Transposon
Name: Tn1721
Family: Tn3        Group: Tn21
Evidence of Transposition: yes
 Host     

Host Organism:Escherichia coli Molecular Source:plasmid pRSD1
Date of Isolation:1979

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGGAACCGCAGAATTCGGAAAAAATCGTACGCTAAG
IRR (Length: 38 bp)GGGGAGCCCGCAGAATTCGGAAAAAATCGTCAGCTAAG

 Sequence     
DNA SequenceLength  11139 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGGAACCG CAGAATTCGG AAAAAATCGT ACGCTAAGCT AACGGTGTTC TCGTGACAGC TCTTTGACTA GGCTTTCTAA GGCCATTCTG ATAGCCCTGA 100
CTTCCTGAAA AGCCATGGCT AAAATTTGTG CGGCTAAAAG GGATAACCGA TGGTAAAGTA AGTTATCCCT GTCGAGATAC TGAAAAGCGT TATCCTCGTT 200
TTTCCCAAAA CTGTTTTGCC AGTTCGCTCA GAGCGCTAGT TAACTGAGCG ACAGATTTCG CACTTTGCAA ATTATTCTGC CCGGTCTGTA CATTGGTATC 300
AGCAGCATCG CGTATATTGA TAATACTGCG GTTTATGTCT TCACTTACTG CTCCCTGCTG CTCGACCGCA GTCGCTATTT GCGCGTTCAT GTCGGTAATT 400
TCGTTAACGC GTTGGCCAAT TCCATCAAGA GCTGTAGCTG CTTCCTCTGC GTGAGCTACA CTCGTGTGCG CTTGCCGACT ACTTTGCTCC ATGACTGTAA 500
CAGCGGATTG CGCTCGCTCT TGTAGAGCGC TGATCATGCT TTGAATATCC GTTGTCGATT GCTGTGTGCG AGCAGCAAGA CTGCGAACCT CATCGGCGAC 600
AACAGCAAAA CCACGCCCCT GCTCACCAGC ACGCGCGGCC TCAATTGCTG CGTTGAGTGC CAACAAATTC GTTTGCTCGG CGATCCCTCG TATAACGTCA 700
AGAACTTTTG ATATCTCGTT ACTTTGACCT TCAAGCTCAT GAATAACCTG AGTGGCTTGC CTAATTTCAC CTTCAAGGGC AGTGATTGAC TGGCTTGTGT 800
GGGCTACCAG ACGCTGGCCA GATGCCGTCT CAGTGTCTGC TCTTCCGGCC GCATCTGCAG CATGCTGTGC ATTGCTCGCA ACCTCTTGAA TGCTTGCCAC 900
CATTTGGTTT ACTGCCGTTG CTATTTGATC TGTCTCTGCC TGCTGCTCAA CTGTAAGTAC ATTGCTTGAC TCAATATCCT TTAGTAGGCC TCGGGTGTGT 1000
TCGCTAAGCC GATTTGATGC ATCACCTATG CGACCTACTA TGGCGCCTGT TTCAGCTTGC ATCATTCGTA AAGCAAACTC TATTTGGCCA AACTCATCGG 1100
TGCGCCCAGT GTAGAGGGAT TGACTTAATG GGTTATTGGA AATATTCCTG GCTCTTTCAA CCAGTCTTCC AAGAGGAGAG AGAATAGCCA AAACACTAAC 1200
AGAGCTTAAG CTTCCTGACA TTAAAGTGGC TAACAATAAG CTGCTTATTG ATGTATCAGT AAGCATGCCG GCAGCCATTG CGCTTGATAT AATACTACCC 1300
CATATGAGCA AGAGTATTTT CACGGAAAAG CTAGCAGCCA ATTTCGGCCT CGCGGCCTTC CCGCTTCTCA ATTGAGCATA TAATTTTTCC GCAGCCAAAA 1400
CCTGCTCAGG TTCAGGCTTG GTCCTTACAG ACTGGTATTC AACAATCGAA CCATTCTTAG CTATTGGCGT TACATAAGCA CTTACCCAAT AGTGGTCGCC 1500
ATTTTTACAG CGATTTTTTA CTAGCCCCAT CCATGAGCGG CCAGATTTTA ATGTACTCCA CATATGCTCA AATGCAGCAG GCGGCATATC TGGGTGTCTT 1600
ACGATGTTGT GAGGCTGGCC TAATAGTTCT TCCTCAGTGA AACCACTGAT TTTAATGAAG TCAGGATTAA CGTACGTGAT ATGGCTTTGA GGGGAGGTAG 1700
TCGAAAGAAT ATTGGCATCT TTTGGGAGTT CTAAGTTTCG ACCCGTCACT GGTAAATTCT GGCGCATAAG AACCTCAAGG GTTGGCTGTT TTATTTTATT 1800
GTTTTCGGCA TTAAGCCCAA TTTCTTGAGC GTTACGATAA AGCTAGCATG GAAACGATAG GTGCAAGCAA GTTAAGGGTT GCATCGCGCA TGTCAATCTA 1900
