Transposon
Name: Tn1000       (Synonyms: gamma-delta)
Family: Tn3        Group: Tn3
Evidence of Transposition: Yes
 Host     

Host Organism:Escherichia coli Molecular Source:plasmid F
Place of Origin:England, USA Date of Isolation:1974

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 35 bp)GGGGTTTGAGGGCCAATGGAACGAAAACGTACGTT
IRR (Length: 35 bp)GGGGTTTGAGGGCCAATGGAACGAAAACGTACGTT

 Sequence     
DNA SequenceLength  5981 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTTTGAG GGCCAATGGA ACGAAAACGT ACGTTTATGG TATAACTTAT TGATTATAAT ACAGTATACA AAGGTCCCTT TTCAGGGACC CTTTCGTATG 100
TTGTAGCTGA TTTTATTTTC TTCTTTTCTT TTGGGTGCTT TTAATAGCCA TATATGATGT TTCATATAAA GTTAAAAGTT TCCCCATCTG TCTATCTATA 200
GCGTCATGTT TTTCAGGATT TCTTAATTTC TGCAGCAGTT TAGATATATA TTTCGCAGGT AACTTTATTA TTAATGAATT ATGGGATTGA TACATTTCCT 300
TTGTCCAATC TAAATCTTTT CCTGATTTCA ATACCTCACT CTCATCTCTA TTAATTATAA AACCGAGCTT TCCATACGGA CCTGTTAAAT ATGATTGTAA 400
TTGTCTATAC TCAGATGGAC CTAATTCTTC AAAATTTTTA GCATCAAAAA CAACTTGTCT TGTTTTATAG TCCTCCAATA CTCGTTTCCA AAAATCAGAT 500
TTGCCACCAT TGGTGCCTAT AATATCTCGT CTCTGAACTG CGTTACCATT TGGATGGGAC TTGATGTCTG TTAGGTGGGA TGCAAATACT ATTCTTAGTG 600
CGTCTAAACA CCATTGTTCA AATTCAGTGG CACCTTCATT TCCTATCGGT ATCTGATCTA GATGAGTAGT TATTTGACCT ATTGTTTTAT TTCTAATGGC 700
TGAATTATCT GAAATAATAT TAATATCATA TTCGTCATTT ATCTCCTCTG CTTCCTCTGG AGCAAGTGCA TTACGATTTA GATTCAAACC AAGCCAGTAA 800
CATGGATGAA TTAATAATTT CTCATTACTT TCAAAACCTT TATCTGGAGT TCGCCCGTCA TGGCAAAATG AATAGGATGA GGTGTTTTTA TCACGAATAC 900
CAACAAATCC TACACTATAC AAACTTTGGA GAATTCCACT TGCCTTTAAC AACTGTATTT CAGACGTTAT TTTAGGATCT CCATTTTCTT CGATTAATTC 1000
GAAAGATGCT TCTATTTTTT TTAAGCACGT ATAAACTGTT AATTCAGGTT CAATGCTACG AAATGCACTA GTTATAACCT GTATTGAAGG AAAGATCTTC 1100
TGATACTCTT TCCAGAGATC TTCAAGTCTG GCCATGGAAA TTGACTTGGC TGCATATTCT AGGTCAGTGT TTATGATAGT TTCTCTATTC TCTCTGAATG 1200
CGGAAAAAAA AGCTTCATTC AACAATGATA GTAAATCCCT GGGCCGGTAA AGGGTAAATT GCAAACATCG CTTAAAACCA TTCCTCCCTT TAAGATCATC 1300
CGCTGTGCAT CTATCCCAAA CTCGTTGATC TTTCTCAATA TCTAGCTTAA ATGCTACTTT CATTCTTTTA GCTGACAGCA TTAGGAGTTG TGCCCAGTCC 1400
CAATGCAACC TTATGACTTG ACCCTCTATA TTTCTCGAGT AATCAGGATC TTCCTTTGAT AGCGACCTAA ATATATTATC CCTTAAAAAA ATTATTGGAC 1500
GAATGCATTT TGCTTTTTGA TTTAATTCAA TAGATGCATA TGCTAGACCT GCAATGATTC CAATTCCTAT ATTATCCGGT TCATACGCCT CATCTAGCTT 1600
ATCCATTAAT ATGACAACTT TCCTGTCTGA GCGTTCAAGA AGTGATACTA TATTATTTTC TATTTCTGAG ATATTCAAAT TGAATTGAAG ATCACCAATT 1700
