Transposon
Name: Tn1331
Family: Tn3        Group: Tn3
Evidence of Transposition: yes
 Host     

Host Organism:Klebsiella pneumoniae strain Kp002 Molecular Source:plasmid pJEG012
Place of Origin:Sydney, Australia Date of Isolation:2012
Other Geographic Information:Sydney Metropolitan Hospital

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG
IRR (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG

 Sequence     
DNA SequenceLength  7996 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCTGAC GCTCAGTGGA ACGAAAACTC ACGTTAAGGG ATTTTGGTCA TGAGATTATC AAAAAGGATC TTCACCTAGA TCCTTTTAAA TTAAAAATGA 100
AGTTTTAAAT CAATCTAAAG TATATATGAG TAAACTTGGT CTGACAGTTA CCAATGCTTA ATCAGTGAGG CACCTATCTC AGCGATCTGT CTATTTCGTT 200
CATCCATAGT TGCCTGACTC CCCGTCGTGT AGATAACTAC GATACGGGAG GGCTTACCAT CTGGCCCCAG TGCTGCAATG ATACCGCGAG ATCCACGCTC 300
ACCGGCTCCA GATTTATCAG CAATAAACCA GCCAGCCGGA AGGGCCGAGC GCAGAAGTGG TCCTGCAACT TTATCCGCCT CCATCCAGTC TATTAATTGT 400
TGCCGGGAAG CTAGAGTAAG TAGTTCGCCA GTTAATAGTT TGCGCAACGT TGTTGCCATT GCTGCAGGCA TCGTGGTGTC ACGCTCGTCG TTTGGTATGG 500
CTTCATTCAG CTCCGGTTCC CAACGATCAA GGCGGGTTAC ATGATCCCCC ATGTTGTGCA AAAAAGCGGT TAGCTCCTTC GGTCCTCCGA TCGTTGTCAG 600
AAGTAAGTTG GCAGCAGTGT TATCACTCAT GGTTATGGCA GCACTGCATA ATTCTCTTAC TGTCATGCCA TCCGTAAGAT GCTTTTCTGT GACTGGTGAG 700
TACTCAACCA AGTCATTCTG AGAATAGTGT ATGCGGCGAC CGAGTTGCTC TTGCCCGGCG TCAACACGGG ATAATACCGC ACCACATAGC AGAACTTTAA 800
AAGTGCTCAT CATTGGAAAA CGTTCTTCGG GGCGAAAACT CTCAAGGATC TTACCGCTGT TGAGATCCAG CTCGATGTAA CCCACTCGTG CACCCAACTG 900
ATCTTCAGCA TCTTTTACTT TCACCAGCGT TTCTGGGTGA GCAAAAACAG GAAGGCAAAA TGCCGCAAAA AAGGGAATAA GGGCGACACG GAAATGTTGA 1000
ATACTCATAC TCTTCCTTTT TCAATATTAT TGAAGCATTT ATCAGGGTTA TTGTCTCATG AGCGGATACA TATTTGAATG TATTTAGAAA AATAAACAAA 1100
TAGGGGTTCC GCGCACATTT CCCCGAAAAG TGCCACCTGA CGTCTAAGAA ACCATTATTA TCATGACATT AACCTATAAA AATAGGCGTA TCACGAGGCC 1200
CTTTCGTCTT CAAGAATTTT ATAAACCGTG GAGCGGGCAA TACTGAGCTG ATGAGCAATT TCCGTTGCAC CAGTGCCCTT CTGATGAAGC GTCAGCACGA 1300
CGTTCCTGTC CACGGTACGC CTGCGGCCAA ATTTGATTCC TTTCAGCTTT GCTTCCTGTC GGCCCTCATT CGTGCGCTCT AGGATCCTCC GGCGTTCAGC 1400
CTGTGCCACA GCCGACAGGA TGGTGACCAC CATTTGCCCC ATATCACCGT CGGTACTGAT CCCGTCGTCA ATAAACCGAA CCGCTACACC CTGAGCATCA 1500
AACTCTTTTC ATGATATATC TCCCAATTTG TGTAGGGCTT ATTATGCACG CTTAAAAATA ATAAAAGCAG ACTTGACCTG ATAGTTTGGC TGTGAGCAAT 1600