GGCTATACCC TAACTTGATG TCAGGCAGGG CCGCGCCGCT TCGTCAGAAT AGAGTCTGCT TTCCCATTTT TTGACACATG CCCGCGAAGG TTATAGATTT 2000
CAGCCTGACA GAAATGGGCT TTGAGGCACA ACGGAACAGA AAGTGCACTT AAGCCGCCTT CAACCAAGGA GACATCGTGC AGGGGCACCG CATCGGCTAC 2100
GTTCGGGTCA GCAGCTTTGA CCAGAACCCG GAACGCCAGC TGGAACAAAC CCAGGTGAGC AAGGTGTTCA CCGACAAGGC ATCGGGCAAG GACACCCAGC 2200
GCCCCCAGCT CGAAGCGCTG CTGAGCTTCG TCCGCGAAGG CGATACAGTG GTGGTGCACA GCATGGATCG GCTGGCCCGC AACCTCGATG ACCTGCGTCG 2300
CTTGGTACAG AAGCTGACTC AGCGCGGCGT GCGCATCGAG TTCCTGAAGG AGGGCCTGGT GTTCACTGGC GAGGACTCGC CGATGGCCAA CCTGATGCTG 2400
TCGGTGATGG GGGCCTTCGC TGAGTTCGAG CGCGCCCTGA TCCGCGAGCG GCAGCGTGAG GGCATCGCCT TGGCCAAGCA GCGTGGCGCG TACCGGGGCC 2500
GCAAGAAAGC CCTGTCCGAT GAGCAGGCTG CTACCCTGCG GCAGCGAGCG ACGGCCGGCG AGCCCAAGGC GCAGCTTGCC CGCGAGTTCA ACATCAGCCG 2600
GGAAACCCTC TACCAGTACC TCCGCACGGA CGACTGACAC ATGCCGCGTC GCTTGATCCT CTCGGCCACG GAGCGGGACA CCCTGCTTGC GCTGCCGGAA 2700
AGCCAGGATG ACCTGATCCG CTACTACACC TTCAACGACT CCGACCTGTC GCTGATCCGC CAGCGACGCG GCGACGCCAA CCGCCTCGGC TTCGCCGTGC 2800
AGCTCTGCCT GCTGCGCTAC CCCGGTTACG CGCTGGGAAC CGACAGCGAG CTGCCCGAGC CGGTCATCCT GTGGGTGGCG AAGCAAGTCC AGGCCGAGCC 2900
GGCGAGCTGG GCAAAGTACG GCGAGCGCGA CGTGACCCGT CGCGAGCATG CCCAGGAACT GCGCACGTAC CTGCAACTGG CCCCGTTCGG CCTGTCCGAC 3000
TTACCCGCCC TGGTGCGCGA GCTAACCGAG CTGGCCCAGC AGACCGACAA CGGCTTGCTG CTGGCCGGTC AGGCCCTGGA GAGCCTACGG CAGAAACGAC 3100
CCATCCTGCC GGCGCTGAGC GTGATTGACC GGGCCTGCTC GGAAGCCATT GCGCGAGCCA ATCGGCGGGT CTACCGCGCC CTGGTCGAAC CACTCACGGA 3200
CTCGCATCGG GCCAAGCTGG ACGAGCTGTT GAAGCTCAAG GCCGGCAGCA GCATCACCTG GTTGACCTGG CTGCGCCAGG CACCGCTGAA ACCCAACTCT 3300
CGGCACATGC TGGAACACAT CGAGCGGCTG AAGACATTTC AGTTGGTGGA CTTGCCCGAA GGCCTGGGCC GGCACATCCA CCAGAACCGC CTGCTCAAGC 3400
TGGCCCGCGA GGGTGGGCAG ATGACGCCCA AAGACCTCGG TAAGTTCGAG CCGCAGCGCC GCTACGCGAC CCTGGCCGCC GTGGTGCTGG AGAGCACCGC 3500
GACCGTGATC GATGAGCTGG TCGATCTGCA TGACCGCATC CTGGTCAAGC TGTTCAGCGG CGCGAAGCAC AAGCATCAGC AGCAGTTCCA GAAGCAGGGC 3600
AAGGCGATGA ACGACAAGGT GCGCCTGTAC TCCAGGATCG GCCAGGCGCT GCTGGAAGCG AAGGAAAGCG GCAGCGACCC CTATGCCGCC ATCGAGGCGG 3700
TGATTCCCTG GGACGAGTTC ACCGAGAGCG TCAGCGAGGC CGAGCTGCTG GCCCGGCCGG AAGGCTTCGA CCACCTGCAC CTGGTCGGCG AGAACTTCGC 3800
CACCCTGCGC CGTTACACGC CGGCCTTGCT GGAGGTGCTG GAACCTCGCG CCGCGCCGGC CGCGCAAGGC GTGCTGGCAG CCGTGCAGAC CCTGCGTGAG 3900
ATGAACGCCG ACAACCTGCG CAAGGTGCCG GCCGATGCAC CCACGGCCTT CATCAAGCCG CGCTGGAAGC CGCTGGTGAT CACCCCGGAA GGCCTCGACC 4000
GGAAATTCTA CGAAATCTGC GCCCTGTCCG AGCTGAAGAA CGCCCTGCGC TCCGGCGACA TCTGGGTCAA GGGCTCGCGG CAGTTCCGCG ACTTCGACGA 4100
CTACCTGCTG CCGGCCGAGA AGTTCGCCGC ACTCAAGCGC GAGCAGGCCC TGCCCCTGGC GATCAACCCG AACAGCGACC AGTACCTGGA AGAGCGTTTG 4200
