Transposon
Name: Tn1546
Family: Tn3        Group: Tn4430
Evidence of Transposition: yes
 Host     

Host Organism:Enterococcus faecium BM4147 Molecular Source:plasmid pIP816
Place of Origin:France Date of Isolation:1988
Other Geographic Information:feces of patients with acute leukemia

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTACCGTCAGGAAAATGCGGATTTACAACGTTAAG
IRR (Length: 38 bp)GGGGTAGCGTCAGGAAAATGCGGATTTACAACGCTAAG

 Sequence     
DNA SequenceLength  10851 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTACCGT CAGGAAAATG CGGATTTACA ACGTTAAGGA AATTTATTAA AGAGACCAAT TCCTCAGCAC TAAAATTGAT AATTGGGCTT TCTTTGTTAC 100
TATAGTGTTA GGTAAGCTTT TTACTTTATC ACCGGTTTTC CCCTCACTTC ACACCTACGG GCGAGTTTCC CCACATCCCG TTTTCCATCT AATCCAATTC 200
ATTCAATATC TTTATGTGTA TGAAAGATCA GATTGCTTGA TTTAGACATC TTACACGTAA TTTATTCTTA AATGGGTACG GTAAACGAGC AATAATACGA 300
GCAAAAGTAT ACCTACAAAA ATAATAACTC TGTCTAATTT TTTTTGATTC ATATGCTTAT TGCTTAAACC ATATAATTTC AGTCCAAGAA AGCCTCCAAC 400
AGTATTTGTA ATTACATCTG TTATGTCTGT CGCTCCAATA GCGAAGATAA ATTGAATTAT TTCAAAAGTA AGACTTAAAA CCAGTACAAA AGCAAACTTA 500
GGTAAAAATC CGATTTCTTT AAAATTGACA TTCAAAAGCA AGCCAAATGG AATAAAGATT ATAACATTAT CTATCATCTC TCTGAAATTC CCAGTAGCAG 600
TAAATGGAGT CAAGTTAAGA CTTCTTTGAT GATAATTAAA TACTGATAAA ATATTGTATT GTAATTTGAA TAACACTAAC CAGATTAGTG TCACTAAATA 700
TAAAGCTAGC AATCCTCTAG ATAATATTTT TCCCAATATA ATTTCCTCTA ATTCTTTTGT TTAAGTTGTA TCATTAGTAT AGCAATGTCC TAGTTAACGT 800
GGGTTTTAAA TTAAAAAGCT AACGTTACCC CAAAAGTGCT AGTACAATAA TGCTGTTCAT TAATTTCGTT GGTTTCATTC CGCCATCCTT ACCTCCTTGA 900
ATTAGTATGT GTTGATCCGG GAAACACTGT CACAATTACA CCGTCTATAT TGTTTCCTGA TATCTCATAA CGAAGATTAG TCGGCACATG AATGGTGGTA 1000
TTTTTAGTAA CAGGATAATA AAAGATCTCA TATTTTTCCC CATTTACACT AACAGAAATG GTTTTTTCTT CTTTTAGGTA ATCCATATAT TCCTCGAGAA 1100
CGAAATTCTT TTCTTTCATA ATCGCACTAT GTGGTAAACC AACATAGCGA ATATGCCATG GTTCATATTG AATTCCTGTT AACTCTGTTT TGTCCTCTGG 1200
ATAACGTAAA ATGAACCCGT ATTTCCAAGC ATTTTCTTCT ATCCACTTTC CTTCAGGGGC TCGTTCCATT TTCGTCAAGC TTGATCCTAC ATCTAGTGAT 1300
AAACCTGAAT TATGCTCACT ATAACCTGCT GGTAAGGCAT ACTCAGCCCC CATTTCTTGG TAAAGCACAC TTTGCTCATC AAAGTCTCGA TAGCCACTAT 1400
TAATAATAAA ATGACTAACG CCACCCTTTA CAGCATCATT GACCATCTCT GAAAATTTTT GTGCTATTTC TTTTGACATA TAAATATTAC TATCAAGCAA 1500
CCCGTATCCA TTTATTAATT CGTCATGTTT AGATAAATTC ACGATATCTG ACTTCACACT TTCTTGGCGA ACAGGATATT TACTATTGAT TAATAGCAGA 1600
TTTCCTTGAT AAACCTGTTC TTCTGTAATT GTTTTCTCTT GGGTATTTTC AGAAGTCCCA CTATTTTCTA AATGTTCTTT GGGATTTTGA TCATAATTTT 1700
GAAATTCGAC TTTTTCCTGA GAAAACAGTG CTTCATTAAC GTAGTCATAA CCTAAGTATA TTAAGAATAA CAATAACAAT AAAAAAAACA ACTTCTTCAT 1800
TTTCAGTCTC CTCCTTAACT ATATAGTTGG AAGTATGAAA TATTTCTAGA ATCTTCCCCT TAAACGGCAC AATCTCGTTT GAGATTGTGC CGTTTTGCCC 1900