TATGTGCTTA GTGCATCTAA CGTTCAAGGT GAGCGGACTC GCGCGGCTTT ATGCGCGAGG TCCGCTCGAG CGCAGGGTTA TGCATCTGCT CTCGATGACG 1700
CCACATATCA TTTGTTACCC ATCAACACGG GTAATTCCAC GAGAATATCC TCTCGTGCTT TAGACCCGCC GGGAATATCG GACTTTTCCT TTCCTATTTC 1800
CAATCGGGCG AAAACAACTT GCCGTCCGTT TTTTTCAGCC CAGCCCACGA ACCAGCCCTG CGGACGACTT TCATTTATCT TGCCGTTATT GTCCCGAAGC 1900
CAGCCGCTGC CGCTTTTTCC ATGTACAGCC CATCCTTCGG CTGCCTGGTA CTGCGGGATT GTGGCATACG CCATGTCATA AGCCGCTTCG GATACAGGCA 2000
GCTTATGCGC GACAAAGCGT AGAAGAAACT GAATTTGCTC CTTGGGAGAT ATGGTGAGCG ACGACATCAG CCATGACTGG GTCAAGCCGT TATGCTTCCC 2100
CGAGTCACCG GAAACATCTT GATTACCGTA CTCAAATTTC TTTACGTATT CCGTGAACCG ATCAACTCCC AGACGGCTTG TTAATTGCTG CGAGAACCAG 2200
ACAACAGAGT CGCTTTGCCA TAGCGCCGGA TAGACTTGTT TGTATGTGCG ATCTCTCGGA GACGGGTTGT ATTCCGGCTT CAATTCCCAC GTAGGTGATT 2300
TTGGCGACTG CAAGATTCCA CTATCAAACC CCATGATTGC CAATGGAAGT TTAAAAGACG AGCACGGAGA CACACGACGG GCACATTCTC CGGTCTCATA 2400
TAAGGTATTT CCGGTAATGG CGTCTGCGAT GATGGTGCAT TTAAGCGTTT CAACCTCATC AGAAGCCACG GAACTGATTG GGAGAGTGGC GGAAACGAAC 2500
ACCAACATAT GCAGCAGCAA AATTTTTTTC ATCAAGGTAT CCTTCATTGC TCCGCTGTGC GCTTAATAGG TGCATAACTT TGTTTTAGAC ATTATTTGCC 2600
GACTACCTTG GTGATCTCGC CTTTCACGTA GTGAACAAAT TCTTCCAACT GATCTGCGCG CGAGGCCAAG CGATCTTCTT GTCCAAGATA AGCCTGCCTA 2700
GCTTCAAGTA TGACGGGCTG ATACTGGGCC GGCAGGCGCT CCATTGCCCA GTCGGCAGCG ACATCCTTCG GCGCGATTTT GCCGGTTACT GCGCTGTACC 2800
AAATGCGGGA CAACGTAAGC ACTACATTTC GCTCATCGCC AGCCCAGTCG GGCGGCGAGT TCCATAGCGT TAAGGTTTCA TTTAGCGCCT CAAATAGATC 2900
CTGTTCAGGA ACCGGATCAA AGAGTTCCTC CGCCGCTGGA CCTACCAAGG CAACGCTATG TTCTCTTGCT TTTGTCAGCA AGATAGCCAG ATCAATGTCG 3000
ATCGTGGCTG GCTCGAAGAT ACCTGCAAGA ATGTCATTGC GCTGCCATTC TCCAAATTGC AGTTCGCGCT TAGCTGGATA ACGCCACGGA ATGATGTCGT 3100
CGTGCACAAC AATGGTGACT TCTACAGCGC GGAGAATCTC GCTCTCTCCA GGGGAAGCCG AAGTTTCCAA AAGGTCGTTG ATCAAAGCTC GCCGCGTTGT 3200
TTCATCAAGC CTTACGGTCA CCGTAACCAG CAAATCAATA TCACTGTGTG GCTTCAGGCC GCCATCCACT GCGGAGCCGT ACAAATGTAC GGCCAGCAAC 3300
GTCGGTTCGA GATGGCGCTC GATGACGCCA ACTACCTCTG ATAGTTGAGT CGATACTTCG GCGATCACCG CTTCCCTCAT GATGTTTAAC GTTTGACATG 3400
AGGGGCGGCC AAGGGCGCCA GCCCTTGGAC GTCCCCCTCG ATGGAAGGGT TAGGCAACAC TGCGTGTTCG CTCGAATGCC TGGCGTGTTT GAACCATGTA 3500
CACGGCTGGA CCATCTGGGG TGGTTACGGT ACCTTGCCTC TCAAACCCCG CTTTCTCGTA GCATCGGATC GCTCGCAAGT TGCTCGGCGA CGGGTCCGTT 3600