CAGCTGCTGG ACGAGCAGTT GGCCACCGTC ACCCGCCTGG CCAAGGACAA CGAGCTGCCC GATGCCATCC TCACCGAGTC AGGGCTGAAA ATCACCCCGC 4300
TGGATGCGGC GGTGCCGGAT CGGGCGCAGG CGCTGATCGA CCAAACCAGC CAGTTACTGC CGCGCATCAA GATCACCGAA CTGCTGATGG ACGTGGACGA 4400
CTGGACGGGC TTCAGCCGCC ACTTCACCCA CTTGAAGGAC GGGGCCGAGG CCAAAGACAG GACGTTGCTG CTGTCCGCAA TCCTCGGTGA TGCGATCAAC 4500
CTCGGGCTGA CCAAGATGGC CGAGTCGAGC CCCGGCCTGA CCTACGCCAA GCTGTCCTGG CTGCAAGCCT GGCACATCCG CGACGAAACC TATTCGGCGG 4600
CCTTGGCCGA GCTGGTCAAC CACCAGTATC GCCACGCCTT TGCCGCCCAC TGGGGCGACG GCACGACCTC ATCCTCCGAT GGCCAGCGCT TCCGCGCGGG 4700
TGGCCGGGGC GAGAGCACCG GGCACGTCAA CCCGAAGTAC GGTAGCGAGC CGGGACGGCT GTTCTATACC CATATCTCCG ACCAGTACGC GCCGTTCAGC 4800
ACCCGCGTGG TGAATGTCGG CGTCCGCGAT TCCACCTATG TGCTCGACGG CCTGCTGTAC CACGAGTCCG ACCTGCGGAT CGAGGAGCAC TACACCGACA 4900
CGGCCGGCTT CACCGATCAC GTCTTTGCCC TGATGCACCT GCTAGGCTTC CGCTTCGCGC CGCGCATCCG CGACCTCGGC GAAACCAAGC TGTACGTGCC 5000
GCAGGGCGTG CAAGCCTACC CGACGTTGCG CCCGCTGATC GGCGGCACCC TGAACATCAA GCACGTGCGT GCCCACTGGG ACGACATCCT GCGCCTGGCC 5100
AGCTCGATCA AGCAGGGCAC CGTCACCGCC TCGCTGATGC TGCGCAAGTT CGGCAGCTAC CCGCGCCAGA ACGGACTGGC CGTGGCCCTG CGCGAGCTGG 5200
GCCGGATCGA GCGCACGCTG TTCATCCTGG ACTGGCTGCA AAGTGTTGAA CTGCGCCGCC GCGTGCATGC CGGCCTGAAC AAAGGTGAGG CGCGCAACTC 5300
GCTGGCCAGG GCGGTGTTCT TCAACCGCCT TGGGGAAATC AGGGATCGGA GCTTCGAGCA GCAGCGCTAC CGGGCCAGCG GCCTCAACCT GGTGACGGCG 5400
GCTATCGTGC TGTGGAACAC GGTGTACCTG GAACGCGCCA CCCAGGGGTT GGTCGAGGCC GGCAAGCCGG TGGACGGCGA GCTGCTGCAA TTCCTGTCGC 5500
CGCTGGGCTG GGAGCACATC AACCTAACCG GCGATTACGT CTGGCGGCAG AGCCGCAGAC TGGAAGACGG GAAGTTTCGG CCCTTACGGA TGCCCGGAAA 5600
ACCTTAGCTG ACGATTTTTT CCGAATTCTG CGGGCTCCCC TATCTCATCT GCGCAAGGCA GAACGTGAAG ACGGCCGCCC TGGACCTCGC CCGCGAGCGC 5700
CAGGCGCACG AGGCCGGCGC GCGGACCCGC GCACGGCCCA CGAGCGGACG CCGCAGCAGG AGCGCCAGAA GGCCGCCAGA GAGGCCGAGC GCGGCCGTGA 5800
GGCTTGGACG CTAGGGCAGG GCATGAAAAA GCCCGTAGCG GGCTGCTACG GGCGTCTGAC GCGGTGGAAA GGGGGAGGGG ATGTTGTCTA CATGGCTCTG 5900
CTGTAGTGAG TGGGTTGCGC TCCGGCAGCG GTCCTGATCA ATCGTCACCC TTTCTCGGTC CTTCAACGTT CCTGACAACG AGCCTCCTTT TCGCCAATCC 6000
ATCGACAATC ACCGCGAGTC CCTGCTCGAA CGCTGCGTCC GGACCGGCTT CGTCGAAGGC GTCTATCGCG GCCCGCAACA GCGGCGAGAG CGGAGCCTGT 6100
TCAACGGTGC CGCCGCGCTC GCCGGCATCG CTGTCGCCGG CCTGCTCCTC AAGCACGGCC CCAACAGTGA AGTAGCTGAT TGTCATCAGC GCATTGACGG 6200
CGTCCCCGGC CGAAAAACCC GCCTCGCAGA GGAAGCGAAG CTGCGCGTCG GCCGTTTCCA TCTGCGGTGC GCCCGGTCGC GTGCCGGCAT GGATGCGCGC 6300
GCCATCGCGG TAGGCGAGCA GCGCCTGCCT GAAGCTGCGG GCATTCCCGA TCAGAAATGA GCGCCAGTCG TCGTCGGCTC TCGGCACCGA ATGCGTATGA 6400
TTCTCCGCCA GCATGGCTTC GGCCAGTGCG TCGAGCAGCG CCCGCTTGTT CCTGAAGTGC CAGTAAAGCG CCGGCTGCTG AACCCCCAAC CGTTCCGCCA 6500
