Transposon
Name: Tn1721.1
Family: Tn3        Group: Tn21
Evidence of Transposition: no
 Host     

Host Organism:Klebsiella pneumoniae WM2b02
Place of Origin:Sydney New SouthWales, Australia Date of Isolation:2011
Other Geographic Information:human commensal from hospital intensive care unit April 2004 to July 2005

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGAACCGCAGAATTCGGAAAAAATCGTACGCTAAG
IRR (Length: 37 bp)GGGGAGCCCGCAGAATTCGGAAAAAATCGTACGCTAA

 Sequence     
DNA SequenceLength  12317 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGAACCG CAGAATTCGG AAAAAATCGT ACGCTAAGCT AACGGTGTTC TCGTGACAGC TCTTTGACTA GGCTTTCTAA GGCCATTCTG ATAGCCCTGA 100
CTTCCTGAAA AGCCATGGCT AAAATTTGTG CGGCTAAAAG GGATAACCGA TGGTAAAGTA AGTTATCCCT GTCGAGATAC TGAAAAGCGT TATCCTCGTT 200
TTTCCCAAAA CTGTTTTGCC AGTTCGCTCA GAGCGCTAGT TAACTGAGCG ACAGATTTCG CACTTTGCAA ATTATTCTGC CCGGTCTGTA CATTGGTATC 300
AGCAGCATCG CGTATATTGA TAATACTGCG GTTTATGTCT TCACTTACTG CTCCCTGCTG CTCGACCGCA GTCGCTATTT GCGCGTTCAT GTCGGTAATT 400
TCGTTAACGC GTTGGCCAAT TCCATCAAGA GCTGTAGCTG CTTCCTCTGC GTGAGCTACA CTCGTGTGCG CTTGCCGACT ACTTTGCTCC ATGACTGTAA 500
CAGCGGATTG CGCTCGCTCT TGTAGAGCGC TGATCATGCT TTGAATATCC GTTGTCGATT GCTGTGTGCG AGCAGCAAGA CTGCGAACCT CATCGGCGAC 600
AACAGCAAAA CCACGCCCCT GCTCACCAGC ACGCGCGGCC TCAATTGCTG CGTTGAGTGC CAACAAATTC GTTTGCTCGG CGATCCCTCG TATAACGTCA 700
AGAACTTTTG ATATCTCGTT ACTTTGACCT TCAAGCTCAT GAATAACCTG AGTGGCTTGC CTAATTTCAC CTTCAAGGGC AGTGATTGAC TGGCTTGTGT 800
GGGCTACCAG ACGCTGGCCA GATGCCGTCT CAGTGTCTGC TCTTCCGGCC GCATCTGCAG CATGCTGTGC ATTGCTCGCA ACCTCTTGAA TGCTTGCCAC 900
CATTTGGTTT ACTGCCGTTG CTATTTGATC TGTCTCTGCC TGCTGCTCAA CTGTAAGTAC ATTGCTTGAC TCAATATCCT TTAGTAGGCC TCGGGTGTGT 1000
TCGCTAAGCC GATTTGATGC ATCACCTATG CGACCTACTA TGGCGCCTGT TTCAGCTTGC ATCATTCGTA AAGCAAACTC TATTTGGCCA AACTCATCGG 1100
TGCGCCCAGT GTAGAGGGAT TGACTTAATG GGTTATTGGA AATATTCCTG GCTCTTTCAA CCAGTCTTCC AAGAGGAGAG AGAATAGCCA AAACACTAAC 1200
AGAGCTTAAG CTTCCTGACA TTAAAGTGGC TAACAATAAG CTGCTTATTG ATGTATCAGT AAGCATGCCG GCAGCCATTG CGCTTGATAT AATACTACCC 1300
CATATGAGCA AGAGTATTTT CACGGAAAAG CTAGCAGCCA ATTTCGGCCT CGCGGCCTTC CCGCTTCTCA ATTGAGCATA TAATTTTTCC GCAGCCAAAA 1400
CCTGCTCAGG TTCAGGCTTG GTCCTTACAG ACTGGTATTC AACAATCGAA CCATTCTTAG CTATTGGCGT TACATAAGCA CTTACCCAAT AGTGGTCGCC 1500
ATTTTTACAG CGATTTTTTA CTAGCCCCAT CCATGAGCGG CCAGATTTTA ATGTACTCCA CATATGCTCA AATGCAGCAG GCGGCATATC TGGGTGTCTT 1600
ACGATGTTGT GAGGCTGGCC TAATAGTTCT TCCTCAGTGA AACCACTGAT TTTAATGAAG TCAGGATTAA CGTACGTGAT ATGGCTTTGA GGGGAGGTAG 1700
TCGAAAGAAT ATTGGCATCT TTTGGGAGTT CTAAGTTTCG ACCCGTCACT GGTAAATTCT GGCGCATAAG AGCCTCAAGG GTTGGCTGTT TTATTTTATT 1800
GTGTTCGGCA TTAAGCCCAA TTTCTTTAGC GTTACGATAA AGCTAGCATG GAAACGATAG GTGCAAGCAA GTTAAGGGTT GCATCGCGCA TGTCAATCTA 1900
GGCTATACCC TAACTTGATG TCAAGCAGGG CTGTCATTTT CAGAAGACGA CTGCACCAGT TGATTGGGCG TAATGGCTGT TGTGCAGCCA GCTCCTGACA 2000