CGTAAATTAC AGTCAATTAT TTCGCCCTAC TGGATTTACT ATTATCACCA ATGTAGATGA ATTTTCATAA GTGATACCCA TGCTGAATTT AACGAGGCTG 2000
AACTGCCTGT TGACAATGGG CGGTGTGAAA TACCACCCCT CTATGCGATC AGTCTTATTA TCAGGCTATC TTGCCGCAGC GCACGCAGAT AATGACCGCA 2100
ATATCGCTCT GCCTTACATC TTCAATACTA TCTACTATAT ATAAATTCCC TAAGAACCAG TTACATACGT CGGGTTTCCT GCCGAAAGAG TTAGCTTATA 2200
TAGTTTGTCC GTGCAACGGT TAAAAGTTTA TTTAACGGGG AAATCAAAAT AGCTATTGGG GTATGGTTCG TCTCTTAATA CATAGTGCCA CCATTCGAGG 2300
CTATATGCTT CAAACCCACT GTTTTCCATG ATGGAGCGCA AACGTCTGCG ATTTTGCGCT TCATTGCATG ATATTCCATT TGCCGCATGA TGAGAGCGTT 2400
CATCCATAAA ATCAAATCGG CTCCCCATTG GTACAAGCTC ACCCGTGTCT AATCGATAAA GCGTAAGATC AATGGCACTG CCGCGGCTAT GGCTTGATTT 2500
TGAAGCCACG TATCCTTTTG AAATCATCTC AGTTCGGTCA ATATTGGGAT AATAACTTTC CTTTGTCAGG TTATTTTCCG GCTGTGCAGC CCATTGCATA 2600
AAACAGTTTA CAGCACGCTT AGGACGGTAA CCGTCCCATA GAAGCAATCC GTACCCTTGG GTAGCAGCCA GTTCTTTTGC CTTCAAAAGC GATTCAGCCA 2700
ACTCGTATGT CCCTACAATG CGATTTACTT CATAACCGTC AACCGGTTTT CCGGTGAAAT TATCCCAAGT GGCATATTTA GCGTCCCAAC GAACACCGTG 2800
TACTATTTCA TCTAAAAAAG TAAATCCTAT TTCCATGCTT ATCACCCCTT TAACGCTAAT ACGATCAAGC GGTCAATCAG TTCGGGAAGT GCAATACCTG 2900
CAGCGGCCAT CATACGGGGA TAACGACTGT ATGACGTGAA ACCGGGCAGA GTATTGACTT CGTTCAGTAC AATGCGGCCG TTATCTTGTA AAAACATATC 3000
CACACGGGCT AGACCTCTAC AGCCGAGCGC TTTATATATT TTTTTTGCCG TTTCCTGTAT CCGTCCTCGC TCCTCTGCTG AAAGGTCTGC GGGAACGGTT 3100
ATAACTGCGT TTTCAGAGCC TTTTTCCGGC TCGACTTCCT GATGAATACG AAAGATTCCG TACTGCAGCC TGATTTGGTC CACCTCGCCA ACAACTAACG 3200
CGGCACTGTT TCCCAATACC GCACAACCGA CCTCACAGCC CGAAACAGCC TGCTCAATTA AGATTTTGCT GTCATATTGT CTTGCCGATT CAATTGCGTA 3300
GTCCAATTCG TCCGCGCTAT TGACTTTTTT CACACCGAAG GATGAGCCTG AACGCGCCGG CTTAACAAAA ACAGGATAGG TAAACGTAGC TGCCACCGGC 3400
CTATCATCTT TATTAATAAC CCAAAAGGCG GGAGTAGCTA TCCCAGCATT TTTCGCAACG ATGTATGTCA ACGATTTGTC CATACAAATT GCTGAGCTTT 3500
GAATATCGCA GCCTACAAAA GGGATACCGG ACAATTCAAA CAGACCTTGT ATGGATCCAT CTTCACCTGA CTTGCCATGC AAAGCTGAAA ATGCTACATC 3600
AACATGGTTG ATTTCATATT CATGGTTCTT TTTAACAAGT AATCCGTGCA TTTTTTTATC CGGCGAGAGT ACAGCTGAAT AGCAATTGTC GTTTTCCCAT 3700
TCCGCGCAAG GTTTTTCGCA CATTTTCCAT ACACCAGATT TCGTAATTCC AATGTATAAC GGCTCGTATT TTTCTTTATT AATGTTAGCG GCTATCTCTA 3800
TTGCAGATTT TACCGATACG TCATGCTCCT CTGAGCAACC CCCAAACAGT ATTGCAACTT TTATTCTATT CATGCTCCTG TCTCCTTTCA AAATCCAAAC 3900
AGTTTTTAAT GGTTTTTTCA ACGGTATCAC GCAACGCTTG CTCGGTATAA TAGGCCGTAT GCGGTGTGAT TATCACGTTA GGCATTCTTT GAAGTTTAAG 4000
TAAAAATTGA TTATCAATTG GTTTTTGGGT GCAATCAGAG TAGAAAAACT CTTCCTCTCC TTCCAATACA TCCAATGCGG CACCGCCCAG TTTCCCGTTT 4100
TCTAATGCTT TAACCAACTC ATAGGTATCT ACAAGTGGAC CGCGCCCAGT ATTGATAAGA AATGCTCCTT GCTTCATTCT CTGTATTTGT TCGTGGCTGA 4200
TAATATAGTG CGTATCCGTA TTGAGCGGCA CATGAAGCGT AACGATATCG CTATTTTGCA GCAACTCATC AAACGGTACA TAGTTTACCT CTATACTTCG 4300