GTTTGCGTGT CGTCAGACCG TCTACGCCGA CCTCGTTCAA CAGGTCCAGG GCGGCACGGA TCACTGTATT CGGCTGCAAC TTTGTCATGC TTGACACTTT 6600
ATCACTGATA AACATAATAT GTCCACCAAC TTATCAGTGA TAAAGAATCC GCGCGTTCAA TCGGACCAGC GGAGGCTGGT CCGGAGGCCA GACGTGAAAC 6700
CCAACAGACC CCTGATCGTA ATTCTGAGCA CTGTCGCGCT CGACGCTGTC GGCATCGGCC TGATTATGCC GGTGCTGCCG GGCCTCCTGC GCGATCTGGT 6800
TCACTCGAAC GACGTCACCG CCCACTATGG CATTCTGCTG GCGCTGTATG CGTTGATGCA ATTTGCCTGC GCACCTGTGC TGGGCGCGCT GTCGGATCGT 6900
TTCGGGCGGC GGCCGGTCTT GCTCGTCTCG CTGGCCGGCG CTGCTGTCGA CTACGCCATC ATGGCGACGG CGCCTTTCCT TTGGGTTCTC TATATCGGGC 7000
GGATCGTGGC CGGCATCACC GGGGCGACTG GGGCGGTAGC CGGCGCTTAT ATTGCCGATA TCACTGATGG CGATGAGCGC GCGCGGCACT TCGGCTTCAT 7100
GAGCGCCTGT TTCGGGTTCG GGATGGTCGC GGGACCTGTG CTCGGTGGGC TGATGGGCGG TTTCTCCCCC CACGCTCCGT TCTTCGCCGC GGCAGCCTTG 7200
AACGGCCTCA ATTTCCTGAC GGGCTGTTTC CTTTTGCCGG AGTCGCACAA AGGCGAACGC CGGCCGTTAC GCCGGGAGGC TCTCAACCCG CTCGCTTCGT 7300
TCCGGTGGGC CCGGGGCATG ACCGTCGTCG CCGCCCTGAT GGCGGTCTTC TTCATCATGC AACTTGTCGG ACAGGTGCCG GCCGCGCTTT GGGTCATTTT 7400
CGGCGAGGAT CGCTTTCACT GGGACGCGAC CACGATCGGC ATTTCGCTTG CCGCATTTGG CATTCTGCAT TCACTCGCCC AGGCAATGAT CACCGGCCCT 7500
GTAGCCGCCC GGCTCGGCGA AAGGCGGGCA CTCATGCTCG GAATGATTGC CGACGGCACA GGCTACATCC TGCTTGCCTT CGCGACACGG GGATGGATGG 7600
CGTTCCCGAT CATGGTCCTG CTTGCTTCGG GTGGCATCGG AATGCCGGCG CTGCAAGCAA TGTTGTCCAG GCAGGTGGAT GAGGAACGTC AGGGGCAGCT 7700
GCAAGGCTCA CTGGCGGCGC TCACCAGCCT GACCTCGATC GTCGGACCCC TCCTCTTCAC GGCGATCTAT GCGGCTTCTA TAACAACGTG GAACGGGTGG 7800
GCATGGATTG CAGGCGCTGC CCTCTACTTG CTCTGCCTGC CGGCGCTGCG TCGCGGGCTT TGGAGCGGCG CAGGGCAACG AGCCGATCGC TGATCGTGGA 7900
AACGATAGGC CTATGCCATG CGGGTCAAGG CGACTTCCGG CAAGCTATAC GCGCCCTAGG AGTGCGGTTG GAACGTTGGC CCAGCCAGAT ACTCCCGATC 8000
ACGAGCAGGA CGCCGATGAT TTGAAGCGCA CTCAGCGTCT GATCCAAGAA CAACCATCCT AGCAACAGCG CGGCGACGGC GGTCCCCGGG CTGAGAAAGC 8100
CCAGTAAGGA AACAACTGTA GGTTCGAGTC GCGAGATCCC CCGGAACCAA AGGAAGTAGG TTAAACCCGC TCCGATCAGG CCGAGCCACG CCAGGCCGAG 8200
AACATTGGTT CCTGTAGGCA TCGGGATTGG CGGATCAAAC ACTAAAGCTA CTGGAACGAG CAGAAGTCCT CCGGCCGCCA GTTGCCAGGC GGTAAAGGTG 8300
AGCAGAGGCA CGGGAGGTTG CCACTTGCGG GTCAGCACGG TTCCGAACGC CATGGAAACC GCCCCCGCCA GGCCCGCTGC GACGCCGACA GGATCTAGCG 8400
CTGCGTTTGG TGTCAACACC AACAGCGCCA CGCCCGCAGT TCCGCAAATA GCCCCCAGGA CCGCCATCAA TCGTATCGGG CTACCTAGCA GAGCGGCAGA 8500
GATGAACACG ACCATCAGCG GCTGCACACG CCTACCGTCG CCGCGACCCC GCCCGGCAGG CGGTAGACCG AAATAAACAA CAAGCTCCAG AATAGCGAAA 8600
TATTAAGTGC GCCGAGGATG AAGATGCGCA TCCACCAGAT TCCCGTTGGA ATCTGTCGGA CGATCATCAC GAGCAATAAA CCCGCCGGCA ACGCCCGCAG 8700