GTTCAATATC AGAAGTGATG TGCACCAATC TCGACTATGC TCAATACTCG TGTGCACCAA AGCGAGGTGA GCATGGCGAC GGACACCCCA CGGATTCCAG 2100
AACAAGGCGT GGCCACTCTG CCTGATGAGG CTTGGGAGCG TGCGCGCCGT CGTGCGGAGA TCATCAGTCC GTTGGCGCAG TCGGAGACGG TCGGGCACGA 2200
AGCGGCCGAT ATGGCGGCTC AGGCGCTGGG CTTGTCTCGG CGCCAGGTAT ACGTTCTGAT CCGGCGTGCC CGGCAAGGCA GCGGCCTCGT GACGGATCTG 2300
GTGCCCGGCC AGTCCGGTGG AGGTAAAGGT AAGGGGCGCT TGCCGGAACC GGTCGAGCGC GTCATCCACG AGCTACTGCA AAAGCGGTTC CTGACCAAGC 2400
AGAAGCGCAG CCTAGCGGCC TTTCACCGCG AAGTCACTCA GGTGTGCAAG GCTCAAAAAC TGCGAGTGCC GGCGCGCAAT ACCGTGGCCT TACGGATCGC 2500
TAGCCTTGAC CCGCGCAAGG TCATCCGCCG GCGGGAAGGC CAGGATGCCG CTCGTGACCT ACAAGGTGTG GGCGGCGAGC CTCCTGCCGT GACCGCGCCG 2600
CTGGAGCAGG TGCAGATAGA CCATACGGTC ATCGACCTGA TCGTGGTCGA TGACCGCGAC CGGCAACCTA TTGGCCGCCC GTACCTGACC CTCGCCATCG 2700
ACGTGTTCAC CCGCTGCGTG CTCGGCATGG TCGTCACGCT GGAAGCGCCG TCTGCCGTTT CGGTTGGCCT GTGCCTCGTG CATGTCGCCT GCGACAAGCG 2800
CCCTTGGCTG GAAGGACTGA ACGTGGAAAT GGATTGGCAG ATGAGCGGCA AGCCCTTGCT GCTCTACCTA GACAACGCGG CCGAGTTCAA GAGCGAGGCC 2900
CTGCGCCGGG GTTGCGAGCA GCATGGCATC CGGCTGGACT ATCGCCCGCT GGGACAGCCG CACTATGGCG GCATCGTGGA ACGGATCATC GGCACGGCGA 3000
TGCAGATGAT TCACGACGAA CTGCCGGGAA CGACCTTCTC CAACCCTGAC CAGCGCGGCG ACTACGATTC CGAAAACAAG GCCGCCCTGA CGCTGCGCGA 3100
GCTAGAGCGC TGGCTCACAT TGGCGGTCGG CACCTACCAC GGTTCGGTGC ACAACGGCCT GCTCCAACCG CCGGCCGCGC GCTGGGCCGA GGCCGTGGCG 3200
CGTGTCGGCG TACCGGCCGT CGTCACACGC GCTACTTCGT TCCTGGTCGA TTTTCTGCCG ATCCTCCGGC GCACGCTGAC CCGCACCGGC TTTGTCATCG 3300
ACCACATCCA CTACTACGCC GATGCGCTCA AGCCGTGGAT TGCGCGGCGT GAACGCTGGC CGTCCTTTCT GATCCGGCGC GATCCGCGCG ACATCAGCCG 3400
TATCTGGGTC CTGGAACCGG AGGGACAGCA TTACCTGGAA ATTCCCTACC GTACCTTGTC GCATCCGGCT GTCACCCTCT GGGAACAACG GCAGGCGCTG 3500
GCGAAACTGC GGCAGCAAGG GCGCGAACAG GTGGATGAGT CGGCGCTGTT CCGCATGATC GGCCAGATGC GTGAGATTGT GACCAGCGCG CAGAAGGCCA 3600
CACGCAAGGC GCGGCGTGAC GCGGATCGCC GCCAGCACCT CAAGACATCA GCTCGGCCGG ACAAGCCCGT TCCGCCGGAT ACGGATATTG CCGACCCGCA 3700
GGCAGACAAC TTGCCACCCG CCAAACCGTT CGACCAGATT GAGGAGTGGT AGCCGTGGAC GAATATCCCA TCATCGACCT GTCCCACCTG CTGCCGGCGG 3800
CCCAGGGCTT GGCCCGTCTT CCGGCGGACG AGCGCATCCA GCGCCTTCGC GCCGACCGCT GGATCGGCTA TCCGCGCGCA GTCGAGGCGC TGAACCGGCT 3900
GGAAGCCCTT TATGCGTGGC CAAACAAGCA ACGCATGCCC AACCTGCTGC TGGTTGGCCC GACCAACAAT GGCAAGTCGA TGATCGTCGA GAAGTTCCGC 4000
CGCACCCACC CGGCCAGCTC CGACGCCGAC CAGGAGCACA TCCCGGTGTT GGTCGTGCAG ATGCCGTCCG AGCCGTCCGT GATCCGCTTC TACGTCGCGC 4100
TGCTCGCCGC GATGGGCGCG CCGCTGCGCC CACGCCCACG GTTGCCGGAA ATGGAGCAAC TGGCTCTGGC ACTGCTGCGC AAGGTCGGCG TGCGCATGCT 4200
GGTGATCGAC GAGCTGCACA ACGTGCTGGC CGGCAACAGC GTCAACCGCC GGGAATTCCT CAACCTGCTG CGCTTCCTCG GCAACGAACT GCGCATCCCG 4300
TTGGTTGGGG TAGGCACGCG CGACGCCTAC CTAGCCATCC GCTCCGATGA CCAGTTGGAA AATCGCTTCG AGCCGATGAT GCTGCCGGTA TGGGAGGCCA 4400
ACGACGATTG CTGCTCACTG CTGGCCAGCT TCGCCGCTTC GCTCCCGCTG CGCCGGCCTT CCCCAATTGC CACGCTGGAC ATGGCTCGCT ACCTGCTCAC 4500
ACGCAGCGAG GGCACCATAG GGGAACTGGC GCACTTGCTG ATGGCGGCGG CCATCGTCGC CGTGGAGAGC GGCGAGGAAG CGATCAACCA TCGCACACTC 4600