GATTCTTCTG GGTTATTTTC ATCTAAATAC TCCTTTGCGA CAAGCCTACA CTTTCTTAAA ATGTCACCTT GTGCAGAATT CCATTTTTTC AAATGTTCAT 1800
TCAACAATGT TTCTGATGAT ATTTGAGATG ACAATTTGTA ATGAGATGAT ATATATGATG CTATCTCCAT TAGCATAGCG TATCGCCATA ATAGTCTTGT 1900
TGCTGCCCTT GCTAAATTAA ATGATCCTGT AAATGGTTTC AACATTGATC TGAAACCAAT AATTTGAGAA TCGTCTGGTG AGAAACTCAG GATTAATATT 2000
TTTTTGTCTT TCTTCCAATG CTCATTTAGC TGAATAAATA AAGCACTTTT ACCTGTCCCT CGTCTACCAA CAACAATGGT CCTGTCATCA GTTTCAATTA 2100
GAGTCCTAAA GTCAGCAGTT TCAATGAAAG CATTACTCAA CATCTTTTTA TCATTTTCTG CTGTCGTATC ACCAAACGGA TTAGACTTTG AAGTAATATT 2200
CAATTCCATA TTCAACCTTT TATGTTAGTT GCTTTCATTT ATTACTTTAT ATACTGTTGA ACGAGCAATA TTCATTGTTT TTGATATATG TGAGGCACCT 2300
AACCCCTGTT GCCACATATT TAATACTGCA TCTCTATCTA TTTTTCTTTT TCTACCAAAA ACAACTCCTT TTGCCATTGC CTCTTGGCGA CCTTCATTGG 2400
TACGCTCTAG TATTCTCTGT CGTTCTGCCT GGGCCACTGC AGATAGAATA GTGACAACCA TTTTACCCAT CTCCCCATCG GTACTGATTC CGTCATCAAT 2500
AAACCGAATG GATACACCTT GGGCGTCAAA CTCTTTTATT AACTGGATCA TGTCAGCAGT ATCGCGCCCA AGGCGGTCAA GTTTCTTCAC CAAGATGACG 2600
TCACCTTCCT CCACCTTCAT CCTCAGCAAG TCCAGCCCTT TCCGATCGCT TGAACTGCCC GATGCCTTGT CAGTAAAGAT GCGATTTGCT TTCACGCCTG 2700
CGTCTTTGAG TGCCCGAACC TGAATATCGA GAGATTGCTG GCTGGTTGAT ACCCGTGCGT AACCAAAAAG TCGCATAAAA ATGTATCCTA AATCAAATAT 2800
CGGACAAGCA GTGTCTGTTA TAACAAAAAA TCGATTTAAT AGACACATTA ACAGCACTGT TTTTATGTGT GCGATAATTT ATAATATTTC GGACGGTTGC 2900
AAAATTGTTA ATGAATAACT GTCAGGTAGG GAGCCTGATA TGCCTGTCGA CTTTCTAACC TCTGACCAAA AACAGAATTA CGGTTGTTAT GCTGCAGAAC 3000
CTAATGACGT GCAACTGGCG CGCTATTTTC ATCTTGATGA ACGGGATCTG GCCTTCATTA ACCAACGACG GGGCAAACAT AATAGGCTGG GCATTGCGCT 3100
TCAGCTCACC ACAGCCCGTT TTCTGGGAAC ATTTCTGACG GATTTAACTC AGGTTCTGCC TGGTGTTCAA CATTTTGTCG CGGTACAGCT TAATATCCAC 3200
CGTCCAGAAG TTCTCTCCCG CTATGCTGAA CGGGACACTA CCCTTAGAGA ACATACTGCA TTAATTAAGG AATATTACGG CTATCATGAA TTTGGTGATT 3300
TTCCATGGTC TTTCCGCCTG AAGCGTCTGC TATATACCCG GGCGTGGCTC AGTAATGAGC GACCGGGTCT GATGTTTGAT TTTGCCACTG CATGGTTGCT 3400
TCAAAATAAG GTATTACTGC CCGGAGCAAC CACACTAGTA CGTCTCATCA GTGAAATTCG TGAAAGGGCA AATCAGCGGC TGTGGAAAAA GCTGGCCGCA 3500
CTGCCGAACA AATGGCAGGC AGCTCAAGTG ATGGAGCTTC TGGTCATTCC GGAAGGTCAG CGTGTATCAG CACTGGAACA GTTGAAAAAA GGCCCTGTTA 3600
CAGTCAGTGG ACCTGCGTTT AATGAAGCGC TGGAACGATA TATCCGATTA CGAAGTCTTG AGTTTTCCCG ACTGAACTTT TCCGGTCTGC CTGCCATTCA 3700
ACTGCGTAAT CTGGCTCGTT ATGCTGGCAT GGCGTCGGTA AAATATATCG CTCGAATGCC ACAGCAGAGA AAGCTTGCTG TACTTACTGC ATTCGTTAAA 3800