GCTGCGACTA TAAGCCAACA CTTTACATCC AAATCCTCGC AGCCGCTCAA TAACCGCTTT GCCTATCTGG CCCGTTCCCA CCACACCAAC TGTCATGTCG 4400
CTGAGTACCT TGCCACGGTC GCTGTCCAAC CTGAAATCAT GTTTTTCCAC AGAGCGCACA ATCGATTTTA CGTTGCGTAC TGCCATAAGA ATTAGCATCA 4500
TAGTATAATC GGCAACGCTA TCCGGCGAGT ACGCCACATT GTCGACAGTG ATGCCCATTC TCTTAGCAGC AGTTGTATCT ATATGATTGC AGCCGATGCT 4600
TCGGGTAGAA ATATATTTCA CACCGGCTCT CTTCAGCGCA AGAAGAATAG AGGCGGAAAT CTCTGATTTA TGTCCCACAC TGATACATTG ATTGAAAGGC 4700
GCGGATTTGG CGTTGGATTC CGACACGTTG GCGTTAATTA TCGTTGCCAT AACGCCAAAG CGAGGCGAAA GAGCATGGAA TGCATCTGCC TCATCCTGCT 4800
CACATCCATA AACAGTAATG CCGATGTTAT TCATAATTAA GACCAACCCT TTCTGTGAAA GGCACCAAAT AAAACGGGGA TGCCAATGGT AATCTTGTCA 4900
AATCTTTCTC TGAAGAACGA AAACGGCTCG TTCTTACGGT ATTAAGTCTA CCGTGTAAGA ACGAGCCGTT TCTTAATATT AAATTGTTAA TTTCCTAAGA 5000
AAAAGTAAAG ATAACCTTGA GATTTTCCTA AAAAATTATA TACATCTCTT AGGACCTCCT TTTATCAACC AAGTCTGGCA TCGCTGGAAG CTCTACCCTA 5100
AACGTCGTAT AGTTATCATT GCTTTCCGCG TAAATCTGCC CTCCATGCTG AACAATAATT TCTTTTGCAA TCGCCAATCC AAGTCCCGCG CCACCCGTAT 5200
CGGAAGAACG AGCATTGTCC AGCCTATAGA ACTTTTCAAA TATGGCAGCT AGCTTATCTT TTGGGATGCT TCCAGTGTTC TTGAATTCGA TTGACACCAC 5300
ATCCCCGGAG AGGCCCGCGG TAATGTCAAT GATGCTGTTA TCCTCACTGT ATGCAGCGGC GTTTTTCAAA ATGTTGTTAA AGACTCTCGC GAGTTTATCA 5400
GGGTCGCCGG ACACGGTCAG ATCCTCGGGG GCGTGAATAA CCGCCTGTTT TCCATGTGCG GAAAGCTGAG GATAAAATTC ATCGGTCATC TGCACCAGCA 5500
TATAGTATAG GTCTATGTGC GTTTTTGTTA GCGTTATCGT TTGTAGGTTA TACCGTGTAA TCTCAAAAAA CTCGTCGATT AGCTGTTCGA GTCGATACGC 5600
TTTGTCCAAC GTGATATGCA CATACTTTGC CTTTTGATCT ACCGGCATGT CTGGAGCCTC GTCAAGCAGG CTCAAATAAC CGATAATGGA TGTAAGGGGC 5700
GTTTTAATAT CGTGCGCCAA GTACATAACA ACGTCATTTT TTCTTTGTTC GGCCAGCTTT GCATCCTGCT CTCGCTTTTC CAGAGTCCGT TTTAATGTGT 5800
TGAGCTTTTG TTCCATAACA TCCATTTCCG CAGAAAGCTC AATTTGTTTA TCTTCGTTCT GAATAAGTAC ATCAATGCCG GTATTTATCT CGTCAAAGTA 5900
TTTTGCGAAT TTTGAAAGCA TGACGCGACA TAGAATAAGA ATACTAATGA CAATCGCCAC ATAAATAAAG ATATCTATAT TGTTCCGTAT GGAATATTGA 6000
TATAATTTCA TCGCGTCCAG GTGATTTAAG TCATATTTGT TTTCCAAAAT ACTTAAGATC CAATCCCCAA GTTTCCCTCG GATCATTGAA CGAATATACA 6100
ACACGAATAC AATTGCTACC ACAACAATTG CAACGATATA CATGTAAAGT TTTCGTTCTA GTTTGGAATA GTCGTTTTTT TTATTTTTCA ATTTTATAAC 6200
CAACCCCCCA TACCGTTTTT ATATATTTCG GATTATCAAT GGTGTCGTTC ATTTTTTCGC GCAAATGCCG GATATGCACG GTGATGGTGT TGTTGCTCTT 6300
GCTGAAATAT TCGTCGCCCC ATATCTCATG AAATAGCAGC TCGGAGCTAA CCACATTCCC CTTGTTTTCA CAGAGGATTC GCAGTATTGA AAACTCGGTG 6400
GGAGTAAGGG ATAACTGCTT CTCGTTCAGA TAACACTCAT GGGTGTTAAC ATTAATGACA AGGCCGGAGT GGACGATAAC ATTTTCGTTC TGCTCCTTTA 6500
CTCCACTGAA TTTTTTGTAT CGGCGCAACT GGGCCTTTAC CCGAGCAATT AACTCCAGTG GGCGAAAGGG CTTCGTTATA TAATCATCCG CGCCGATTGT 6600
TAACCCTGTA ATTTTATCTA CCTCTGTATC TTTCCCGGTC AGCATGATAA TCGGATAGGT GTGCTTGTCC CTTATTTTTT GACAGATAGT AAGGCCGCTT 6700