TGGATCTTGG TGACCTCGGG ATCATTGAAC AGCAACTCAA CCAGAGCTCG AACCAGCTTG GTTCCCAAGC CTTTGCCCAG TTGTGATGCA TTCGCCAGTG 3700
ACAGGTCTAT TCCGCGTACT CCTGGATCGG TTTCTTCTTC CCACCATCCG TCCCCGCTTC CAAGAGCAAC GTACGACTGG GCATACCCAA TCGGCTCTCC 3800
ATTCAGCATT GCAATGTATG GAGTGACGGA CTCTTGCGCT AAAACGCTTG GCAAGTACTG TTCCTGTACG TCAGCAAGTG TCGGGCGTGC TTCTTCTCCG 3900
CCCCACCACT CGACGATATG AGATCGATTT AGCCACTCAT AGAGCATCGC AAGGTCATGC TCAGTCATGA GGCGCAGTGT GACGGAATCG TTGCTGTTGG 4000
TCACGATGCT GTACTTTGTG ATGCCTAACT TTGTTTGGAA ATGTTGAATA CTCATACTCT TCCTTTTTCA ATATTATTGA AGCATTTATC AGGGTTATTG 4100
TCTCATGAGC GGATACATAT TTGAATGTAT TTAGAAAAAT AAACAAATAG GGGTTCCGCG CACATTTCCC CGAAAAGTGC CACCTGACGT CTAAGAAACC 4200
ATTATTATCA TGACATTAAC CTATAAAAAT AGGCGTATCA CGAGGCCCTT TCGTCTTCAA GAATTTTATA AACCGTGGAG CGGGCAATAC TGAGCTGATG 4300
AGCAATTTCC GTTGCACCAG TGCCCTTCTG ATGAAGCGTC AGCACGACGT TCCTGTCCAC GGTACGCCTG CGGCCAAATT TGATTCCTTT CAGCTTTGCT 4400
TCCTGTCGGC CCTCATTCGT GCGCTCTAGG ATCCTCCGGC GTTCAGCCTG TGCCACAGCC GACAGGATGG TGACCACCAT TTGCCCCATA TCACCGTCGG 4500
TACTGATCCC GTCGTCAATA AACCGAACCG CGACACCCTG AGCATCAAAC TCTTTTATCA GTTGGATCAT GTCGGCGGTG TCGCGGCCAA GACGGTCGAG 4600
CTTCTTCACC AGAATGACAT CACCTTCCTC CACCTTCATC CTCAGCAAAT CCAGCCCTTC CCGATCTGTT GAACTGCCGG ATGCCTTGTC GGTAAAGATG 4700
CGGTTAGCTT TTACCCCTGC ATCTTTGAGC GCTCTGATCT GAATATCGAG GGACTGCTGG CTGGTTGAGA CCCGCGCATA ACCAAAAATT CGCATAAAAT 4800
GTACCTTAAA TCGAATATCA GACACGATGT GTCTATTATG CCAAAATGAC GATTTAATGG ACACTCAAAC GAAGCCGTTT TACTATGTCT GATAATTTAT 4900
AACATTTCGG ACGGTTGCAA AAATGTTACT AAATGCCCGT AAGGCAGGGA GGCCTATATG CCCGTTGACT TTCTGACCAC TGAGCAGACT GAAAGCTATG 5000
GCAGATTCAC CGGTGAACCG GATGAGCTTC AGCTGGCACG ATATTTTCAC CTTGATGAAG CAGACAAGGA ATTTATCGGA AAAAGCAGAG GTGATCACAA 5100
CCGTCTGGGC ATTGCCCTGC AAATTGGATG TGTCCGTTTT CTGGGCACCT TCCTCACCGA TATGAATCAT ATTCCTTCCG GCGTCCGGCA TTTTACCGCC 5200
AGACAGCTCG GGATTCGTGA TATCACCGTT CTTGCAGAAT ACGGTCAGAG GGAAAATACC CGCCGTGAGC ATGCAGCGCT GATACGTCAG CACTATCAGT 5300
ATCGTGAATT TGCCTGGCCC TGGACATTTC GCCTTACCCG TCTTTTATAT ACCCGGAGCT GGATAAGCAA CGAACGTCCT GGCCTGCTTT TCGATCTGGC 5400
GACAGGGTGG CTTATGCAAC ATCGTATTAT TCTCCCCGGA GCCACTACGC TGACTCGGTT GATTTCAGAG GTAAGGGAAA AGGCGACGTT GCGCCTGTGG 5500
AACAAACTGG CACTGATACC GTCAGCCGAA CAGCGTTCAC AGCTGGAGAT GCTGCTGGGG CCAACTGATT GCAGCCGCCT GTCTTTACTG GAATCACTGA 5600
