAGACGATA ATTTTCATGA 8600
AGAAATGGTG GAGCAGTACG GGCGCGTTCG TCGTTTCCTG CCCCATCTGC TGAATACCGT TAAATTTTCA TCCGCACCTG CCGGGGTTAC CACTCTGAAT 8700
GCCTGTGACT ACCTCAGCCG GGAGTTCAGC TCACGGCGGC AGTTTTTTGA CGACGCACCA ACGGAAATTA TCAGTCGGTC ATGGAAACGG CTGGTGATTA 8800
ACAAGGAAAA ACATATCACC CGCAGGGGAT ACACGCTCTG CTTTCTCAGT AAACTGCAGG ATAGTCTGAG GCGGAGGGAT GTCTACGTTA CCGGCAGTAA 8900
CCGGTGGGGA GATCCCCGAG CAAGATTACT ACAGGGTGCT GACTGGCAGG CAAACCGGAT TAAGGTTTAT CGTTCTCTGG GACACCCGAC AGACCCGCAG 9000
GAAGCAATAA AATCTCTGGG TCATCAGCTT GATAGTCGTT ACAGACAGGT TGCTGCACGT CTTGGCGAAA ATGAGGCTGT CGAACTCGAT GTTTCTGGCC 9100
CGAAGCCCCG GTTGACAATT TCTCCCCTCG CCAGTCTTGA TGAGCCGGAC AGTCTGAAAC GACTGAGCAA AATGATCAGT GATCTGCTCC CTCCGGTGGA 9200
TTTAACGGAG TTGCTGCTCG AAATTAACGC CCATACCGGA TTTGCTGATG AGTTTTTCCA TGCTAGTGAA GCCAGTGCCA GAGTTGATGA TCTGCCCGTC 9300
AGCATCAGCG CCGTGCTGAT GGCTGAAGCC TGCAATATCG GTCTGGAACC ACTGATCAGA TCAAATGTTC CTGCACTGAC CCGACACCGG CTGAACTGGA 9400
CAAAAGCGAA CTATCTGCGG GCTGAAACTA TCACCAGCGC TAATGCCAGA CTGGTTGATT TTCAGGCAAC GCTGCCACTG GCACAGATAT GGGGTGGCGG 9500
AGAAGTGGCA TCTGCAGATG GAATGCGCTT TGTTACGCCA GTCAGAACAA TCAATGCCGG ACCGAACCGC AAATACTTTG GTAATAACAG AGGGATCACC 9600
TGGTACAACT TTGTGTCCGA TCAGTATTCC GGCTTTCATG GCATCGTTAT ACCGGGGACG CTGAGGGACT CTATCTTTGT GCTGGAAGGC CTTCTGGAAC 9700
AGGAGACCGG GCTGAATCCA ACCGAAATTA TGACCGATAC AGCAGGTACC AGCGAACTTG TCTTTGGCCT TTTCTGGCTG CTGGGATACC AGTTTTCTCC 9800
ACGCCTGGCT GATGCCGGTG CTTCGGTTTT CTGGCGAATG GGCCATGATG CCAACTATGG CGTGCTGAAT GATATTGCCA GAGGGCAATC AGATCCCCGA 9900
AAAATAGTCC TTCAGTGGGA CGAAATGATC CGGACCGCTG GCTCCCTGAA ACTGGGCAAA GTACAGGCTT CAGTGCTGGT CCGTTCATTG CTGAAAAGTG 10000
AACGTCCTTC CGGACTGACT CAGGCAATCA TTGAAGTGGG GCGCATCAAC AAAACGCTGT ATCTGCTTAA TTATATTGAT GATGAAGATT ACCGCCGGCG 10100
CATTCTGACC CAGCTTAATC GGGGAGAAAG CCGCCATGCC GTTGCCAGAG CCATCTGTCA CGGTCAAAAA GGTGAGATAA GAAAACGATA TACCGACGGT 10200
CAGGAAGATC AACTGGGCGC ACTGGGGCTG GTCACTAACG CCGTCGTGTT ATGGAACACT ATGTATATGC AGGCAGCCCT GGATCATCTC CGGGCGCAAG 10300
GTGAAACACT GAATGATGAA GATATCGCAC GCCTCTCCCC GCTTTGCCAC GGACATATCA ATATGCTCGG CCATTATTCC TTCACGCTGG CAGAACTGGT 10400
GACCAAAGGA CATCTGAGAC CATTAAAAGA GGCGTCAGAG GTAGAAAACG TTGCTTAACG TGAGTTTTCG TTCCACTGAG CGTCAGACCC C

