Transposon
Name: Tn1
Family: Tn3        Group: Tn3
Evidence of Transposition: yes
 Host     

Host Organism:Pseudomonas aeruginosa Molecular Source:RP4
Other Geographic Information:;host

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG
IRR (Length: 38 bp)GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG

 Sequence     
DNA SequenceLength  4949 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
GGGGTCTGAC GCTCAGTGGA ACGAAAACTC ACGTTAAGGG ATTTTGGTCA TGAGATTATC AAAAAGGATC TTCACCTAGA TCCTTTTAAA TTAAAAATGA 100
AGTTTTAAAT CAATCTAAAG TATATATGAG TAAACTTGGT CTGACAGTTA CCAATGCTTA ATCAGTGAGG CACCTATCTC AGCGATCTGT CTATTTCGTT 200
CATCCATAGT TGCCTGACTC CCCGTCGTGT AGATAACTAC GATACGGGAG GGCTTACCAT CTGGCCCCAG TGCTGCAATG ATACCGCGAG ATCCACGCTC 300
ACCGGCTCCA GATTTATCAG CAATAAACCA GCCAGCCGGA AGGGCCGAGC GCAGAAGTGG TCCTGCAACT TTATCCGCCT CCATCCAGTC TATTAATTGT 400
TGCCGGGAAG CTAGAGTAAG TAGTTCGCCA GTTAATAGTT TGCGCAACGT TGTTGCCATT GCTGCAGGCA TCGTGGTGTC ACGCTCGTCG TTTGGTATGG 500
CTTCATTCAG CTCCGGTTCC CAACGATCAA GGCGGGTTAC ATGATCCCCC ATGTTGTGCA AAAAAGCGGT TAGCTCCTTC GGTCCTCCGA TCGTTGTCAG 600
AAGTAAGTTG GCCGCAGTGT TATCACTCAT GGTTATGGCA GCACTGCATA ATTCTCTTAC TGTCATGCCA TCCGTAAGAT GCTTTTCTGT GACTGGTGAG 700
TACTCAACCA AGTCATTCTG AGAATAGTGT ATGCGGCGAC CGAGTTGCTC TTGCCCGGCG TCAACACGGG ATAATACCGC ACCACATAGC AGAACTTTAA 800
AAGTGCTCAT CATTGGAAAA CGTTCTTCGG GGCGAAAACT CTCAAGGATC TTACCGCTGT TGAGATCCAG CTCGATGTAA CCCACTCGTG CACCCAACTT 900
ATCTTCAGCA TCTTTTACTT TCACCAGCGT TTCTGGGTGA GCAAAAACAG GAAGGCAAAA TGCCGCAAAA AAGGGAATAA GGGCGACACG GAAATGTTGA 1000
ATACTCATAC TCTTCCTTTT TCAATATTAT TGAAGCATTT ATCAGGGTTA TTGTCTCATG AGCGGATACA TATTTGAATG TATTTAGAAA AATAAACAAA 1100
TAGGGGTTCC GCGCACATTT CCCCGAAAAG TGCCACCTGA CGTCTAAGAA ACCATTATTA TCATGACATT AACCTATAAA AATAAGCGTA TCACGAGGCC 1200
CTTTCGTCTT CAAGAATTTT ATAAACCGTG GAGCGGGCAA TACTGAGCTG ATGAGCAATT TCCGTTGCAC CAGTGCCCTT CTGATGAAGC GTCAGCACGA 1300
CGTTCCTGTC CACGGTACGC CTGCGGCCAA ATTTGATTCC TTTCAGCTTT GCTTCCTGTC GGCCCTCATT CGTGCGCTCT AGGATCCTCC GGCGTTCAGC 1400