AGCATGGCCG TTTACACCGG ACCCAGCGAG CGGCGGCGGC AATTCGAGCG GGAACTGATG TGAAGCCTGC GCCGCGCTGG CCGCTGCATC CCGCCCCGAA 4700
AGAAGGCGAG GCGCTGTCCT CATGGCTCAA CCGCGTGGCC CTTTGCTATC ACATGGAGGA GCCCGACCTG CTGGAGCACG ATCTTGGTCA CGGCCAGGTC 4800
GATGACCTGG ACACCGCGCC ACCACTCTCG CTGCTGGCGT TGCTTTCCCA GCGGAGCGGC ATCGAGCTGG ACCGGCTGCG CTGTATGAGT TTCGCCGGAT 4900
GGGTGCCTTG GCTACTGGAC AGCCTTGATG ACCAGATTCC AGACGCCTTG GAAACCTATG CGTTTCAGCT CTCGGTGTTG CTGCCAAGAC TCCGCCGTAA 5000
GACGCGATCC ATCACGAGCT GGCGTGCCTG GCTGCCCAGC CAGCCGATAA ACCGCGCCTG TCCGCTCTGC CTGAGCGATC CGGAGAACCA AGCCGTACTG 5100
CTCGCGTGGA AGCTGCCCCT GATGCTGAGC TGCCCGCTGC ATGGCTGCTG GCTGGAATCC TATTGGGGCG TGCCAGGGCG GTTTCTCGGC TGGGAGAACG 5200
CCGACGCCGA ACCGCGCACC GCCAGCGACG CGATTGCGGC GATGGACCAG CGTACCTGGC AGGCACTGAC AACCGGTCAC GTGGAGCTGC CGCGCCGACG 5300
CATCCACGCC GGATTGTGGT TTCGACTTCT TCGCACGCTG CTCGATGAGC TGAACACCCC GCTTTCCGCG TGCGGAACCT GCGCGGGGTA TCCCCGCCAA 5400
GTCTGGGAAG GCTGCGGGCA TCCGCTGCGT GCTGGGCAAA GTCTGTGGCG ACCGTATGAA ACCCTGAATC CGATAGTACG GTTACAGATG CTGGAGGCGG 5500
CGGCAACGGC AATCAGCTTG ATTGAGGTGA GGGACATCAG CCCGCCAGGC GAGCAGGCAA AGCTATTCTG GTCCGAGCCC CAAACCGGGT TCACCAGTGG 5600
CCTGCCGACG AAAGCGCCGA AGCCCGAGCC CATCAATCAC TGGCAGCGTG CAGTCCAGGC CATCGACGAG GCCATCATTG AAGCGCGACA CAACCCCGAG 5700
ACGGCACGCT CGCTGTTCGC GTTGGCTTCC TATGGTCGGC GCGATCCCGC TTCCTTGGAA CGGTTGCGCG CCACCTTCGT GAAGGAAGGC ATCCCGCCGG 5800
AATTTCTGTC ACATTACCTG CCTGATGCAC CCTTTGCATG TCTTAAACAA AATGACGGGT TAAGTGACAA ATTTTGACGG ATAGAGCTTT CCGGCTCACA 5900
CTGTCACATA ATCGAACGTA TACGTGACGG GTGAAAAGGT GCTGATCGGC TACATGCGGG TATCGAAGGC GGACGGATCC CAGTCCACCA ATTTGCAACG 6000
CGATGCGCTC ATCGCCGCTG GTGTGAGCCT TGCGCACCTT TACGAGGATC TGGCCTCGGG CAGGCGCGAT GATCGCCCAG GGTTGGCTGC TTGCCTGAAG 6100
GCGCTTCGTG AAGGGGACAC GCTGATCGTG TGGAAGCTCG ATCGGCTTGG CCGTGATCTG CGCCACCTGA TCAACACCGT GCACGACCTA ACTGCGCGTA 6200
GCGTGGGCCT GAAGGTCCTG ACCGGTCACG GTGCGGCGGT CGACACGACG ACTGCCGCCG GCAAGCTTGT GTTCGGTATT TTTGCCGCGC TGGCCGAGTT 6300
CGAGCGTGAG TTGATTTCCG AGCGAACAGT CGCTGGACTT ATCTCGGCGC GCGCTCGCGG CAGGAAAGGG GGGCGCCCCT TCAAGATGAC CGCCGCCAAG 6400
CTACGCCTGG CGATGGCCAG CATGGGGCAA CCGGAAACCA AGGTGGGCGA TCTCTGCGAA GAACTCGGGA TTACCCGGCA GACGCTCTAC CGGCACGTGT 6500
CGCCCAAGGG CGAACTGCGG CCAGACGGCG TAAAGCTGCT CTCCCTCGGT TCAGCCGCAT AAATGGAGGC GACCTGGAAC GGGGCGCTGT TCAGTGCGGC 6600
AACGATCCGA TTACCGGTGT CGACCCAGAG CAGCCGTAGA GCTTTTGGGA AAGCTGTCGT TCAACGCCGA GTTCAGCGGC AGTTTTTAAG TTGTGATTTT 6700
ATGGAATACT TTTGCGCAGC AAAACCATAA AGCCGCGACT TAAAAACTGT CCAGCGCAGG CACGAAGTGC TGGAGCGGTG CTGCAACGAC TTGTTAGATG 6800
ACTGAGTTTA TTAGTGGGCA CTTGCTTTGG AAAGCAAGTT TAAAACTACT ACACCACTAA CTATGAGCCC CATACCTACA AAGCCCCACG CATCAAGCTT 6900
TTGCCCATGA AGCAACCAGG CAATGGCTGT AATTATGACG ACGCCGAGTC CCGACCAGAG TGCATAAGCA ACACCGACAG GGATGGATTT CATAACCAGA 7000
GAAAGAAAAT AAAATGCGAT GCCATAACCG ATTATGACAA CGGCGGAAGG GGCAAGCTTA GTAAAGCCCT CGCTAGATTT TAATGCGGAT GTTGCGATTA 7100