GTGCCGGGAA GCATGATGTC CAATATGGCA AGGTCAATCT CAGACTTGTC TATACATTCC AATGCTTCTT TGGCGGTATA GTATTTGAAA ACCGTATAAT 6800
TCTCGTTTTT TAAGTATAAT TCAACCAAAT CGGCAATTTC ATGTTCATCA TCCACAATAA GTATTTTATC GCTCATAGTT ATCACCCTTT CACATAAGTT 6900
TGCCCTTAAT AATTTATCAG ATTATAGGGC CGAATTTATA AGCATTTACA TAATAAATGA CTAAGAATTT CTTAAGATGA TGATTCTTTT TTTATCAAAG 7000
GGCTTTTCGG CATCGCTAGG AGGCTGTTAA TATTTTATAG TTTCCTTTTC TTCTTTAAAA ATATTGCCCA TTAGCGGAAT ACAGAATGGC TAATTATTCA 7100
CTTCTGATAA TTTCCTGTAT AATGAAGCCC TAGATACATT AGTAATTTCA CAAATTTGAT TTACAGTCAT ATTTCCTTCT TTATATAGCT TTACCGCATA 7200
ATTCATTCCT GCGTGATTTT TATGATACTT CTTTAATCGA CCTTTAAACT TTCCTTCTTT CTTAGCCAAT TCAATCCCTT CACGTTGTCT CATCCGAATA 7300
AGATCTCGCT CTAATTGGTT AACACCAGCC ATTACAGTAA TTAAGAATTG GCTGTATGGA TTATCTTCTG ATAAATCAAG CCATGTATCT TTTAGTGATT 7400
TTAAACTTGC CTTTTTATCT CGTATGTTAT CGATTAATTC AAATAGATCT TGTGTACTAC GAGTGATTCG AGTTAAGTCT GTAACATAAA TGATGTCATC 7500
TTCCTGTAAA TCGTCTAACA CTTTTTGAAG TTGCTCGCGA TCCTTTGTTG CTCCTGAAAC TTTCTCTTCA TATATAATAT CCATTCCGAT CTCGTTCAAC 7600
TGCTGAAATT GTCTTGAAGG ATTCTGGTTA GTCGAACTGA CACGAATATA ACCGATTTTC CGCAAAATAT CACCTCATTT TTGAGACAAG TCTTATGAGA 7700
CGCTCTTAAC TATGATTTTA TCAGTCTACT ACATTTGTAT CAATAGAGTA CACTCTATTG ATATATAATT GAACTAATAA ATTGAAAATA CAGAAATGGA 7800
ATGATACTGA ATGAAAATTG CGAGAGGTAG AGAATTGCTT ACACCGGAAC AGAGACAGGC TTTTATGCAA ATCCCTGAAG ATGAATGGAT ACTGGGGACC 7900
TACTTCACTT TTTCCAAACG GGATTTAGAA ATAGTTAATA AGCGAAGGAG GGAAGAAAAC CGTTTAGGAT TTGCTGTTCA ATTAGCTGTT CTTCGGTATC 8000
CCGGTTGGCC ATACACTCAT ATCAAAAGCA TCCCAGATTC GGTCATACAA TATATATCGA AACAGATTGG TGTTAGTCCA TCCTCGCTTG ATCATTATCC 8100
TCAAAGGGAA AATACACTTT GGGATCATTT GAAAGAAATT CGAAGTGAAT ACGACTTTGT AACTTTTACC CTGAGTGAAT ATCGAATGAC ATTTAAGTAC 8200
CTTCATCAAT TAGCTTTGGA AAATGGTGAT GCCATTCATC TACTGCATGA ATGCATAGAT TTTCTAAGAA AAAACAAAAT TATACTGCCT GCTATCACTA 8300
CACTTGAAAG AATGGTGTGG GAAGCAAGGG CAATGGCTGA AAAGAAGCTA TTTAATACGG TTAGTAAATC TCTAACAAAT GAGCAAAAAG AAAAGCTTGA 8400
AGGGATTATT ACCTCGCAGC ATCCATCCGA ATCCAATAAA ACGATATTGG GTTGGTTAAA AGAGCCACCG GGTCATCCTT CACCCGAAAC TTTTCTAAAA 8500
ATAATAGAAC GACTCGAATA CATACGAGGA ATGGATTTAG AAACAGTGCA AATTAGTCAT TTGCACCGTA ACCGCCTGTT GCAGCTGTCT CGCTTAGGCT 8600
CAAGATACGA GCCGTATGCA TTCCGTGACT TTCAAGAAAA TAAACGTTAT TCGATATTAA CCATCTATTT ATTACAACTT ACTCAGGAGC TAACGGATAA 8700
AGCGTTTGAA ATTCATGATA GGCAAATACT TAGTTTGTTA TCAAAAGGTC GTAAGGCTCA AGAGGAAATC CAGAAACAAA ACGGTAAAAA GCTAAATGAG 8800
AAAGTTATAC ACTTTACGAA CATCGGACAA GCATTAATTA AAGCAAGAGA GGAAAAATTA GACGTTTTTA AGGTTTTAGA ATCGGTTATT GAATGGAATA 8900
CCTTTGTCTC TTCAGTAGAA GAGGCTCAGG AACTTGCACG TCCTGCCGAC TATGATTATT TAGACTTACT GCAAAAACGG TTTTATTCAC TAAGAAAATA 9000
TACGCCAACG CTATTAAGAG TATTGGAATT TCATTCTACA AAGGCAAATG AGCCACTTTT ACAAGCTGTT GAGATTATCC GAGGAATGAA CGAATCTGGA 9100