TTGTGCCACA GCCGACAGGA TGGTGACCAC CATTTGCCCC ATATCACCGT CGGTACTGAT CCCGTCGTCA ATAAACCGAA CCGCGACACC CTGAGCATCA 1500
AACTCTTTTA TCAGTTGGAT CATGTCGGCG GTGTCGCGGC CAAGACGGTC GAGCTTCTTC ACCAGAATGA CATCACCTTC CTCCACCTTC ATCCTCAGCA 1600
AATCCAGCCC TTCCCGATCT GTTGAACTGC CGGATGCCTT GTCGGTAAAG ATGCGGTTAG CTTTTACCCC TGCATCTTTG AGCGCTCTGA TCTGAATATC 1700
GAGGGACTGC TGGCTGGTTG AGACCCGCGC ATAACCAAAA ATTCGCATAA AATGTACCTT AAATCGAATA TCAGACACGA TGTGTCTATT ATGCCAAAAT 1800
GACGATTTAA TGGACACTCA AACGAAGCCG TTTTACTATG TCTGATAATT TATAACATTT CGGACGGTTG CAAAAATGTT ACTAAATGCC CGTCAGGCAG 1900
GGAGGCCGAT ATGCCCGTTG ACTTTCTGAC CACTGAGCAG ACTGAAAGCT ATGGCAGATT CACCGGTGAA CCGGATGAGC TTCAGCTGGC ACGATATTTT 2000
CATCTTGATG AAGCAGACAA GGAATTTATC GGAAAAAGCA GAGGTGATCA CAACCGTCTG GGCATTGCCC TGCAAATTGG ATGTGTCCGT TTTCTGGGCA 2100
CCTTCCTCAC CGATATGAAT CATATTCCTT CCGGCGTCCG GCATTTTACC GCCAGACAGC TCGGGATTCG TGATATCACC GTTCTTGCAG AATACGGTCA 2200
GAGGGAAAAT ACCCGCCGTG AGCATGCAGC GCTGATACGT CAGCACTATC AGTATCGTGA ATTTGCCTGG CCCTGGACAT TTCGCCTTAC CCGTCTTTTA 2300
TATACCCGGA GCTGGATAAG CAACGAACGT CCTGGCCTGC TTTTCGATCT GGCGACAGGG TGGCTTATGC AACATCGTAT TATTCTCCCC GGAGCCACTA 2400
CGCTGACCCG GTTGATTTCA GAGGTAAGGG AAAAGGCGAC GTTGCGCCTG TGGAACAAAC TGGCACTGAT ACCGTCAGCC GAACAACGTT CACAGCTGGA 2500
GATGCTGCTG GGGCCAACTG ATTGCAGCCG CCTGTCTTTA CTGGAATCAC TGAAAAAAGG CCCTGTGACC ATCAGTGGTC CGGCGTTTAA TGAAGCAATT 2600
GAACGCTGGA AAACTCTGAA CGATTTTGGC TTGCATGCTG ACAACCTGAG TACACTCCCG GCTGTGCGCC TGAAAAATCT CGCACGTTAT GCTGGTATGA 2700
CTTCGGTGTT CAATATTGCC AGGATGTCAC CGCAGAAAAG GATGGCGGTT CTGGTTGCCT TTGTCCTTGC ATGGGAAACG CTGGCGTTGG ATGATGCACT 2800
GGACGTTCTG GACGCCATGC TGGCCGTTAT CATCCGTGAC GCCAGAAAGA TTGGGCAGAA AAAACGGCTC CGCTCGCTGA AGGATCTGGA TAAATCTGCA 2900
TTGGCGCTCG CCAGCGCATG TTCGTACCTG CTGAAAGAAG AAACACCGGA CGAATCGATT CGTGCTGAGG TGTTCAGCTA CATCCCCAGG CAAAAGCTGG 3000
CTGAAATCAT CACGCTTGTC CGTGAAATTG CCCGGCCCTC AGACGATAAT TTTCATGAAG AAATGGTGGA GCAGTACGGG CGCGTTCGTC GTTTCCTGCC 3100
CCATCTGCTG AATACCGTTA AATTTTCATC CGCACCTGCC GGGGTTACCA CTCTGAATGC CTGTGACTAC CTCAGCCGGG AGTTCAGCTC ACGGCGGCAG 3200