AAAAGGGCCC TGTGACCATC AGTGGTCCGG CGTTTAATGA AGCAATTGAA CGCTGGAAAA CTCTGAACGA TTTTGGCTTG CATGCTGACA ACCTGAGTAC 5700
ACTCCCGGCT GTGCGCCTGA AAAATCTCGC ACGTTATGCT GGTATGACTT CGGTGTTCAA TATTGCCAGG ATGTCACCGC AGAAAAGGAT GGCGGTTCTG 5800
GTTGCCTTTG TCCTTGCATG GGAAACGCTG GCGCTGGATG ATGCACTGGA CGTTCTGGAC GCCATGCTGG CCGTTATCAT CCGTGACGCC AGAAAGATTG 5900
GGCAGAAAAA ACGGCTCCGC TCGCTGAAGG ATCTGGATAA ATCTGCATTG GCGCTCGCCA GCGCATGTTC GTACCTGCTG AAAGAAGAAA CACCGGACGA 6000
ATCGATTCGT GCTGAGGTGT TCAGCTACAT CCCCAGGCAA AAGCTGGCTG AAATCATCAC GCTTGTCCGT GAAATTGCCC GGCCCTCAGA CGATAATTTT 6100
CATGAAGAAA TGGTGGAGCA GTACGGGCGC GTTCGTCGTT TCCTGCCCCA TCTGCTGAAT ACCGTTAAAT TTTCATCCGC ACCTGCCGGG GTTACCACTC 6200
TGAATGCCTG TGACTACCTC AGCCGGGAGT TCAGCTCACG GCGGCAGTTT TTTGACGACG CACCAACGGA AATTATCAGT CGGTCATGGA AACGGCTGGT 6300
GATTAACAAG GAAAAACATA TCACCCGCAG GGGATACACG CTCTGCTTTC TCAGTAAACT GCAGGATAGT CTGAGGCGGA GGGATGTCTA CGTTACCGGC 6400
AGTAACCGGT GGGGAGATCC CCGAGCAAGA TTACTACAGG GTGCTGACTG GCAGGCAAAC CGGATTAAGG TTTATCGTTC TCTGGGACAC CCGACAGACC 6500
CGCAGGAAGC AATAAAATCT CTGGGTCATC AGCTTGATAG TCGTTACAGA CAGGTTGCTG CACGTCTTGG CGAAAATGAG GCTGTCGAAC TCGATGTTTC 6600
TGGCCCGAAG CCCCGGTTGA CAATTTCTCC CCTCGCCAGT CTTGATGAGC CGGACAGTCT GAAACGACTG AGCAAAATGA TCAGTGATCT GCTCCCTCCG 6700
GTGGATTTAA CGGAGTTGCT GCTCGAAATT AACGCCCATA CCGGATTTGC TGATGAGTTT TTCCATGCTA GTGAAGCCAG TGCCAGAGTT GATGATCTGC 6800
CCGTCAGCAT CAGCGCCGTG CTGATGGCTG AAGCCTGCAA TATCGGTCTG GAACCACTGA TCAGATCAAA TGTTCCTGCA CTGACCCGAC ACCGGCTGAA 6900
CTGGACAAAA GCGAACTATC TGCGGGCTGA AACTATCACC AGCGCTAATG CCAGACTGGT TGATTTTCAG GCAACGCTGC CACTGGCACA GATATGGGGT 7000
GGAGGAGAAG TGGCATCTGC AGATGGAATG CGCTTTGTTA CGCCAGTCAG AACAATCAAT GCCGGACCGA ACCGCAAATA CTTTGGTAAT AACAGAGGGA 7100
TCACCTGGTA CAACTTTGTG TCCGATCAGT ATTCCGGCTT TCATGGCATC GTTATACCGG GGACGCTGAG GGACTCTATC TTTGTGCTGG AAGGCCTTCT 7200
GGAACAGGAG ACCGGGCTGA ATCCAACCGA AATTATGACC GATACAGCAG GTGCCAGCGA ACTTGTCTTT GGCCTTTTCT GGCTGCTGGG ATACCAGTTT 7300
TCTCCACGCC TGGCTGATGC CGGTGCTTCG GTTTTCTGGC GAATGGACCA TGATGCCGAC TATGGCGTGC TGAATGATAT TGCCAGAGGG CAATCAGATC 7400
CCCGAAAAAT AGTCCTTCAG TGGGACGAAA TGATCCGGAC CGCTGGCTCC CTGAAGCTGG GCAAAGTACA GGCTTCAGTG CTGGTCCGTT CATTGCTGAA 7500
AAGTGAACGT CCTTCCGGAC TGACTCAGGC AATCATTGAA GTGGGGCGCA TCAACAAAAC GCTGTATCTG CTTAATTATA TTGATGATGA AGATTACCGC 7600