AAGCGAAAAG TGCCTGATGA CTCACCTGTG GATTTTATTT CAAAACGATG GAAAAGACAT TTATACGAGG ATGATGGTAC AACAATTAAT CGTCATTACT 9200
ATGAAATGGC TGTTTTAACA GAACTTCGGG AGCATGTTCG GGCAGGAGAT GTTTCCATTG TTGGCAGCAG ACAATATAGG GATTTTGAGG AATATTTGTT 9300
TTCGGAAGAT ACATGGAATC AATCGAAGGG GAATACGAGA TTATCAGTTA GTTTATCATT CGAAGATTAT ATAACGGAGA GAACCAGCAG CTTTAATGAA 9400
AGGTTAAAGT GGTTAGCTGC CAATTCCAAT AAGTTAGATG GGGTTTCTCT TGAAAAAGGA AAGCTATCAC TTGCACGCTT AGAAAAAGAT GTTCCAGAAG 9500
AAGCAAAAAA ATTTAGTGCA AGCCTTTATC AGATGCTACC AAGAATAAAA TTAACTGATT TACTCATGGA TGTGGCCCAT ATAACAGGAT TTCATGAGCA 9600
ATTCACTCAT GCTTCCAATA ATCGAAAACC AGATAAGGAA GAAACAATCA TTATCATGGC TGCCCTTTTA GGAATGGGAA TGAATATTGG CTTGAGCAAG 9700
ATGGCCGAAG CCACACCCGG ACTTACATAT AAGCAACTAG CCAATGTATC TCAATGGCGC ATGTATGAAG ATGCCATGAA TAAAGCCCAA GCCATATTAG 9800
TAAACTTTCA TCATAAATTA CAATTGCCTT TCTATTGGGG CGACGGTACA ACATCTTCGT CAGATGGTAT GAGAATGCAG CTAGGTGTTT CATCACTACA 9900
TGCAGATGCA AATCCACATT ATGGAACTGG AAAAGGAGCC ACCATCTACC GATTTACAAG TGATCAATTC TCTTCTTACT ACACAAAGAT TATTCATACT 10000
AATTCAAGAG ATGCGATTCA TGTTTTGGAT GGTTTGTTAC ATCATGAGAC GGATCTAAAC ATAGAGGAAC ATTATACAGA CACTGCCGGT TACACTGACC 10100
AAATATTCGG ACTGACTCAT TTATTAGGAT TTAAATTTGC CCCAAGAATA AGGGATTTAT CGGACTCAAA ATTATTTACG ATAGATAAAG CAAGTGAGTA 10200
TCCAAAACTA GAAGCCATTT TACGTGGACA AATAAATACA AAGGTCATTA AAGAAAATTA TGAGGATGTT TTGCGATTAG CTCATTCTAT AAGGGAGGGA 10300
ACAGTTTCAG CATCCCTTAT TATGGGGAAG CTAGGTTCCT ATTCAAGACA AAACAGCTTA GCTACAGCCT TACGTGAGAT GGGCCGAATA GAAAAAACGA 10400
TCTTTATTTT GAATTATATA TCGGATGAAT CATTAAGAAG AAAAATACAA AGAGGATTGA ATAAAGGAGA AGCCATGAAT GGATTGGCAA GAGCTATTTT 10500
CTTCGGAAAA CAAGGTGAGC TTAGAGAACG CACCATACAG CATCAATTGC AAAGAGCCAG TGCTTTAAAC ATAATTATCA ATGCTATAAG TATTTGGAAT 10600
ACTCTCCACC TAACAACAGC AGTTGAATAT AAAAAACGGA CAGGTAGCTT TAATGAAGAT TTGTTACACC ATATGTCGCC CTTAGGTTGG GAACATATTA 10700
ATTTACTAGG AGAATACCAT TTTAACTCAG AGAAAGTAGT CTCATTAAAT TCTTTAAGAC CACTAAAACT TTCTTAACGT TGTTAAAAAC GAGGGATTCG 10800
TCAGGAAAAT AGGCTTAGCG TTGTAAATCC GCATTTTCCT GACGCTACCC C

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
vanZA (ARO:3002962) Tn1546 251-736 Passenger Gene Antibiotic Resistance -
vanYA (ARO:3002955) Tn1546 889-1800 Passenger Gene Antibiotic Resistance -
vanXA (ARO:3002949) Tn1546 2228-2836 Passenger Gene Antibiotic Resistance -
vanA (ARO:3000010) Tn1546 2842-3873 Passenger Gene Antibiotic Resistance -
vanHA (ARO:3002942) Tn1546 3866-4834 Passenger Gene Antibiotic Resistance -
vanSA (ARO:3002931) Tn1546 5049-6143 Passenger Gene Antibiotic Resistance -
vanRA (ARO:3002919) Tn1546 6181-6876 Passenger Gene Antibiotic Resistance -
tnpR Tn1546 7090-7668 Accessory Gene Resolvase -