TTTTTTGACG ACGCACCAAC GGAAATTATC AGTCGGTCAT GGAAACGGCT GGTGATTAAC AAGGAAAAAC ATATCACCCG CAGGGGATAC ACGCTCTGCT 3300
TTCTCAGTAA ACTGCAGGAT AGTCTGAGGC GGAGGGATGT CTACGTTACC GGCAGTAACC GGTGGGGAGA TCCCCGAGCA AGATTACTAC AGGGTGCTGA 3400
CTGGCAGGCA AACCGGATTA AGGTTTATCG TTCTCTGGGA CACCCGACAG ACCCGCAGGA AGCAATAAAA TCTCTGGGTC ATCAGCTTGA TAGTCGTTAC 3500
AGACAGGTTG CTGCACGTCT TGGCGAAAAT GAGGCTGTCG AACTCGATGT TTCTGGCCCG AAGCCCCGGT TGACAATTTC TCCCCTCGCC AGTCTTGATG 3600
AGCCGGACAG TCTGAAACGA CTGAGCAAAA TGATCAGTGA TCTGCTCCCT CCGGTGGATT TAACGGAGTT GCTGCTCGAA ATTAACGCCC ATACCGGATT 3700
TGCTGATGAG TTTTTCCATG CTAGTGAAGC CAGTGCCAGA GTTGATGATC TGCCCGTCAG CATCAGCGCC GTGCTGATGG CTGAAGCCTG CAATATCGGT 3800
CTGGAACCAC TGATCAGATC AAATGTTCCT GCACTGACCC GACACCGGCT GAACTGGACA AAAGCGAACT ATCTGCGGGC TGAAACTATC ACCAGCGCTA 3900
ATGCCAGACT GGTTGATTTT CAGGCAACGC TGCCACTGGC ACAGATATGG GGTGGCGGAG AAGTGGCATC TGCAGATGGA ATGCGCTTTG TTACGCCAGT 4000
CAGAACAATC AATGCCGGAC CGAACCGCAA ATACTTTGGT AATAACAGAG GGATCACCTG GTACAACTTT GTGTCCGATC AGTATTCCGG CTTTCATGGC 4100
ATCGTTATAC CGGGGACGCT GAGGGACTCT ATCTTTGTGC TGGAAGGCCT TCTGGAACAG GAGACCGGGC TGAATCCAAC CGAAATTATG ACCGATACAG 4200
CAGGTACCAG CGAACTTGTC TTTGGCCTTT TCTGGCTGCT GGGATACCAG TTTTCTCCAC GCCTGGCTGA TGCCGGTGCT TCGGTTTTCT GGCGAATGGG 4300
CCATGATGCC AACTATGGCG TGCTGAATGA TATTGCCAGA GGGCAATCAG ATCCCCGAAA AATAGTCCTT CAGTGGGACG AAATGATCCG GACCGCTGGC 4400
TCCCTGAAAC TGGGCAAAGT ACAGGCTTCA GTGCTGGTCC GTTCATTGCT GAAAAGTGAA CGTCCTTCCG GACTGACTCA GGCAATCATT GAAGTGGGGC 4500
GCATCAACAA AACGCTGTAT CTGCTTAATT ATATTGATGA TGAAGATTAC CGCCGGCGCA TTCTGACCCA GCTTAATCGG GGAGAAAGCC GCCATGCCGT 4600
TGCCAGAGCC ATCTGTCACG GTCAAAAAGG TGAGATAAGA AAACGATATA CCGACGGTCA GGAAGATCAA CTGGGCGCAC TGGGGCTGGT CACTAACGCC 4700
GTCGTGTTAT GGAACACTAT GTATATGCAG GCAGCCCTGG ATCATCTCCG GGCGCAAGGT GAAACACTGA ATGATGAAGA TATCGCACGC CTCTCCCCGC 4800
TTTGCCACGG ACATATCAAT ATGCTCGGCC ATTATTCCTT CACGCTGGCA GAACTGGTGA CCAAAGGACA TCTGAGACCA TTAAAAGAGG CGTCAGAGGT 4900
AGAAAACGTT GCTTAACGTG AGTTTTCGTT CCACTGAGCG TCAGACCCC