CTTCGCCAAC TATTGCGATA ACAAGAAAAA GCCAGCCTTT CATGATATAT CTCCCAATTT GTGTAGGGCT TATTATGCAC GCTTAAAAAT AATAAAACCA 7200
GACTTGACCT GATAGTTTGG CTGTGAGCAA TTATGTGCTT AGTGCATCTA ACTTTGTTTT AGGGCGACTG CCCTGCTGCG TAACATCGTT GCTGCTCCAT 7300
AACATCAAAC ATCGACCCAC GGCGTAACGC GCTTGCTGCT TGGATGCCCG AGGCATAGAC TGTACAAAAA AACAGTCATA ACAAGCCATG AAAACCGCCA 7400
CTGCGCCGTT ACCACCGCTG CGTTCGGTCA AGGTTCTGGA CAGTTGCGTG AGCCGCATAC GCTACTTGCA TTACAGCTTA CGAACCGAAC AGGCTTATGT 7500
CCACTGGGTT CGTGCCTTCA TCCGTTTCCA CGGTGTGCGT CACCCGGCAA CCTTGGGCAG CAGCGAAGTC GAGGCATTTC TGTCCTGGCT GGCGAACGAG 7600
CGCAAGGTTT CGGTCTCCAC GCATCGTCAG GCATTGGCGG CCTTGCTGTT CTTCTACGGC AAGGTGCTGT GCACGGATCT GCCCTGGCTT CAGGAGATCG 7700
GAAGACCTCG GCCGTCGCGG CGCTTGCCGG TGGTGCTGAC CCCGGATGAA GTGGTTCGCA TCCTCGGTTT TCTGGAAGGC GAGCATCGTT TGTTCGCCCA 7800
GCTTCTGTAT GGAACGGGCA TGCGGATCAG TGAGGGTTTG CAACTGCGGG TCAAGGATCT GGATTTCGAT CACGGCACGA TCATCGTGCG GGAGGGCAAG 7900
GGCTCCAAGG ATCGGGCCTT GATGTTACCC GAGAGCTTGG CACCCAGCCT GCGCGAGCAG CTGTCGCGTG CACGGGCATG GTGGCTGAAG GACCAGGCCG 8000
AGGGCCGCAG CGGCGTTGCG CTTCCCGACG CCCTTGAGCG GAAGTATCCG CGCGCCGGGC ATTCCTGGCC GTGGTTCTGG GTTTTTGCGC AGCACACGCA 8100
TTCGACCGAT CCACGGAGCG GTGTCGTGCG TCGCCATCAC ATGTATGACC AGACCTTTCA GCGCGCCTTC AAACGTGCCG TAGAACAAGC AGGCATCACG 8200
AAGCCCGCCA CACCGCACAC CCTCCGCCAC TCGTTCGCGA CGGCCTTGCT CCGCAGCGGT TACGACATTC GAACCGTGCA GGATCTGCTC GGCCATTCCG 8300
ACGTCTCTAC GACGATGATT TACACGCATG TGCTGAAAGT TGGCGGTGCC GGAGTGCGCT CACCGCTTGA TGCGCTGCCG CCCCTCACTA GTGAGAGGTA 8400
GGGCAGCGCA AGTCAATCCT GGCGGATTCA CTACCCCTGC GCGAAGGCCA TCGGTGCCGC ATCGAACGGC CGGTTGCGGA AAGTCCTCCC TGCGTCCGCT 8500
GATGGCCGGC AGCAGCCCGT CGTTGCCTGA TGGATCCAAC CCCTCCGCTG CTATAGTGCA GTCGGCTTCT GACGTTCAGT GCAGCCGTCT TCTGAAAACG 8600
ACAAGGGCCG CGCCGCTTCG TCAGAATAGA GTCTGCTTTC CCATTTTTTG ACACATGCCC GCGAAGGTTA TAGATTTCAG CCTGACAGAA ACGGGGTTTG 8700
AGGCGCAACG GAACAGAAAG TGCACTTAAG CCGCCTTCAA CCAAGGAGAC ATCGTGCAGG GGCACCGCAT CGGCTACGTC CGGGTCAGCA GCTTCGACCA 8800
GAACCCGGAA CGCCAACTGG AACAGACCCA GGTGAGCAAG GTGTTCACCG ACAAGGCATC CGGCAAGGAC ACCCAGCGCC CCCAGCTCGA AGCGCTGCTG 8900
AGCTTCGTCC GCGAGGGCGA CACGGTGGTG GTGCACAGCA TGGATCGCCT GGCCCGCAAC CTCGACGACC TGCGCCGCCT GGTGCAGAAG CTGACCCAGC 9000
GCGGCGTGCG AATCGAGTTC TTGAAGGAGG GGCTGGTATT CACCGGCGAG GACTCGCCGA TGACCAACCT GATGCTGTCG GTAATGGGGG CCTTCGCTGA 9100
GTTCGAGCGC GCTCTGATCC GTGAGCGGCA GCGCGAGGGT ATCGCCCTGG CCAAGCAGCG CGGCGCGTAC CGGGGCCGCA AGAAGGCCCT GTCCGACGAG 9200
CAGACTGTTA CCCTGCGGCA GCGGGCGGCG GCAGGTGAGC CCAAGGCGCA GCTCGCCCGC GAGTTCAACA TCAGCCGCGA AACTCTCTAC CAGTACCTCC 9300
GCACGGACGA CTGACACATG CCGCGTCGCT TGATCCTCTC GGCCACGGAG CGGGACACCC TGCTCGCGCT GCCGGAAAGC CAGGATGACC TGATCCGCTA 9400
CTACACCTTC AACGATTCCG ACCTGTCACT GATCCGCCAG CGGCGCGGCG ACGCCAACCG TCTGGGCTTT GCGGTGCAAC TCTGCCTGCT GCGCTACCCC 9500
GGCTATGCGT TGGGCACTGA CAGCGAGCTG CCCGAACCGG TCATCCTGTG GGTGGCCAAG CAAGTCCAGA CCGATCCGGC GAGTTGGACG AAGTACGGCG 9600