tnpA Tn1546 7811-10777 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
vanZA (ARO:3002962) VanZA Tn1546 486 251-736 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target alteration (ARO:0001001)
Target:   glycopeptide antibiotic (ARO:3000081)||vancomycin (ARO:0000028)
Sequence Family:  vanZ (ARO:3000116)||glycopeptide resistance gene cluster (ARO:3000234)
Comment:   perfect match to reference sequence for ARO:3002962||Synonym: vanZ
Protein Sequence:  
MGKILSRGLL ALYLVTLIWL VLFKLQYNIL SVFNYHQRSL NLTPFTATGN FREMIDNVII FIPFGLLLNV NFKEIGFLPK FAFVLVLSLT FEIIQFIFAI
GATDITDVIT NTVGGFLGLK LYGLSNKHMN QKKLDRVIIF VGILLLVLLL VYRTHLRINY V

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
vanYA (ARO:3002955) VanYA Tn1546 912 889-1800 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target alteration (ARO:0001001)
Transpoase Chemistry:   D-Ala-D-Ala carboxypeptidase
Target:   glycopeptide antibiotic (ARO:3000081)||vancomycin (ARO:0000028)
Sequence Family:  vanY (ARO:3000077)||glycopeptide resistance gene cluster (ARO:3000234)
Comment:   perfect match to reference sequence for ARO:3002955||D-Ala-D-Ala carboxypeptidase||Synonym: vanY
Protein Sequence:  
MKKLFFLLLL LFLIYLGYDY VNEALFSQEK VEFQNYDQNP KEHLENSGTS ENTQEKTITE EQVYQGNLLL INSKYPVRQE SVKSDIVNLS KHDELINGYG
LLDSNIYMSK EIAQKFSEMV NDAVKGGVSH FIINSGYRDF DEQSVLYQEM GAEYALPAGY SEHNSGLSLD VGSSLTKMER APEGKWIEEN AWKYGFILRY
PEDKTELTGI QYEPWHIRYV GLPHSAIMKE KNFVLEEYMD YLKEEKTISV SVNGEKYEIF YYPVTKNTTI HVPTNLRYEI SGNNIDGVIV TVFPGSTHTN
SRR

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
vanXA (ARO:3002949) VanXA Tn1546 609 2228-2836 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target alteration (ARO:0001001)
Transpoase Chemistry:   D-Ala-D-Ala dipeptidase
Target:   glycopeptide antibiotic (ARO:3000081)||vancomycin (ARO:0000028)
Sequence Family:  vanX (ARO:3000011)||glycopeptide resistance gene cluster (ARO:3000234)
Comment:   perfect match to reference sequence for ARO:3002949||Synonym: vanX
Protein Sequence:  
MEIGFTFLDE IVHGVRWDAK YATWDNFTGK PVDGYEVNRI VGTYELAESL LKAKELAATQ GYGLLLWDGY RPKRAVNCFM QWAAQPENNL TKESYYPNID
RTEMISKGYV ASKSSHSRGS AIDLTLYRLD TGELVPMGSR FDFMDERSHH AANGISCNEA QNRRRLRSIM ENSGFEAYSL EWWHYVLRDE PYPNSYFDFP
VK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
vanA (ARO:3000010) VanA Tn1546 1032 2842-3873 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target alteration (ARO:0001001)
Transpoase Chemistry:   D-alanine--(R)-lactate ligase
Target:   glycopeptide antibiotic (ARO:3000081)||vancomycin (ARO:0000028)
Sequence Family:  glycopeptide resistance gene cluster (ARO:3000234)||van ligase (ARO:3002906)
Comment:   perfect match to reference sequence for ARO:3000010
Protein Sequence:  