 Recombination Sites     

Name Coordinates Gene Sequence
res 1750-1870 121 AAATGTACCT TAAATCGAAT ATCAGACACG ATGTGTCTAT TATGCCAAAA TGACGATTTA
ATGGACACTC AAACGAAGCC GTTTTACTAT GTCTGATAAT TTATAACATT TCGGACGGTT
G
res_site_III_a 1753-1775 23 TGTACCTTAA ATCGAATATC AGA
res_site_II_a 1781-1816 36 TGTGTCTATT ATGCCAAAAT GACGATTTAA TGGACA
res_site_I 1839-1867 29 TGTCTGATAA TTTATAACAT TTCGGACGG

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
bla TEM-110 (ARO:3000973) Tn1Mer 148-1008 Passenger Gene Antibiotic Resistance -
tnpR Tn1Mer 1191-1748 Accessory Gene Resolvase -
merR Tn5036.1 1921-2376 Passenger Gene Heavy Metal Resistance -
merT Tn5036.1 2448-2798 Passenger Gene Heavy Metal Resistance +
merP Tn5036.1 2814-3089 Passenger Gene Heavy Metal Resistance +
merC Tn5036.1 3117-3524 Passenger Gene Heavy Metal Resistance +
merA Tn5036.1 3563-5245 Passenger Gene Heavy Metal Resistance +
tnpA Tn5036.1 5364-7391 Transposase   +
tnpA Tn1Mer 7453-10458 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla TEM-110 (ARO:3000973) Bla TEM-110 Tn1Mer 861 148-1008 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   cephalosporin (ARO:0000032)||penem (ARO:3003706)||monobactam (ARO:0000004)||penam (ARO:3000008)
Sequence Family:  TEM beta-lactamase (ARO:3000014)
Comment:   hydrolyzes the beta-lactam bond in penicillins and cephalosporins||perfect match to reference sequence for ARO:300973
Protein Sequence:  
MSIQHFRVAL IPFFAAFCFP VFAHPETLVK VKDAEDQLGA RVGYIELDLN SGKILESFRP EERFPMMSTF KVLLCGAVLS RVDAGQEQLG RRIHYSQNDL
VEYSPVTEKH LTDGMTVREL CSAAITMSDN TAANLLLTTI GGPKELTAFL HNMGDHVTRL DRWEPELNEA IPNDERDTTM PAAMATTLRK LLTGELLTLA
SRQQLIDWME ADKVAGPLLR SALPAGWFIA DKSGAGERGS RGIIAALGPD GKPSRIVVIY MTGSQATMDE RNRQIAEIGA SLIKHW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn1Mer 558 1191-1748 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   recombinase acitivity (GO:0000150)
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MRIFGYARVS TSQQSLDIQI RALKDAGVKA NRIFTDKASG SSTDREGLDL LRMKVEEGDV ILVKKLDRLG RDTADMIQLI KEFDAQGVAV RFIDDGISTD
GDMGQMVVTI LSAVAQAERR RILERTNEGR QEAKLKGIKF GRRRTVDRNV VLTLHQKGTG ATEIAHQLSI ARSTVYKILE DERAS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merR MerR Tn5036.1 456 1921-2376 -
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   activator-repressor of mer operon
Target:   Mercury
Protein Sequence:  
MQINFENLTI GVFAKAAGVN VETIRFYQRK GLLPEPDKPY GSIRRYGEAD VTRVRFVKSA QRLGFSLDEI AELLRLEDGT HCEEASGLAE HKLKDVREKM
ADLARMEAVL SELVCACHAR KGNVSCPLIA SLQDGTKLAA SARGSHGVTT P