AGCGCGATGT GACCCGTCGT GAGCACGCCC AGGAACTGCG CACCTACCTT CAACTGGCCC CGTTCGGCCT GTCCGACTTC CGCGCCCTGG TGCGCGAGCT 9700
GACCAAACTG GCCCAGCAGA CCGACAAGGG CTTGCTGCTG GCCGGCCAGG CGCTGGAGAG CCTGCGGCAG AAGCGACGCA TCCTGCCGGC GTTGAGCGTG 9800
ATCGACCGGG CTTGCTCGGA GGCCATTGCA CGGGCCAATC GGCGGGTCTA CCGCGCCTTG GTCGAACCTC TCACCGACTC GCATCGGGCC AAGCTGGACG 9900
AGTTGCTTAA GCTCAAGGCC GGCAGCAGCA TCACCTGGTT GACCTGGCTG CGGCAGGCAC CGCTGAAACC CAACTCCCGC CACATGCTTG AGCACATCGA 10000
ACGGCTGAAG ACATTTCAGC TGGTGGACTT GCCCGAAGGC CTTGGCCGGC ACATCCACCA GAACCGCCTG CTCAAGCTGG CCCGCGAGGG TGGGCAGATG 10100
ACGCCCAAAG ACCTTGGCAA GTTCGAGCCG CAGCGACGTT ATGCGACCCT GGCCGCCGTG GTACTGGAGA GCACTGCAAC CGTGATTGAT GAGCTGGTGG 10200
ATCTGCACGA CCGCATCCTG GTCAAGCTGT TCAGCGGCGC GAAACACAAG CATCAGCAGC AGTTCCAGAA GCAGGGCAAG GCGATCAATG ACAAAGTGCG 10300
CCTGTACTCC AAGATTGGCC AGGCGCTGCT GGAGGCAAAG GAAAGCGGCA GCGATCCCTA CGCCGCCATC GAGGCGGTGA TTCCCTGGGA CGAGTTCACC 10400
GAGAGCGTCA GTGAGGCCGA GCTGCTGGCC CGGCCGGAGG GCTTCGACCA CCTGCACCTG GTCGGCGAGA ACTTCGCCAC CCTGCGCCGC TACACGCCGG 10500
CCCTGCTGGA GGTACTGGAG CTGCGCGCCG CCCCGGCCGC ACAAGGCGTG CTGGCAGCCG TGCAGACCCT GCGTGAGATG AACGCCGACA ACCTGCGCAA 10600
GGTGCCGGCC GATGCCCCCA CCGCCTTCAT CAAGCCGCGC TGGAAGCCGC TGGTGATCAC CCCGGAAGGC CTCGACCGGC GCTTCTACGA AATCTGCGCG 10700
CTGTCCGAGC TGAAGAACGC CCTGCGCTCC GGCGACATCT GGGTCAAGGG CTCGCGGCAG TTCCGCGACT TCGACGACTA CCTGTTGCCG GCCGAGAAGT 10800
TCGCCGCGCT CAAGCGGGAA CAGGCCCTGC CGCTGGCGAT CAACCCGAAC AGCGACCAGT ACCTGGAAGA GCGCTTGCAG CTGCTGGACG AGCAGTTGGC 10900
CACTGTCGCC CGCCTGGCCA AGGACAACGA TCTGCCCGAT GCCATCCTCA CCGAGTCCGG CCTGAAAATC ACCCCGCTGG ATGCGGCGGT GCCGGATCGG 11000
GCGCAGGCGC TGATCGACCA GACCAGTCAG TTACTGCCGC GCATCAAGAT CACCGAACTG CTGATGGACG TGGACGATTG GACGGGCTTC AGCCGCCACT 11100
TCACCCACTT GAAGGACGGG GCCGAGGCCA AAGACCGGAC GTTGCTGCTG TCCGCGATCC TCGGTGATGC AATCAACCTC GGACTGACCA AGATGGCCGA 11200
GTCGAGCCCC GGCCTGACCT ACGCCAAGCT GTCCTGGCTA CAAGCCTGGC ATATCCGCGA TGAAACCTAT TCGGCGGCCT TGGCCGAGCT GGTCAATCAC 11300
CAGTACCGCC ATGCCTTCGC TGCCCATTGG GGCGACGGCA CCACCTCATC CTCCGATGGC CAGCGCTTCC GCGCTGGCGG CCGGGGTGAG AGCACCGGGC 11400
ACGTCAACCC GAAGTACGGC AGCGAGCCAG GACGGCTGTT CTACACCCAC ATCTCCGACC AATACGCGCC GTTCAGCACA CGCGTGGTGA ATGTCGGCGT 11500
CCGAGATTCC ACCTATGTGC TCGACGGCCT GCTGTATCAC GAGTCCGACC TGCGGATCGA GGAGCACTAC ACCGACACGG CCGGTTTCAC CGATCACGTC 11600
TTCGCCCTGA TGCACCTGCT GGGCTTCCGC TTCGCGCCAC GCATCCGCGA CCTCGGCGAA ACCAAACTGT ACGTGCCGCA GGGCGTGCAG GCCTACCCGA 11700
CGCTGCGCCC GCTGATCGGT GGCACCCTGA ACATCAAGCA CGTGCGCGCT CATTGGGACG ACATCCTGCG CCTGGCCAGC TCGATCAAGC AGGGCACCGT 11800
TACCGCCTCG CTGATGCTGC GCAAGCTCGG CAGCTATCCG CGTCAGAACG GCCTGGCTGT CGCCCTGCGC GAACTGGGCC GGATCGAACG CACGCTGTTC 11900
ATCCTGGACT GGCTGCAAAG TGTTGAACTG CGCCGCCGCG TGCATGCCGG CCTGAACAAA GGTGAGGCGC GTAACTCGCT GGCCAGGGCG GTGTTCTTCA 12000
ACCGCCTTGG GGAAATCAGG GATCGGAGCT TCGAGCAGCA GCGCTACCGG GCCAGCGGCC TCAACCTGGT GACGGCGGCT ATCGTGCTGT GGAACACGGT 12100