CATCGCGACC GTCATCGGTG AGAAGTTCGG CAGGTATTGG GTGGTGACAA TGTAGGTGCT GCCCCAAATG GCAGGTGCTA TCGCTGTGAA CAATAAATCG 8800
GGCGTGCGTA ATGACATGCG ATTACAAGAC CTCCGCTACG GCGATGGGTT TTTGAGAGTT GCAGGCGCCG CGATGACCGC ACCCTGACTT GGACTGGCCC 8900
TGCCTCGCAC CAATCCACCT CGGCTATGGC CGCGATCATG CGAGGCCCGA AAATTACACG ACCTGTACAC GTCCGCCGAA CCCGGAACGC AACAGAGCTT 9000
CGTGGGCATC CCGATCCGGG TCGTAGCAGC AGTCCTGGAC CAAACGCACG TCGTAGTCCG CATCACTAGC CCAGGCGACG CTTGAAAGAA CAACGCCGGT 9100
GGTGCTTATC CCGGCCATGA CAAGCGTGCT TACGCCGCGC GTCCGAAGGT CGGCGTCGAG CGCCGTGCCA TAAAAGACGC TGGCTCGGCG GACATGCATA 9200
GAAAAGGTCG CCCCGTTCGA TCGCAAGCCC TTCGACGGGC AGACCGGTGC GAAATCGTCC GCTCGGGAGA TACGGTGAGA TTTGGCGATT CGTCGCCGGC 9300
GGCGCATGTT CATACTCTTC GCCGAGCGAA AAGTTGGGGA ACAGCACGGG CCGGCCGCGC AAGGCGTGCT GGCAGCCGTG CAGACCCTGC GTGAGATGAA 9400
CGCCGACAAC CTGCGCAAGG TGCCGGCCGA TGCACCCACG GCCTTCATCA AGCCGCGCTG GAAGCCGCTG GTGATCACCC CGGAAGGCCT CGACCGGAAA 9500
TTCTACGAAA TCTGCGCCCT GTCCGAGCTG AAGAACGCCC TGCGCTCCGG CGACATCTGG GTCAAGGGCT CGCGGCAGTT CCGCGACTTC GACGACTACC 9600
TGCTGCCGGC GCGAGAAGGT TCGCCGGCAC GTCAAGCGCG AGCAGGCCCT GCCCCTGGCG ATCAACCCGA ACAGCGACCA GTACCTGGAA GAGCGTTTGC 9700
AGCTGCTGGA CGAGCAGTTG GCCACCGTCA CCCGCCTGGC CAAGGACAAC GAGCTGCCCG ATGCCATCCT CACCGAGTCA GGGCTGAAAA TCACCCCGCT 9800
GGATGCGGCG GTGCCGGATC GGGCGCAGGC GCTGATCGAC CAAACCAGCC AGTTACTGCC GCGCATCAAG ATCACCGAAC TGCTGATGGA CGTGGACGAC 9900
TGGACGGGCT TCAGCCGCCA CTTCACCCAC TTGAAGGACG GGGCCGAGGC CAAAGACAGG ACGTTGCTGC TGTCCGCAAT CCTCGGTGAT GCGATCAACC 10000
TCGGGCTGAC CAAGATGGCC GAGTCGAGCC CCGGCCTGAC CTACGCCAAG CTGTCCTGGC TGCAAGCCTG GCACATCCGC GACGAAACCT ATTCGGCGGC 10100
CTTGGCCGAG CTGGTCAACC ACCAGTATCG CCACGCCTTT GCCGCCCACT GGGGCGACGG CACGACCTCA TCCTCCGATG GCCAGCGCTT CCGCGCGGGT 10200
GGCCGGGGCG AGAGCACCGG GCACGTCAAC CCGAAGTACG GTAGCGAGCC GGGACGGCTG TTCTATACCC ATATCTCCGA CCAGTACGCG CCGTTCAGCA 10300
CCCGCGTGGT GAATGTCGGC GTCCGCGATT CCACCTATGT GCTCGACGGC CTGCTGTACC ACGAGTCCGA CCTGCGGATC GAGGAGCACT ACACCGACAC 10400
GGCCGGCTTC ACCGATCACG TCTTTGCCCT GATGCACCTG CTAGGCTTCC GCTTCGCGCC GCGCATCCGC GACCTCGGCG AAACCAAGCT GTACGTGCCG 10500
CAGGGCGTGC AAGCCTACCC GACGTTGCGC CCGCTGATCG GCGGCACCCT GAACATCAAG CACGTGCGTG CCCACTGGGA CGACATCCTG CGCCTGGCCA 10600
GCTCGATCAA GCAGGGCACC GTCACCGCCT CGCTGATGCT GCGCAAGTTC GGCAGCTACC CGCGCCAGAA CGGACTGGCC GTGGCCCTGC GCGAGCTGGG 10700
CCGGATCGAG CGCACGCTGT TCATCCTGGA CTGGCTGCAA AGTGTTGAAC TGCGCCGCCG CGTGCATGCC GGCCTGAACA AAGGTGAGGC GCGCAACTCG 10800
CTGGCCAGGG CGGTGTTCTT CAACCGCCTT GGGGAAATCA GGGATCGGAG CTTCGAGCAG CAGCGCTACC GGGCCAGCGG CCTCAACCTG GTGACGGCGG 10900
CTATCGTGCT GTGGAACACG GTGTACCTGG AACGCGCCAC CCAGGGGTTG GTCGAGGCCG GCAAGCCGGT GGACGGCGAG CTGCTGCAAT TCCTGTCGCC 11000