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merT MerT Tn5036.1 351 2448-2798 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercuric ion transport protein
Target:   Mercury
Protein Sequence:  
MSEPQNGRGA LFAGGLAAIL ASACCLGPLV LIALGFSGAW IGNLTVLEPY RPIFIGAALV ALFFAWRRIY RPAQACKPGE VCAIPQVRAT YKLIFWIVAV
LVLVALGFPY VMPFFY

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merP MerP Tn5036.1 276 2814-3089 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercury transport
Target:   Mercury
Protein Sequence:  
MKKLFAALAL AAVVAPVWAT TQTVTLSVPG MTCSTCPITV KKAISKVEGV SKIDVTFETR EAVVTFDDAK TSVQKLTKAT GDAGYPSSVK Q

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merC MerC Tn5036.1 408 3117-3524 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   mercurry ion transport Go:0015694
Target:   Mercury
Protein Sequence:  
MGLITRIADK AGALGSVVSA MGCAACFPAI ASLGAAIGLG FLQEYEGLFI SKLLPLFAVV ALLANALGWL SHRQWYRSLL GMVGPAIVLA AMLLFFGNWW
TANLLYVGLA LMIGVSIWDL LSPANRRCEL PPKHG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
merA MerA Tn5036.1 1683 3563-5245 +
Class:   Passenger Gene
Sub Class:   Heavy Metal Resistance
Function:   response to mercury ion (GO:0046689)
Target:   Mercury
Comment:   Hg (II) mercuric ion reductase||Synonym
Protein Sequence:  
MYLNITGMTC DSCATHVKDA LEKVPGVLSA LVSYPKGSAQ LATDPGTSPE ALTAAVAGLG YKATPADAPS TSARGRLLGK ALGWLGGGDK AGGDGDGLHV
AVIGSGGAAM AAALKAVEQG ANVTLIERGT IGGTCVNVGC VPSKIMIRAA HIAHLRRESP FDSGIAATVP AIDRSKLLAQ QQARVDELRH AKYEGILDSN
PAITVLHGEA RFKDDQSLAV RLNDGGERVV AFDRCLVATG ASPAVPPIPG LKESPYWTST EALVSDTIPE RLAVIGSSVV ALELAQAFAR LGSKVTILAR
STLFFREDPA IGEAVTAAFR AEGIKVLEHT QASQVAHVDG EFVLTTGYGE IRADQLLVAT GRAPNTRSLA LEAAGVAANA QGAIVIDKGM RTSTPHIYAA
GDCTDQPQFV YVAAAAGTRA AINMTGGDAA LDLTAMPAVV FTDPQVATVG YSEAEAHHDG IETDSRTLTL DNVPRALANF DTRGFIKLVI EEGSGRLIGV
QAVAPEAGEL IQTAVLAIRN RMTVQELADQ LFPYLTMVEG LKLAAQTFSK DVKQLSCCAG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn5036.1 2028 5364-7391 +
Class:   Transposase
Function:   transposase activity (GO:0004803)
Transpoase Chemistry:   DDE
Comment:   internal deletion
Protein Sequence:  
MTLADLAKFE VQRRYATLVA LAIEGMATVT DEIIDLHDRI IGKLFNAAKN KHQQQFQASG KAINDKVRMY GRIGQALIEA KQSGSDPFAA IEAVMPWDTF
AASVTEAQTL ARPADFDFLH HIGESYATLR RYAPQFLGVL KLRAVLDAID MLRGMNSDSA CKVPADAPTA FIKPRWAKLV LTDDGIDRRY YELCALSELK