GTACCTGGAA CGCGCCACCC AGGGGTTGGT CGAGGCCGGC AAGCCGGTGG ACGGCGAGCT GCTGCAATTC CTGTCGCCGC TGGGCTGGGA GCACATCAAC 12200
CTAACCGGCG ATTACGTCTG GCGGCAGAGC CGCAGACTGG AAGACGGGAA GTTTCGGCCC CTACGGATGC CCGGAAAACC TTAGCGTACG ATTTTTTCCG 12300
AATTCTGCGG GCTCCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res_site_I 1886-1923 38 GCGCATGTCA ATCTAGGCTA TACCCTAACT TGATGTCA
res_site_I 1886-1923 38 GCGCATGTCA ATCTAGGCTA TACCCTAACT TGATGTCA
r6 5755-5768 14 TTGGAACGGT TGCG
r5 5801-5814 14 AATTTCTGTC ACAT
r4 5806-5819 14 CTGTCACATT ACCT
r3 5857-5870 14 GGGTTAAGTG ACAA
res 5898-5932 35 ACACTGTCAC ATAATCGAAC GTATACGTGA CGGGT
r2 5901-5914 14 CTGTCACATA ATCG
r1 5917-5930 14 CGTATACGTG ACGG
attC qacE 6659-6799 141 GTTCAACGCC GAGTTCAGCG GCAGTTTTTA AGTTGTGATT TTATGGAATA CTTTTGCGCA
GCAAAACCAT AAAGCCGCGA CTTAAAAACT GTCCAGCGCA GGCACGAAGT GCTGGAGCGG
TGCTGCAACG ACTTGTTAGA T
attI 7252-7307 56 CTTTGTTTTA GGGCGACTGC CCTGCTGCGT AACATCGTTG CTGCTCCATA ACATCA
res_site_III 8662-8687 26 CGAAGGTTAT AGATTTCAGC CTGACA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
mcp Tn1721.1 190-1767 Passenger Gene Other -
tniA In_Tn1721.1 2073-3752 Transposase   +
tniB In_Tn1721.1 3755-4663 Accessory Gene   +
tniQ In_Tn1721.1 4660-5877 Accessory Gene Target Site Selection +
tniR In_Tn1721.1 5939-6562 Accessory Gene Resolvase +
qacE (ARO:3005009) In_Tn1721.1 6811-7143 Passenger Gene Antibiotic Resistance -
intI1 In_Tn1721.1 7388-8401 Integron Integrase Class 1 +
tnpR Tn1721.1 8754-9314 Accessory Gene Resolvase +
tnpA Tn1721.1 9318-12284 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
mcp Mcp Tn1721.1 1578 190-1767 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   methyl-accepting chemotaxis protein
Protein Sequence:  
MRQNLPVTGR NLELPKDANI LSTTSPQSHI TYVNPDFIKI SGFTEEELLG QPHNIVRHPD MPPAAFEHMW STLKSGRSWM GLVKNRCKNG DHYWVSAYVT
PIAKNGSIVE YQSVRTKPEP EQVLAAEKLY AQLRSGKAAR PKLAASFSVK ILLLIWGSII SSAMAAGMLT DTSISSLLLA TLMSGSLSSV SVLAILSPLG
RLVERARNIS NNPLSQSLYT GRTDEFGQIE FALRMMQAET GAIVGRIGDA SNRLSEHTRG LLKDIESSNV LTVEQQAETD QIATAVNQMV ASIQEVASNA
QHAADAAGRA DTETASGQRL VAHTSQSITA LEGEIRQATQ VIHELEGQSN EISKVLDVIR GIAEQTNLLA LNAAIEAARA GEQGRGFAVV ADEVRSLAAR
TQQSTTDIQS MISALQERAQ SAVTVMEQSS RQAHTSVAHA EEAATALDGI GQRVNEITDM NAQIATAVEQ QGAVSEDINR SIINIRDAAD TNVQTGQNNL
QSAKSVAQLT SALSELAKQF WEKRG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniA TniA In_Tn1721.1 1680 2073-3752 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   can be extended upstream by 12 amino acids| identical to tniA (Tn1721 and In2)| 25% amino acid sequence identity to TnsB from Tn7
Protein Sequence:  
MATDTPRIPE QGVATLPDEA WERARRRAEI ISPLAQSETV GHEAADMAAQ ALGLSRRQVY VLIRRARQGS GLVTDLVPGQ SGGGKGKGRL PEPVERVIHE
LLQKRFLTKQ KRSLAAFHRE VTQVCKAQKL RVPARNTVAL RIASLDPRKV IRRREGQDAA RDLQGVGGEP PAVTAPLEQV QIDHTVIDLI VVDDRDRQPI
GRPYLTLAID VFTRCVLGMV VTLEAPSAVS VGLCLVHVAC DKRPWLEGLN VEMDWQMSGK PLLLYLDNAA EFKSEALRRG CEQHGIRLDY RPLGQPHYGG