CGGCGCATTC TGACCCAGCT TAATCGGGGA GAAAGCCGCC ATGCCGTTGC CAGAGCCATC TGTCACGGTC AAAAAGGTGA GATAAGAAAA CGATATACCG 7700
ACGGTCAGGA AGATCAACTG GGCGCACTGG GGCTGGTCAC TAACGCCGTC GTGTTATGGA ACACTATTTA TATGCAGGCA GCCCTGGATC ATCTCCGGGC 7800
GCAGGGTGAA ACACTGAATG ATGAAGATAT CGCACGCCTC TCCCCGCTTT GCCACGGACA TATCAATATG CTCGGCCATT ATTCCTTCAC GCTGGCAGAA 7900
CTGGTGACCA AAGGACATCT GAGACCATTA AAAGAGGCGT CAGAGGTAGA AAACGTTGCT TAACGTGAGT TTTCGTTCCA CTGAGCGTCA GACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
attC bla OXA-9 core 1621-1689 69 CGTTCAAGGT GAGCGGACTC GCGCGGCTTT ATGCGCGAGG TCCGCTCGAG CGCAGGGTTA
TGCATCTGC
attC aadA core 2536-2590 55 GGTATCCTTC ATTGCTCCGC TGTGCGCTTA ATAGGTGCAT AACTTTGTTT TAGAC
attC AAC(6')-Ib core 3390-3455 66 CGTTTGACAT GAGGGGCGGC CAAGGGCGCC AGCCCTTGGA CGTCCCCCTC GATGGAAGGG
TTAGGC
res 4797-4917 121 AAATGTACCT TAAATCGAAT ATCAGACACG ATGTGTCTAT TATGCCAAAA TGACGATTTA
ATGGACACTC AAACGAAGCC GTTTTACTAT GTCTGATAAT TTATAACATT TCGGACGGTT
G
res_site_III_a 4800-4822 23 TGTACCTTAA ATCGAATATC AGA
res_site_II_a 4828-4863 36 TGTGTCTATT ATGCCAAAAT GACGATTTAA TGGACA
res_site_I 4886-4914 29 TGTCTGATAA TTTATAACAT TTCGGACGG

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
bla TEM-1 (ARO:3000873) Tn1331 148-1008 Passenger Gene Antibiotic Resistance -
tnpR_p Tn1331 1191-1509 Accessory Gene Resolvase -
bla OXA-9 (ARO:3001404) Tn1331 1708-2547 Passenger Gene Antibiotic Resistance -
aadA (ARO:3002601) Tn1331 2592-3380 Passenger Gene Antibiotic Resistance -
AAC(6')-Ib4 (ARO:3002577) Tn1331 3450-4004 Passenger Gene Antibiotic Resistance -
tnpR Tn1331 4238-4795 Accessory Gene Resolvase -
tnpA Tn1331 4958-7963 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla TEM-1 (ARO:3000873) Bla TEM-1 Tn1331 861 148-1008 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   penam (ARO:3000008)||monobactam (ARO:0000004)||cephalosporin (ARO:0000032)||penem (ARO:3003706)
Sequence Family:  TEM beta-lactamase (ARO:3000014)
Comment:   strict match to reference sequence for ARO:3000873 (bitscore: 591)
Protein Sequence:  
MSIQHFRVAL IPFFAAFCLP VFAHPETLVK VKDAEDQLGA RVGYIELDLN SGKILESFRP EERFPMMSTF KVLLCGAVLS RVDAGQEQLG RRIHYSQNDL
VEYSPVTEKH LTDGMTVREL CSAAITMSDN TAANLLLTTI GGPKELTAFL HNMGDHVTRL DRWEPELNEA IPNDERDTTM PAAMATTLRK LLTGELLTLA