GCACAGGAAA TAACGGCATT AGACGATGCC GTTGATGTGC TTGATATGCT AATTCTGGAC ATTATCCGCG AAGCAAAGAA AACCGGGCAA AAAAAAAGAC 3900
TCAGGACACT GAAAGATCTT GATCAGGCCG CATTGTTACT GGCGCGGGCA TGTGCATTGT TGCTGGATGA TAATACAGAT GTCCCAGATC TCAGGCAGGT 4000
TATCTTCAAG TGCGTACCCA AAAACAGACT GGCAGAATCT GTAAGCAAGG TTAATGAACT TGCTCGTCCA CAGAACAATA ATTTCCATGA CGAAATGGTT 4100
GAGCAGTACG GTCGGGTTAA ACGTTTTCTT CCGGCGGTGT TGCGGGACCT GCATTTCCGT GCGGCACCGG CAGGTGAACA TGTACTGGCT GCGATTCATT 4200
ATCTGGCAGA ACTGAATGGT TCGAAAAAGC GCATCCTTGA TGATGCGCCT GAACATATTA TCACCGGTCC CTGGAAACGC CTCGTATACG ATGCGGAGGG 4300
ACGGATACAG CGTGCAGGTT ATTCACTATG TTTGCTGGAA CGCCTTCAGG ATGCACTGCG CCGCCGGGAC ATCTGGCTTG AAAACAGTGA TCGCTGGGGA 4400
GATCCTCGCG AGAAGTTGTT GCAAGGTGAA GAGTGGCAGA CTCAGCGTAT TCCTGTCTGT CGGGCACTGG GACATCCTGT CGATGGACGT AAAGGTGTGC 4500
AACAACTGGC TATTCAGCTG GATGAGACCT GGAAAGCCGT GGCATCACGA TTTGAAAAGA ATGCGGAAGT TCATATCTGT AATGAAGGTA AATATCCATC 4600
CCTGACTATC AGTTGTCTGG AGAAACAGGA AGAGCCACCA TCATTGCTTC GTCTAAATAA TCGGATCAAA CAGCTACTCC CACCGGTAGA TTTAACGGAA 4700
CTGTTACTTG AGATAGATGC CCAGACAGGA TTTACACATG AGTTTGCGCA TGTCAGTGAA TCTGGTGCTC GAGCGCAAGA TTTGCACATC AGTTTATGTG 4800
CGGTATTGAT GGCTGAAGCC TGTAATATCG GACTGGAACC GCTGATAAAG CACAATATAC CAGCACTGAC CCGCCATCGG CTCAGTTGGG TGAAACAGAA 4900
TTACCTTCGT GCAGAAACGC TGGTCAGCGC CAATGCCCGC CTGGTTGATT TTCAGTCCAC ACTGGAGCTT GCTGGTCGTT GGGGAGGTGG AGAAGTGGCA 5000
TCAGCTGACG GCATGCGCTT TGTCACACCA GTGAAGACCA TCAACTCAGG ATCTAACAGA AAATATTTTG GTTCTGGACG AGGCATCACC TGGTATAACT 5100
TCGTATCTGA TCAGTACTCT GGGTTCCATG GCATTGTGGT ACCCGGTACA TTACGGGATT CGATTTTTGT ACTGGAAGGA CTTCTTGAGC AGCAGACAGG 5200
GCTGAATCCA GTTGAAATCA TGACAGACAC TGCGGGTAGC AGCGATATTA TTTTCGGTCT GTTCTGGCTA CTGGGGTATC AGTTTTCCCC CCGGCTTGCC 5300
GATGCAGGTG AGGCGGTGTT CTGGCGGGTG AATAAATCGG CAAACTACGG AGTACTGGAT AAGTTGGCCC GAGGATATGC AGATCTGTCA AAAGCGGAGA 5400
GTCAGTGGGA TGAGATGATG CGAACCGCTG GTTCGCTGAA GTTGGGTACA ATTCATGCGT CAGAACTCAT TCGCTCTTTA CTGAAAAGCT CGCGCCCATC 5500
AGGACTGGCA CAGGCAATTA TGGAAGTAGG GCGTGTAAAC AAAACGCTAT ATCTCCTCAA TTATATTGAT GATGAAGATT ATCGTCGGCG GATCCTGACG 5600
CAGCTTAATC GAGGAGAAGG CCGCCACGCT GTGGCTCGTG CGATTTGTTA CGGACAACGC GGAGAGATCA GAAAGCGTTA TCGTGAAGGG CAGGAAGATC 5700
AACTGGGGGC GCTGGGCCTG GTTACTAATG CAGTGGTTCT GTGGAACACG CTCTATATGG AGGAAGCGTT GAGCTGGATG CGCCGTAATG GCGAAGAAAT 5800
TATAGATGAA GATATCGCTC GGCTATCTCC CCTGATGCAC GGGCATATCA ATATGTTGGG CCATTATACA TTCACGTTGC CAGAGGATAT TTTAAAAGGG 5900
GAACTGAGAG CTCTAAATTT AAATATAAAC AACGAATTAT CTCCTTAACG TACGTTTTCG TTCCATTGGC CCTCAAACCC C