MNRIKVAILF GGCSEEHDVS VKSAIEIAAN INKEKYEPLY IGITKSGVWK MCEKPCAEWE NDNCYSAVLS PDKKMHGLLV KKNHEYEINH VDVAFSALHG
KSGEDGSIQG LFELSGIPFV GCDIQSSAIC MDKSLTYIVA KNAGIATPAF WVINKDDRPV AATFTYPVFV KPARSGSSFG VKKVNSADEL DYAIESARQY
DSKILIEQAV SGCEVGCAVL GNSAALVVGE VDQIRLQYGI FRIHQEVEPE KGSENAVITV PADLSAEERG RIQETAKKIY KALGCRGLAR VDMFLQDNGR
IVLNEVNTLP GFTSYSRYPR MMAAAGIALP ELIDRLIVLA LKG

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
vanHA (ARO:3002942) VanHA Tn1546 969 3866-4834 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target alteration (ARO:0001001)
Transpoase Chemistry:   D-lactate dehydrogenase VanH-A
Target:   glycopeptide antibiotic (ARO:3000081)||vancomycin (ARO:0000028)
Sequence Family:  glycopeptide resistance gene cluster (ARO:3000234)||vanH (ARO:3000006)
Comment:   perfect match to reference sequence for ARO:3002942||Synonym: vanH
Protein Sequence:  
MNNIGITVYG CEQDEADAFH ALSPRFGVMA TIINANVSES NAKSAPFNQC ISVGHKSEIS ASILLALKRA GVKYISTRSI GCNHIDTTAA KRMGITVDNV
AYSPDSVADY TMMLILMAVR NVKSIVRSVE KHDFRLDSDR GKVLSDMTVG VVGTGQIGKA VIERLRGFGC KVLAYSRSRS IEVNYVPFDE LLQNSDIVTL
HVPLNTDTHY IISHEQIQRM KQGAFLINTG RGPLVDTYEL VKALENGKLG GAALDVLEGE EEFFYSDCTQ KPIDNQFLLK LQRMPNVIIT PHTAYYTEQA
LRDTVEKTIK NCLDFERRQE HE

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
vanSA (ARO:3002931) VanSA Tn1546 1095 5049-6143 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target alteration (ARO:0001001)
Transpoase Chemistry:   VanA-type vancomycin resistance histidine kinase sensor
Target:   glycopeptide antibiotic (ARO:3000081)||vancomycin (ARO:0000028)
Sequence Family:  glycopeptide resistance gene cluster (ARO:3000234)||vanS (ARO:3000071)
Comment:   strict match to reference sequence for ARO:3002931 (bitscore: 743)||Missing first 20 amino acids relative to vanSA (ARO:3002931)||Synonym: vanS
Protein Sequence:  
MYIVAIVVVA IVFVLYIRSM IRGKLGDWIL SILENKYDLN HLDAMKLYQY SIRNNIDIFI YVAIVISILI LCRVMLSKFA KYFDEINTGI DVLIQNEDKQ
IELSAEMDVM EQKLNTLKRT LEKREQDAKL AEQRKNDVVM YLAHDIKTPL TSIIGYLSLL DEAPDMPVDQ KAKYVHITLD KAYRLEQLID EFFEITRYNL
QTITLTKTHI DLYYMLVQMT DEFYPQLSAH GKQAVIHAPE DLTVSGDPDK LARVFNNILK NAAAYSEDNS IIDITAGLSG DVVSIEFKNT GSIPKDKLAA
IFEKFYRLDN ARSSDTGGAG LGLAIAKEII VQHGGQIYAE SNDNYTTFRV ELPAMPDLVD KRRS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
vanRA (ARO:3002919) VanRA Tn1546 696 6181-6876 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic target alteration (ARO:0001001)
Transpoase Chemistry:   VanA-type vancomycin resistance DNA-binding response regulator
Target:   glycopeptide antibiotic (ARO:3000081)||vancomycin (ARO:0000028)
Sequence Family:  glycopeptide resistance gene cluster (ARO:3000234)||vanR (ARO:3000574)
Comment:   perfect match to reference sequence for ARO:3002919||Synonym: vanR
Protein Sequence:  