SRQQLIDWME ADKVAGPLLR SALPAGWFIA DKSGAGERGS RGIIAALGPD GKPSRIVVIY TTGSQATMDE RNRQIAEIGA SLIKHW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR_p TnpR_p Tn1331 319 1191-1509 -
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   C-terminal fragment
Protein Sequence:  
KRV*CSGCSG SVY*RRDQYR R*YGANGGHH PVGCGTG*TP EDPRAHE*GP TGSKAERNQI WPQAYRGQER RADASSEGHW CNGNCSSAQY CPLHGL*NS*
RRKGLV

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla OXA-9 (ARO:3001404) Bla OXA-9 Tn1331 840 1708-2547 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   cephalosporin (ARO:0000032)||penam (ARO:3000008)
Sequence Family:  OXA beta-lactamase (ARO:3000017)
Comment:   strict match to reference sequence for ARO:3001404 (bitscore: 569)
Protein Sequence:  
MKDTLMKKIL LLHMLVFVSA TLPISSVASD EVETLKCTII ADAITGNTLY ETGECARRVS PCSSFKLPLA IMGFDSGILQ SPKSPTWELK PEYNPSPRDR
TYKQVYPALW QSDSVVWFSQ QLTSRLGVDR FTEYVKKFEY GNQDVSGDSG KHNGLTQSWL MSSLTISPKE QIQFLLRFVA HKLPVSEAAY DMAYATIPQY
QAAEGWAVHG KSGSGWLRDN NGKINESRPQ GWFVGWAEKN GRQVVFARLE IGKEKSDIPG GSKAREDILV ELPVLMGNK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
aadA (ARO:3002601) AadA Tn1331 789 2592-3380 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  ANT(3'') (ARO:3004275)
Comment:   strict match to reference sequence for ARO:3002601 (bitscore: 520)||Synonym: ANT(9)(3'')
Protein Sequence:  
MREAVIAEVS TQLSEVVGVI ERHLEPTLLA VHLYGSAVDG GLKPHSDIDL LVTVTVRLDE TTRRALINDL LETSASPGES EILRAVEVTI VVHDDIIPWR
YPAKRELQFG EWQRNDILAG IFEPATIDID LAILLTKARE HSVALVGPAA EELFDPVPEQ DLFEALNETL TLWNSPPDWA GDERNVVLTL SRIWYSAVTG
KIAPKDVAAD WAMERLPAQY QPVILEARQA YLGQEDRLAS RADQLEEFVH YVKGEITKVV GK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
AAC(6')-Ib4 (ARO:3002577) AAC(6')-Ib4 Tn1331 555 3450-4004 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   aminoglycoside antibiotic (ARO:0000016)
Sequence Family:  AAC(6') (ARO:3000345)
Comment:   strict match to reference sequence for ARO:3002577 (bitscore: 380)
Protein Sequence:  
MTNSNDSVTL RLMTEHDLAM LYEWLNRSHI VEWWGGEEAR PTLADVQEQY LPSVLAQESV TPYIAMLNGE PIGYAQSYVA LGSGDGWWEE ETDPGVRGID
LSLANASQLG KGLGTKLVRA LVELLFNDPE VTKIQTDPSP SNLRAIRCYE KAGFERQGTV TTPDGPAVYM VQTRQAFERT RSVA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn1331 558 4238-4795 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase; serine site-specific recombinase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Comment:   first defined as a repressor