NALRSGDVWV QGSRQFKDFD EYLVPVEKFA TLKLASELPL DAAVPDAAQA MIDQTAMLLP HLKITELLME VDEWTGFTRH FTHLKTSDTA KDKTLLLTTI
LADAINLGLT KMAESCPGTT YAKLSWLQAW HIRDETYSTA LAELVNAQFR QPFAGNWDDG TTSSSDGQNF RTGSKAESTG HINPKYGSSP GRTFYTHISD
QYAPFSAKVV NVGIRDSTYV LDGLLYHESD LRIEEHYTDT AGFTDHVFGL MHLLGFRFAP RIRDLGETKL FIPKGDAAYD ALKPMISSDR LNIKQIRAHW
DEILRLATSI KQGTVTASLM LRKLGSYPRQ NGLAVALREL GRIEHTLFIL DWLQSVELRR RVHAGLNKGE ARNALARAVF FYRLGEIRDR SFEQQRYRAS
GLNLVTAAIV LWNTVYLERA TSALRGNGTA LDDTLLQYLS PLGWEHINLT GDYLWRSSAK VGAGKFRPLR PLPPA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn1Mer 3006 7453-10458 +
Class:   Transposase
Function:   transposase activity (GO:0004803)
Transpoase Chemistry:   DDE
Protein Sequence:  
MPVDFLTTEQ TESYGRFTGE PDELQLARYF HLDEADKEFI GKSRGDHNRL GIALQIGCVR FLGTFLTDMN HIPSGVRHFT ARQLGIRDIT VLAEYGQREN
TRREHAALIR QHYQYREFAW PWTFRLTRLL YTRSWISNER PGLLFDLATG WLMQHRIILP GATTLTRLIS EVREKATLRL WNKLALIPSA EQRSQLEMLL
GPTDCSRLSL LESLKKGPVT ISGPAFNEAI ERWKTLNDFG LHADNLSTLP AVRLKNLARY AGMTSVFNIA RMSPQKRMAV LVAFVLAWET LALDDALDVL
DAMLAVIIRD ARKIGQKKRL RSLKDLDKSA LALASACSYL LKEETPDESI RAEVFSYIPR QKLAEIITLV REIARPSDDN FHEEMVEQYG RVRRFLPHLL
NTVKFSSAPA GVTTLNACDY LSREFSSRRQ FFDDAPTEII SRSWKRLVIN KEKHITRRGY TLCFLSKLQD SLRRRDVYVT GSNRWGDPRA RLLQGADWQA
NRIKVYRSLG HPTDPQEAIK SLGHQLDSRY RQVAARLGEN EAVELDVSGP KPRLTISPLA SLDEPDSLKR LSKMISDLLP PVDLTELLLE INAHTGFADE
FFHASEASAR VDDLPVSISA VLMAEACNIG LEPLIRSNVP ALTRHRLNWT KANYLRAETI TSANARLVDF QATLPLAQIW GGGEVASADG MRFVTPVRTI
NAGPNRKYFG NNRGITWYNF VSDQYSGFHG IVIPGTLRDS IFVLEGLLEQ ETGLNPTEIM TDTAGTSELV FGLFWLLGYQ FSPRLADAGA SVFWRMGHDA
NYGVLNDIAR GQSDPRKIVL QWDEMIRTAG SLKLGKVQAS VLVRSLLKSE RPSGLTQAII EVGRINKTLY LLNYIDDEDY RRRILTQLNR GESRHAVARA
ICHGQKGEIR KRYTDGQEDQ LGALGLVTNA VVLWNTMYMQ AALDHLRAQG ETLNDEDIAR LSPLCHGHIN MLGHYSFTLA ELVTKGHLRP LKEASEVENV
A

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
Tn5036.1-GQ160960.2 Tn5036.1 Transposon 1888-7424 5537

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRL Tn5036.1 1888-1925 GGGGTCGTCT CAGAATTCGG AAAATAAAGC ACGCTAAG
IRR Tn5036.1 7387-7424 GAATCGCACG AAATAAAAGG CAAAAGACTC TGCTGGGG

 References     

Pinyon JL, Hall RM. Evolution of IncP-1α plasmids by acquisition of antibiotic and mercuric ion resistance transposons. Microb Drug Resist. 2011 Sep;17(3):339-43. doi: 10.1089/mdr.2010.0196. Epub 2011 Apr 8. PubMed ID: 21476866