 Recombination Sites     

Name Coordinates Gene Sequence
res 2774-2905 132 CATAAAAATG TATCCTAAAT CAAATATCGG ACAAGCAGTG TCTGTTATAA CAAAAAATCG
ATTTAATAGA CACATTAACA GCACTGTTTT TATGTGTGCG ATAATTTATA ATATTTCGGA
CGGTTGCAAA AT
res_site_III 2782-2806 25 TGTATCCTAA ATCAAATATC GGACA
res_site_II 2812-2845 34 TGTCTGTTAT AACAAAAAAT CGATTTAATA GACA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
hypX Tn1000 113-2209 Passenger Gene Other -
tnpR Tn1000 2225-2776 Accessory Gene Resolvase -
tnpA Tn1000 2940-5948 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
hypX HypX Tn1000 2097 113-2209 -
Class:   Passenger Gene
Sub Class:   Other
Function:   unknown
Protein Sequence:  
MELNITSKSN PFGDTTAEND KKMLSNAFIE TADFRTLIET DDRTIVVGRR GTGKSALFIQ LNEHWKKDKK ILILSFSPDD SQIIGFRSML KPFTGSFNLA
RAATRLLWRY AMLMEIASYI SSHYKLSSQI SSETLLNEHL KKWNSAQGDI LRKCRLVAKE YLDENNPEES IGDLQFNLNI SEIENNIVSL LERSDRKVVI
LMDKLDEAYE PDNIGIGIIA GLAYASIELN QKAKCIRPII FLRDNIFRSL SKEDPDYSRN IEGQVIRLHW DWAQLLMLSA KRMKVAFKLD IEKDQRVWDR
CTADDLKGRN GFKRCLQFTL YRPRDLLSLL NEAFFSAFRE NRETIINTDL EYAAKSISMA RLEDLWKEYQ KIFPSIQVIT SAFRSIEPEL TVYTCLKKIE
ASFELIEENG DPKITSEIQL LKASGILQSL YSVGFVGIRD KNTSSYSFCH DGRTPDKGFE SNEKLLIHPC YWLGLNLNRN ALAPEEAEEI NDEYDINIIS
DNSAIRNKTI GQITTHLDQI PIGNEGATEF EQWCLDALRI VFASHLTDIK SHPNGNAVQR RDIIGTNGGK SDFWKRVLED YKTRQVVFDA KNFEELGPSE
YRQLQSYLTG PYGKLGFIIN RDESEVLKSG KDLDWTKEMY QSHNSLIIKL PAKYISKLLQ KLRNPEKHDA IDRQMGKLLT LYETSYMAIK STQKKRRK

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn1000 552 2225-2776 -
Class:   Accessory Gene
Sub Class:   Resolvase
Function:   resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MRLFGYARVS TSQQSLDIQV RALKDAGVKA NRIFTDKASG SSSDRKGLDL LRMKVEEGDV ILVKKLDRLG RDTADMIQLI KEFDAQGVSI RFIDDGISTD
GEMGKMVVTI LSAVAQAERQ RILERTNEGR QEAMAKGVVF GRKRKIDRDA VLNMWQQGLG ASHISKTMNI ARSTVYKVIN ESN