Protein Sequence:  
MRIFGYARVS TSQQSLDIQI RALKDAGVKA NRIFTDKASG SSTDREGLDL LRMKVEEGDV ILVKKLDRLG RDTADMIQLI KEFDAQGVAV RFIDDGISTD
GDMGQMVVTI LSAVAQAERR RILERTNEGR QEAKLKGIKF GRRRTVDRNV VLTLHQKGTG ATEIAHQLSI ARSTVYKILE DERAS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn1331 3006 4958-7963 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Comment:   identical to tnpA (Tn1)
Protein Sequence:  
MPVDFLTTEQ TESYGRFTGE PDELQLARYF HLDEADKEFI GKSRGDHNRL GIALQIGCVR FLGTFLTDMN HIPSGVRHFT ARQLGIRDIT VLAEYGQREN
TRREHAALIR QHYQYREFAW PWTFRLTRLL YTRSWISNER PGLLFDLATG WLMQHRIILP GATTLTRLIS EVREKATLRL WNKLALIPSA EQRSQLEMLL
GPTDCSRLSL LESLKKGPVT ISGPAFNEAI ERWKTLNDFG LHADNLSTLP AVRLKNLARY AGMTSVFNIA RMSPQKRMAV LVAFVLAWET LALDDALDVL
DAMLAVIIRD ARKIGQKKRL RSLKDLDKSA LALASACSYL LKEETPDESI RAEVFSYIPR QKLAEIITLV REIARPSDDN FHEEMVEQYG RVRRFLPHLL
NTVKFSSAPA GVTTLNACDY LSREFSSRRQ FFDDAPTEII SRSWKRLVIN KEKHITRRGY TLCFLSKLQD SLRRRDVYVT GSNRWGDPRA RLLQGADWQA
NRIKVYRSLG HPTDPQEAIK SLGHQLDSRY RQVAARLGEN EAVELDVSGP KPRLTISPLA SLDEPDSLKR LSKMISDLLP PVDLTELLLE INAHTGFADE
FFHASEASAR VDDLPVSISA VLMAEACNIG LEPLIRSNVP ALTRHRLNWT KANYLRAETI TSANARLVDF QATLPLAQIW GGGEVASADG MRFVTPVRTI
NAGPNRKYFG NNRGITWYNF VSDQYSGFHG IVIPGTLRDS IFVLEGLLEQ ETGLNPTEIM TDTAGASELV FGLFWLLGYQ FSPRLADAGA SVFWRMDHDA
DYGVLNDIAR GQSDPRKIVL QWDEMIRTAG SLKLGKVQAS VLVRSLLKSE RPSGLTQAII EVGRINKTLY LLNYIDDEDY RRRILTQLNR GESRHAVARA
ICHGQKGEIR KRYTDGQEDQ LGALGLVTNA VVLWNTIYMQ AALDHLRAQG ETLNDEDIAR LSPLCHGHIN MLGHYSFTLA ELVTKGHLRP LKEASEVENV
A

 References     

1.Espedido BA, Steen JA, Ziochos H, Grimmond SM, Cooper MA, Gosbell IB, van Hal SJ, Jensen SO. Whole genome sequence analysis of the first Australian OXA-48-producing outbreak-associated Klebsiella pneumoniae isolates: the resistome and in vivo evolution. PLoS One. 2013;8(3):e59920. doi: 10.1371/journal.pone.0059920. Epub 2013 Mar 29. PubMed ID: 23555831
2.Tolmasky ME, Crosa JH. Tn1331, a novel multiresistance transposon encoding resistance to amikacin and ampicillin in Klebsiella pneumoniae. Antimicrob Agents Chemother. 1987 Dec;31(12):1955-60. doi: 10.1128/aac.31.12.1955. PubMed ID: 2830842