IVERIIGTAM QMIHDELPGT TFSNPDQRGD YDSENKAALT LRELERWLTL AVGTYHGSVH NGLLQPPAAR WAEAVARVGV PAVVTRATSF LVDFLPILRR
TLTRTGFVID HIHYYADALK PWIARRERWP SFLIRRDPRD ISRIWVLEPE GQHYLEIPYR TLSHPAVTLW EQRQALAKLR QQGREQVDES ALFRMIGQMR
EIVTSAQKAT RKARRDADRR QHLKTSARPD KPVPPDTDIA DPQADNLPPA KPFDQIEEW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniB TniB In_Tn1721.1 909 3755-4663 +
Class:   Accessory Gene
Sequence Family:  ATP binding protein?
Comment:   identical to tniB (Tn1721)| similar function to Tn7 tnsC and MuB
Protein Sequence:  
MDEYPIIDLS HLLPAAQGLA RLPADERIQR LRADRWIGYP RAVEALNRLE ALYAWPNKQR MPNLLLVGPT NNGKSMIVEK FRRTHPASSD ADQEHIPVLV
VQMPSEPSVI RFYVALLAAM GAPLRPRPRL PEMEQLALAL LRKVGVRMLV IDELHNVLAG NSVNRREFLN LLRFLGNELR IPLVGVGTRD AYLAIRSDDQ
LENRFEPMML PVWEANDDCC SLLASFAASL PLRRPSPIAT LDMARYLLTR SEGTIGELAH LLMAAAIVAV ESGEEAINHR TLSMAVYTGP SERRRQFERE
LM

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniQ TniQ In_Tn1721.1 1218 4660-5877 +
Class:   Accessory Gene
Sub Class:   Target Site Selection
Comment:   identical to tniQ (Tn1721)|similar function to Tn7 tnsD?
Protein Sequence:  
MKPAPRWPLH PAPKEGEALS SWLNRVALCY HMEEPDLLEH DLGHGQVDDL DTAPPLSLLA LLSQRSGIEL DRLRCMSFAG WVPWLLDSLD DQIPDALETY
AFQLSVLLPR LRRKTRSITS WRAWLPSQPI NRACPLCLSD PENQAVLLAW KLPLMLSCPL HGCWLESYWG VPGRFLGWEN ADAEPRTASD AIAAMDQRTW
QALTTGHVEL PRRRIHAGLW FRLLRTLLDE LNTPLSACGT CAGYPRQVWE GCGHPLRAGQ SLWRPYETLN PIVRLQMLEA AATAISLIEV RDISPPGEQA
KLFWSEPQTG FTSGLPTKAP KPEPINHWQR AVQAIDEAII EARHNPETAR SLFALASYGR RDPASLERLR ATFVKEGIPP EFLSHYLPDA PFACLKQNDG
LSDKF

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tniR TniR In_Tn1721.1 624 5939-6562 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   resolution of cointegrates || Protein: ACE81792.1 || identical to tniR (Tn1721)
Protein Sequence:  
MLIGYMRVSK ADGSQSTNLQ RDALIAAGVS LAHLYEDLAS GRRDDRPGLA ACLKALREGD TLIVWKLDRL GRDLRHLINT VHDLTARSVG LKVLTGHGAA
VDTTTAAGKL VFGIFAALAE FERELISERT VAGLISARAR GRKGGRPFKM TAAKLRLAMA SMGQPETKVG DLCEELGITR QTLYRHVSPK GELRPDGVKL
LSLGSAA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
qacE (ARO:3005009) QacE In_Tn1721.1 333 6811-7143 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   quaternary ammonium salts
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Comment:   SMR export pump||perfect match to reference sequence for ARO:3005009 (bitscore:207)
Protein Sequence:  
MKGWLFLVIA IVGEVIATSA LKSSEGFTKL APSAVVIIGY GIAFYFLSLV MKSIPVGVAY ALWSGLGVVI ITAIAWLLHG QKLDAWGFVG MGLIVSGVVV
LNLLSKASAH

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
intI1 IntI1 In_Tn1721.1 1014 7388-8401 +
Class:   Integron Integrase
Sub Class:   Class 1
Transpoase Chemistry:   Tyrosine
Sequence Family:  Class 1 Integron Tyrosine Integrase
Protein Sequence:  
MKTATAPLPP LRSVKVLDSC VSRIRYLHYS LRTEQAYVHW VRAFIRFHGV RHPATLGSSE VEAFLSWLAN ERKVSVSTHR QALAALLFFY GKVLCTDLPW