GCTGGGCTGG GAGCACATCA ACCTAACCGG CGATTACGTC TGGCGGCAGA GCCGCAGACT GGAAGACGGG AAGTTTCGGC CCTTACGGAT GCCCGGAAAA 11100
CCTTAGCTGA CGATTTTTTC CGAATTCTGC GGGCTCCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res_site_I 1886-1925 40 GCGCATGTCA ATCTAGGCTA TACCCTAACT TGATGTCAGG
res_site_II 1938-1981 44 GCTTCGTCAG AATAGAGTCT GCTTTCCCAT TTTTTGACAC ATGC
res_site_III 1985-2015 31 CGAAGGTTAT AGATTTCAGC CTGACAGAAA T

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
mcp Tn1721 190-1767 Passenger Gene Other -
tnpR Tn1721 2077-2637 Accessory Gene Resolvase +
tnpA Tn1721 2641-5607 Transposase   +
tetR (ARO:3003479) Tn1721 5938-6615 Passenger Gene Antibiotic Resistance -
tet(A) (ARO:3000165) Tn1721 6694-7893 Passenger Gene Antibiotic Resistance +
yedA Tn1721 7925-8515 Passenger Gene Other -
tnpA C-ter Tn1721 9354-11106 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
mcp Mcp Tn1721 1578 190-1767 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   methyl-accepting chemotaxis protein
Protein Sequence:  
MRQNLPVTGR NLELPKDANI LSTTSPQSHI TYVNPDFIKI SGFTEEELLG QPHNIVRHPD MPPAAFEHMW STLKSGRSWM GLVKNRCKNG DHYWVSAYVT
PIAKNGSIVE YQSVRTKPEP EQVLAAEKLY AQLRSGKAAR PKLAASFSVK ILLLIWGSII SSAMAAGMLT DTSISSLLLA TLMSGSLSSV SVLAILSPLG
RLVERARNIS NNPLSQSLYT GRTDEFGQIE FALRMMQAET GAIVGRIGDA SNRLSEHTRG LLKDIESSNV LTVEQQAETD QIATAVNQMV ASIQEVASNA
QHAADAAGRA DTETASGQRL VAHTSQSITA LEGEIRQATQ VIHELEGQSN EISKVLDVIR GIAEQTNLLA LNAAIEAARA GEQGRGFAVV ADEVRSLAAR
TQQSTTDIQS MISALQERAQ SAVTVMEQSS RQAHTSVAHA EEAATALDGI GQRVNEITDM NAQIATAVEQ QGAVSEDINR SIINIRDAAD TNVQTGQNNL
QSAKSVAQLT SALSELAKQF WEKRG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn1721 561 2077-2637 +
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MQGHRIGYVR VSSFDQNPER QLEQTQVSKV FTDKASGKDT QRPQLEALLS FVREGDTVVV HSMDRLARNL DDLRRLVQKL TQRGVRIEFL KEGLVFTGED
SPMANLMLSV MGAFAEFERA LIRERQREGI ALAKQRGAYR GRKKALSDEQ AATLRQRATA GEPKAQLARE FNISRETLYQ YLRTDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn1721 2967 2641-5607 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPRRLILSAT ERDTLLALPE SQDDLIRYYT FNDSDLSLIR QRRGDANRLG FAVQLCLLRY PGYALGTDSE LPEPVILWVA KQVQAEPASW AKYGERDVTR
REHAQELRTY LQLAPFGLSD LPALVRELTE LAQQTDNGLL LAGQALESLR QKRPILPALS VIDRACSEAI ARANRRVYRA LVEPLTDSHR AKLDELLKLK
AGSSITWLTW LRQAPLKPNS RHMLEHIERL KTFQLVDLPE GLGRHIHQNR LLKLAREGGQ MTPKDLGKFE PQRRYATLAA VVLESTATVI DELVDLHDRI
LVKLFSGAKH KHQQQFQKQG KAMNDKVRLY SRIGQALLEA KESGSDPYAA IEAVIPWDEF TESVSEAELL ARPEGFDHLH LVGENFATLR RYTPALLEVL
EPRAAPAAQG VLAAVQTLRE MNADNLRKVP ADAPTAFIKP RWKPLVITPE GLDRKFYEIC ALSELKNALR SGDIWVKGSR QFRDFDDYLL PAEKFAALKR