MSDKILIVDD EHEIADLVEL YLKNENYTVF KYYTAKEALE CIDKSEIDLA ILDIMLPGTS GLTICQKIRD KHTYPIIMLT GKDTEVDKIT GLTIGADDYI
TKPFRPLELI ARVKAQLRRY KKFSGVKEQN ENVIVHSGLV INVNTHECYL NEKQLSLTPT EFSILRILCE NKGNVVSSEL LFHEIWGDEY FSKSNNTITV
HIRHLREKMN DTIDNPKYIK TVWGVGYKIE K

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn1546 579 7090-7668 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MLRKIGYIRV SSTNQNPSRQ FQQLNEIGMD IIYEEKVSGA TKDREQLQKV LDDLQEDDII YVTDLTRITR STQDLFELID NIRDKKASLK SLKDTWLDLS
EDNPYSQFLI TVMAGVNQLE RDLIRMRQRE GIELAKKEGK FKGRLKKYHK NHAGMNYAVK LYKEGNMTVN QICEITNVSR ASLYRKLSEV NN

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn1546 2967 7811-10777 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MKIARGRELL TPEQRQAFMQ IPEDEWILGT YFTFSKRDLE IVNKRRREEN RLGFAVQLAV LRYPGWPYTH IKSIPDSVIQ YISKQIGVSP SSLDHYPQRE
NTLWDHLKEI RSEYDFVTFT LSEYRMTFKY LHQLALENGD AIHLLHECID FLRKNKIILP AITTLERMVW EARAMAEKKL FNTVSKSLTN EQKEKLEGII
TSQHPSESNK TILGWLKEPP GHPSPETFLK IIERLEYIRG MDLETVQISH LHRNRLLQLS RLGSRYEPYA FRDFQENKRY SILTIYLLQL TQELTDKAFE
IHDRQILSLL SKGRKAQEEI QKQNGKKLNE KVIHFTNIGQ ALIKAREEKL DVFKVLESVI EWNTFVSSVE EAQELARPAD YDYLDLLQKR FYSLRKYTPT
LLRVLEFHST KANEPLLQAV EIIRGMNESG KRKVPDDSPV DFISKRWKRH LYEDDGTTIN RHYYEMAVLT ELREHVRAGD VSIVGSRQYR DFEEYLFSED
TWNQSKGNTR LSVSLSFEDY ITERTSSFNE RLKWLAANSN KLDGVSLEKG KLSLARLEKD VPEEAKKFSA SLYQMLPRIK LTDLLMDVAH ITGFHEQFTH
ASNNRKPDKE ETIIIMAALL GMGMNIGLSK MAEATPGLTY KQLANVSQWR MYEDAMNKAQ AILVNFHHKL QLPFYWGDGT TSSSDGMRMQ LGVSSLHADA
NPHYGTGKGA TIYRFTSDQF SSYYTKIIHT NSRDAIHVLD GLLHHETDLN IEEHYTDTAG YTDQIFGLTH LLGFKFAPRI RDLSDSKLFT IDKASEYPKL
EAILRGQINT KVIKENYEDV LRLAHSIREG TVSASLIMGK LGSYSRQNSL ATALREMGRI EKTIFILNYI SDESLRRKIQ RGLNKGEAMN GLARAIFFGK
QGELRERTIQ HQLQRASALN IIINAISIWN TLHLTTAVEY KKRTGSFNED LLHHMSPLGW EHINLLGEYH FNSEKVVSLN SLRPLKLS

 References     

1.Leclercq R, Derlot E, Duval J, Courvalin P. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. N Engl J Med. 1988 Jul 21;319(3):157-61. doi: 10.1056/NEJM198807213190307. PubMed ID: 2968517
2.Leclercq R, Derlot E, Weber M, Duval J, Courvalin P. Transferable vancomycin and teicoplanin resistance in Enterococcus faecium. Antimicrob Agents Chemother. 1989 Jan;33(1):10-5. doi: 10.1128/aac.33.1.10. PubMed ID: 2523687
3.Arthur M, Molinas C, Depardieu F, Courvalin P. Characterization of Tn1546, a Tn3-related transposon conferring glycopeptide resistance by synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. J Bacteriol. 1993 Jan;175(1):117-27. doi: 10.1128/jb.175.1.117-127.1993. PubMed ID: 8380148
4.Arthur M, Depardieu F, Molinas C, Reynolds P, Courvalin P. The vanZ gene of Tn1546 from Enterococcus faecium BM4147 confers resistance to teicoplanin. Gene. 1995 Feb 27;154(1):87-92. PubMed ID: 7867956