LQEIGRPRPS RRLPVVLTPD EVVRILGFLE GEHRLFAQLL YGTGMRISEG LQLRVKDLDF DHGTIIVREG KGSKDRALML PESLAPSLRE QLSRARAWWL
KDQAEGRSGV ALPDALERKY PRAGHSWPWF WVFAQHTHST DPRSGVVRRH HMYDQTFQRA FKRAVEQAGI TKPATPHTLR HSFATALLRS GYDIRTVQDL
LGHSDVSTTM IYTHVLKVGG AGVRSPLDAL PPLTSER

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn1721.1 561 8754-9314 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MQGHRIGYVR VSSFDQNPER QLEQTQVSKV FTDKASGKDT QRPQLEALLS FVREGDTVVV HSMDRLARNL DDLRRLVQKL TQRGVRIEFL KEGLVFTGED
SPMTNLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKALSDEQ TVTLRQRAAA GEPKAQLARE FNISRETLYQ YLRTDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn1721.1 2967 9318-12284 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRLILSAT ERDTLLALPE SQDDLIRYYT FNDSDLSLIR QRRGDANRLG FAVQLCLLRY PGYALGTDSE LPEPVILWVA KQVQTDPASW TKYGERDVTR
REHAQELRTY LQLAPFGLSD FRALVRELTK LAQQTDKGLL LAGQALESLR QKRRILPALS VIDRACSEAI ARANRRVYRA LVEPLTDSHR AKLDELLKLK
AGSSITWLTW LRQAPLKPNS RHMLEHIERL KTFQLVDLPE GLGRHIHQNR LLKLAREGGQ MTPKDLGKFE PQRRYATLAA VVLESTATVI DELVDLHDRI
LVKLFSGAKH KHQQQFQKQG KAINDKVRLY SKIGQALLEA KESGSDPYAA IEAVIPWDEF TESVSEAELL ARPEGFDHLH LVGENFATLR RYTPALLEVL
ELRAAPAAQG VLAAVQTLRE MNADNLRKVP ADAPTAFIKP RWKPLVITPE GLDRRFYEIC ALSELKNALR SGDIWVKGSR QFRDFDDYLL PAEKFAALKR
EQALPLAINP NSDQYLEERL QLLDEQLATV ARLAKDNDLP DAILTESGLK ITPLDAAVPD RAQALIDQTS QLLPRIKITE LLMDVDDWTG FSRHFTHLKD
GAEAKDRTLL LSAILGDAIN LGLTKMAESS PGLTYAKLSW LQAWHIRDET YSAALAELVN HQYRHAFAAH WGDGTTSSSD GQRFRAGGRG ESTGHVNPKY
GSEPGRLFYT HISDQYAPFS TRVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG ETKLYVPQGV QAYPTLRPLI
GGTLNIKHVR AHWDDILRLA SSIKQGTVTA SLMLRKLGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNSLAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERATQGLVEA GKPVDGELLQ FLSPLGWEHI NLTGDYVWRQ SRRLEDGKFR PLRMPGKP

 Internal Transposable Elements (TE)     

TnCentral Accession TE Name Type Coordinates Length
In_Tn1721.1-HQ730118.1 In Integron null-null 1

 Internal Repeat Elements     

Name Associated Mobile Element Coordinates Sequence (Top Strand)
IRt In_Tn1721.1 1932-1964 TGTCATTTTC AGAAGACGAC TGCACCAGTT GAT
repeat t1 In_Tn1721.1 1940-1958 TCAGAAGACG ACTGCACCA
repeat t2 In_Tn1721.1 1980-1998 AACACGTCGG TCGAGGACT
repeat t4 In_Tn1721.1 2041-2059 TCAATACTCG TGTGCACCA
repeat i4 In_Tn1721.1 8484-8502 AGGAGGGACG CAGGCGACT
repeat i3 In_Tn1721.1 8512-8530 CGTCGGGCAG CAACGGACT
repeat i2 In_Tn1721.1 8554-8572 ATCACGTCAG CCGAAGACT
IRi In_Tn1721.1 8571-8603 CTGCAAGTCA CGTCGGCAGA AGACTTTTGC TGT
repeat i1 In_Tn1721.1 8577-8595 GTCACGTCGG CAGAAGACT

 References     

Betteridge T, Partridge SR, Iredell JR, Stokes HW. Genetic context and structural diversity of class 1 integrons from human commensal bacteria in a hospital intensive care unit. Antimicrob Agents Chemother. 2011 Aug;55(8):3939-43. doi: 10.1128/AAC.01831-10. Epub 2011 May 31. PubMed ID: 21628540