EQALPLAINP NSDQYLEERL QLLDEQLATV TRLAKDNELP DAILTESGLK ITPLDAAVPD RAQALIDQTS QLLPRIKITE LLMDVDDWTG FSRHFTHLKD
GAEAKDRTLL LSAILGDAIN LGLTKMAESS PGLTYAKLSW LQAWHIRDET YSAALAELVN HQYRHAFAAH WGDGTTSSSD GQRFRAGGRG ESTGHVNPKY
GSEPGRLFYT HISDQYAPFS TRVVNVGVRD STYVLDGLLY HESDLRIEEH YTDTAGFTDH VFALMHLLGF RFAPRIRDLG ETKLYVPQGV QAYPTLRPLI
GGTLNIKHVR AHWDDILRLA SSIKQGTVTA SLMLRKFGSY PRQNGLAVAL RELGRIERTL FILDWLQSVE LRRRVHAGLN KGEARNSLAR AVFFNRLGEI
RDRSFEQQRY RASGLNLVTA AIVLWNTVYL ERATQGLVEA GKPVDGELLQ FLSPLGWEHI NLTGDYVWRQ SRRLEDGKFR PLRMPGKP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tetR (ARO:3003479) TetR Tn1721 678 5938-6615 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000); antibiotic target alteration (ARO:0001001)
Target:   tetracycline antibiotic (ARO:3000050)
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Comment:   52% match to reference sequence for ARO:3003479 (bitscore: 214)|| repressor of tetA||Synonyms:
Protein Sequence:  
MFISDKVSSM TKLQPNTVIR AALDLLNEVG VDGLTTRKLA ERLGVQQPAL YWHFRNKRAL LDALAEAMLA ENHTHSVPRA DDDWRSFLIG NARSFRQALL
AYRDGARIHA GTRPGAPQME TADAQLRFLC EAGFSAGDAV NALMTISYFT VGAVLEEQAG DSDAGERGGT VEQAPLSPLL RAAIDAFDEA GPDAAFEQGL
AVIVDGLAKR RLVVRNVEGP RKGDD

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tet(A) (ARO:3000165) Tet(A) Tn1721 1200 6694-7893 +
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic efflux (ARO:0010000)
Target:   tetracycline antibiotic (ARO:3000050)
Sequence Family:  major facilitator superfamily (MFS) antibiotic efflux pump (ARO:0010002)
Protein Sequence:  
MKPNRPLIVI LSTVALDAVG IGLIMPVLPG LLRDLVHSND VTAHYGILLA LYALMQFACA PVLGALSDRF GRRPVLLVSL AGAAVDYAIM ATAPFLWVLY
IGRIVAGITG ATGAVAGAYI ADITDGDERA RHFGFMSACF GFGMVAGPVL GGLMGGFSPH APFFAAAALN GLNFLTGCFL LPESHKGERR PLRREALNPL
ASFRWARGMT VVAALMAVFF IMQLVGQVPA ALWVIFGEDR FHWDATTIGI SLAAFGILHS LAQAMITGPV AARLGERRAL MLGMIADGTG YILLAFATRG
WMAFPIMVLL ASGGIGMPAL QAMLSRQVDE ERQGQLQGSL AALTSLTSIV GPLLFTAIYA ASITTWNGWA WIAGAALYLL CLPALRRGLW SGAGQRADR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
yedA YedA Tn1721 591 7925-8515 -
Class:   Passenger Gene
Sub Class:   Other
Comment:   Eam family inner membrane transporter
Protein Sequence:  
MVVFISAALL GSPIRLMAVL GAICGTAGVA LLVLTPNAAL DPVGVAAGLA GAVSMAFGTV LTRKWQPPVP LLTFTAWQLA AGGLLLVPVA LVFDPPIPMP
TGTNVLGLAW LGLIGAGLTY FLWFRGISRL EPTVVSLLGF LSPGTAVAAL LLGWLFLDQT LSALQIIGVL LVIGSIWLGQ RSNRTPRARI ACRKSP

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA C-ter TnpA C-ter Tn1721 1753 9354-11106 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   truncated tnpA
Protein Sequence:  