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn1000 3009 2940-5948 +
Class:   Transposase
Function:   transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MPVDFLTSDQ KQNYGCYAAE PNDVQLARYF HLDERDLAFI NQRRGKHNRL GIALQLTTAR FLGTFLTDLT QVLPGVQHFV AVQLNIHRPE VLSRYAERDT
TLREHTALIK EYYGYHEFGD FPWSFRLKRL LYTRAWLSNE RPGLMFDFAT AWLLQNKVLL PGATTLVRLI SEIRERANQR LWKKLAALPN KWQAAQVMEL
LVIPEGQRVS ALEQLKKGPV TVSGPAFNEA LERYIRLRSL EFSRLNFSGL PAIQLRNLAR YAGMASVKYI ARMPQQRKLA VLTAFVKAQE ITALDDAVDV
LDMLILDIIR EAKKTGQKKR LRTLKDLDQA ALLLARACAL LLDDNTDVPD LRQVIFKCVP KNRLAESVSK VNELARPQNN NFHDEMVEQY GRVKRFLPAV
LRDLHFRAAP AGEHVLAAIH YLAELNGSKK RILDDAPEHI ITGPWKRLVY DAEGRIQRAG YSLCLLERLQ DALRRRDIWL ENSDRWGDPR EKLLQGEEWQ
TQRIPVCRAL GHPVDGRKGV QQLAIQLDET WKAVASRFEK NAEVHICNEG KYPSLTISCL EKQEEPPSLL RLNNRIKQLL PPVDLTELLL EIDAQTGFTH
EFAHVSESGA RAQDLHISLC AVLMAEACNI GLEPLIKHNI PALTRHRLSW VKQNYLRAET LVSANARLVD FQSTLELAGR WGGGEVASAD GMRFVTPVKT
INSGSNRKYF GSGRGITWYN FVSDQYSGFH GIVVPGTLRD SIFVLEGLLE QQTGLNPVEI MTDTAGSSDI IFGLFWLLGY QFSPRLADAG EAVFWRVNKS
ANYGVLDKLA RGYADLSKAE SQWDEMMRTA GSLKLGTIHA SELIRSLLKS SRPSGLAQAI MEVGRVNKTL YLLNYIDDED YRRRILTQLN RGEGRHAVAR
AICYGQRGEI RKRYREGQED QLGALGLVTN AVVLWNTLYM EEALSWMRRN GEEIIDEDIA RLSPLMHGHI NMLGHYTFTL PEDILKGELR ALNLNINNEL
SP

 References     

1.Lee HJ, Otsubo E, Deonier RC, Davidson N. Electron microscope heteroduplex studies of sequence relations among plasmids of Escherichia coli. V. ilv+ Deletion mutants of F14. J Mol Biol. 1974 Nov 15;89(4):585-97. PubMed ID: 4615160
2.Guyer MS. The gamma delta sequence of F is an insertion sequence. J Mol Biol. 1978 Dec 15;126(3):347-65. doi: 10.1016/0022-2836(78)90045-1. PubMed ID: 745233
3.Reed RR, Young RA, Steitz JA, Grindley ND, Guyer MS. Transposition of the Escherichia coli insertion element gamma generates a five-base-pair repeat. Proc Natl Acad Sci U S A. 1979 Oct;76(10):4882-6. doi: 10.1073/pnas.76.10.4882. PubMed ID: 388421
4.Wiater LA, Grindley ND. Gamma delta transposase and integration host factor bind cooperatively at both ends of gamma delta. EMBO J. 1988 Jun;7(6):1907-11. PubMed ID: 2844529
5.Broom JE, Hill DF, Hughes G, Jones WA, McNaughton JC, Stockwell PA, Petersen GB. Sequence of a transposon identified as Tn1000 (gamma delta). DNA Seq. 1995;5(3):185-9. doi: 10.3109/10425179509029361. PubMed ID: 7612932
6.Wiater LA, Grindley ND. Uncoupling of transpositional immunity from gamma delta transposition by a mutation at the end of gamma delta. J Bacteriol. 1990 Sep;172(9):4959-63. doi: 10.1128/jb.172.9.4959-4963.1990. PubMed ID: 2168371
7.Wiater LA, Grindley ND. Integration host factor increases the transpositional immunity conferred by gamma delta ends. J Bacteriol. 1990 Sep;172(9):4951-8. doi: 10.1128/jb.172.9.4951-4958.1990. PubMed ID: 2168370
8.Salvo JJ, Grindley ND. The gamma delta resolvase bends the res site into a recombinogenic complex. EMBO J. 1988 Nov;7(11):3609-16. PubMed ID: 2850169
9.Wiater LA, Grindley ND. Gamma delta transposase. Purification and analysis of its interaction with a transposon end. J Biol Chem. 1991 Jan 25;266(3):1841-9. PubMed ID: 1846366
10.Reed RR, Grindley ND. Transposon-mediated site-specific recombination in vitro: DNA cleavage and protein-DNA linkage at the recombination site. Cell. 1981 Sep;25(3):721-8. doi: 10.1016/0092-8674(81)90179-3. PubMed ID: 6269756
11.Wells RG, Grindley ND. Analysis of the gamma delta res site. Sites required for site-specific recombination and gene expression. J Mol Biol. 1984 Nov 15;179(4):667-87. PubMed ID: 6094833