AAQGVLAAVQ TLREMNADNL RKVPADAPTA FIKPRWKPLV ITPEGLDRKF YEICALSELK NALRSGDIWV KGSRQFRDFD DYLLPAREGS PARQARAGPA
PGDQPEQRPV PGRAFAAAGR AVGHRHPPGQ GQRAARCHPH RVRAENHPAG CGGAGSGAGA DRPNQPVTAA HQDHRTADGR GRLDGLQPPL HPLEGRGRGQ
RQDVAAVRNP R*CDQPRADQ DGRVEPRPDL RQAVLAASLA HPRRNLFGGL GRAGQPPVSP RLCRPLGRRH DLILRWPALP RGWPGREHRA RQPEVR*RAG
TAVLYPYLRP VRAVQHPRGE CRRPRFHLCA RRPAVPRVRP ADRGALHRHG RLHRSRLCPD APARLPLRAA HPRPRRNQAV RAAGRASLPD VAPADRRHPE
HQARACPLGR HPAPGQLDQA GHRHRLADAA QVRQLPAPER TGRGPARAGP DRAHAVHPGL AAKC*TAPPR ACRPEQR*GA QLAGQGGVLQ PPWGNQGSEL
RAAALPGQRP QPGDGGYRAV EHGVPGTRHP GVGRGRQAGG RRAAAIPVAA GLGAHQPNRR LRLAAEPQTG RREVSALTDA RKTL

 References     

1.Schmitt R, Bernhard E, Mattes R. Characterisation of Tn1721, a new transposon containing tetracycline resistance genes capable of amplification. Mol Gen Genet. 1979 Apr 17;172(1):53-65. doi: 10.1007/BF00276215. PubMed ID: 377024
2.Allmeier H, Cresnar B, Greck M, Schmitt R. Complete nucleotide sequence of Tn1721: gene organization and a novel gene product with features of a chemotaxis protein. Gene. 1992 Feb 1;111(1):11-20. PubMed ID: 1312499
3.Diver WP, Grinsted J, Fritzinger DC, Brown NL, Altenbuchner J, Rogowsky P, Schmitt R. DNA sequences of and complementation by the tnpR genes of Tn21, Tn501 and Tn1721. Mol Gen Genet. 1983;191(2):189-93. PubMed ID: 6312271
4.Zgur-Bertok D, Ambrozic J, Grabnar M. Tn5431 arose by transposition of Tn3 into Tn1721. Can J Microbiol. 1996 Dec;42(12):1274-6. doi: 10.1139/m96-166. PubMed ID: 8989866
5.Grinsted J, de la Cruz F, Altenbuchner J, Schmitt R. Complementation of transposition of tnpA mutants of Tn3, Tn21, Tn501, and Tn1721. Plasmid. 1982 Nov;8(3):276-86. doi: 10.1016/0147-619x(82)90065-8. PubMed ID: 6294711
6.Rogowsky P, Halford SE, Schmitt R. Definition of three resolvase binding sites at the res loci of Tn21 and Tn1721. EMBO J. 1985 Aug;4(8):2135-41. PubMed ID: 2998784
7.Pasquali F, Kehrenberg C, Manfreda G, Schwarz S. Physical linkage of Tn3 and part of Tn1721 in a tetracycline and ampicillin resistance plasmid from Salmonella Typhimurium. J Antimicrob Chemother. 2005 Apr;55(4):562-5. doi: 10.1093/jac/dkh553. Epub 2005 Feb 24. PubMed ID: 15731203
8.Frech G, Schwarz S. Plasmid-encoded tetracycline resistance in Salmonella enterica subsp. enterica serovars choleraesuis and typhimurium: identification of complete and truncated Tn1721 elements. FEMS Microbiol Lett. 1999 Jul 1;176(1):97-103. doi: 10.1111/j.1574-6968.1999.tb13648.x. PubMed ID: 10418136
9.Rogowsky P, Schmitt R. Tn1721-encoded resolvase: structure of the tnpR gene and its in vitro functions. Mol Gen Genet. 1985;200(1):176-81. doi: 10.1007/BF00383332. PubMed ID: 2993811