 Recombination Sites     

Name Coordinates Gene Sequence
res 1750-1870 121 AAATGTACCT TAAATCGAAT ATCAGACACG ATGTGTCTAT TATGCCAAAA TGACGATTTA
ATGGACACTC AAACGAAGCC GTTTTACTAT GTCTGATAAT TTATAACATT TCGGACGGTT
G
res_site_III 1753-1775 23 TGTACCTTAA ATCGAATATC AGA
res_site_II 1781-1816 36 TGTGTCTATT ATGCCAAAAT GACGATTTAA TGGACA
res_site_I 1839-1867 29 TGTCTGATAA TTTATAACAT TTCGGACGG

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
bla TEM-2 (ARO:3000874) Tn1 148-1008 Passenger Gene Antibiotic Resistance -
tnpR Tn1 1191-1748 Accessory Gene Resolvase -
tnpA Tn1 1911-4916 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
bla TEM-2 (ARO:3000874) Bla TEM-2 Tn1 861 148-1008 -
Class:   Passenger Gene
Sub Class:   Antibiotic Resistance
Function:   antibiotic inactivation (ARO:0001004)
Target:   monobactam (ARO:0000004)||penem (ARO:3003706)||cephalosporin (ARO:0000032)||penam (ARO:3000008)
Sequence Family:  TEM beta-lactamase (ARO:3000014)
Comment:   perfect match to reference sequence for ARO:3000874||Synonyms:
Protein Sequence:  
MSIQHFRVAL IPFFAAFCLP VFAHPETLVK VKDAEDKLGA RVGYIELDLN SGKILESFRP EERFPMMSTF KVLLCGAVLS RVDAGQEQLG RRIHYSQNDL
VEYSPVTEKH LTDGMTVREL CSAAITMSDN TAANLLLTTI GGPKELTAFL HNMGDHVTRL DRWEPELNEA IPNDERDTTM PAAMATTLRK LLTGELLTLA
SRQQLIDWME ADKVAGPLLR SALPAGWFIA DKSGAGERGS RGIIAALGPD GKPSRIVVIY TTGSQATMDE RNRQIAEIGA SLIKHW

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpR TnpR Tn1 558 1191-1748 -
Class:   Accessory Gene
Sub Class:   Resolvase
Transpoase Chemistry:   Serine
Sequence Family:  Serine Site-Specific Recombinase
Protein Sequence:  
MRIFGYARVS TSQQSLDIQI RALKDAGVKA NRIFTDKASG SSTDREGLDL LRMKVEEGDV ILVKKLDRLG RDTADMIQLI KEFDAQGVAV RFIDDGISTD
GDMGQMVVTI LSAVAQAERR RILERTNEGR QEAKLKGIKF GRRRTVDRNV VLTLHQKGTG ATEIAHQLSI ARSTVYKILE DERAS

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
tnpA TnpA Tn1 3006 1911-4916 +
Class:   Transposase
Function:   transposase activity (GO:0004803)
Transpoase Chemistry:   DDE
Protein Sequence:  
MPVDFLTTEQ TESYGRFTGE PDELQLARYF HLDEADKEFI GKSRGDHNRL GIALQIGCVR FLGTFLTDMN HIPSGVRHFT ARQLGIRDIT VLAEYGQREN
TRREHAALIR QHYQYREFAW PWTFRLTRLL YTRSWISNER PGLLFDLATG WLMQHRIILP GATTLTRLIS EVREKATLRL WNKLALIPSA EQRSQLEMLL
GPTDCSRLSL LESLKKGPVT ISGPAFNEAI ERWKTLNDFG LHADNLSTLP AVRLKNLARY AGMTSVFNIA RMSPQKRMAV LVAFVLAWET LALDDALDVL
DAMLAVIIRD ARKIGQKKRL RSLKDLDKSA LALASACSYL LKEETPDESI RAEVFSYIPR QKLAEIITLV REIARPSDDN FHEEMVEQYG RVRRFLPHLL
NTVKFSSAPA GVTTLNACDY LSREFSSRRQ FFDDAPTEII SRSWKRLVIN KEKHITRRGY TLCFLSKLQD SLRRRDVYVT GSNRWGDPRA RLLQGADWQA
NRIKVYRSLG HPTDPQEAIK SLGHQLDSRY RQVAARLGEN EAVELDVSGP KPRLTISPLA SLDEPDSLKR LSKMISDLLP PVDLTELLLE INAHTGFADE
FFHASEASAR VDDLPVSISA VLMAEACNIG LEPLIRSNVP ALTRHRLNWT KANYLRAETI TSANARLVDF QATLPLAQIW GGGEVASADG MRFVTPVRTI
NAGPNRKYFG NNRGITWYNF VSDQYSGFHG IVIPGTLRDS IFVLEGLLEQ ETGLNPTEIM TDTAGTSELV FGLFWLLGYQ FSPRLADAGA SVFWRMGHDA
NYGVLNDIAR GQSDPRKIVL QWDEMIRTAG SLKLGKVQAS VLVRSLLKSE RPSGLTQAII EVGRINKTLY LLNYIDDEDY RRRILTQLNR GESRHAVARA
ICHGQKGEIR KRYTDGQEDQ LGALGLVTNA VVLWNTMYMQ AALDHLRAQG ETLNDEDIAR LSPLCHGHIN MLGHYSFTLA ELVTKGHLRP LKEASEVENV
A

 References     

1.Haines AS, Jones K, Batt SM, Kosheleva IA, Thomas CM. Sequence of plasmid pBS228 and reconstruction of the IncP-1alpha phylogeny. Plasmid. 2007 Jul;58(1):76-83. doi: 10.1016/j.plasmid.2007.01.001. Epub 2007 Feb 23. PubMed ID: 17320955
2.Hedges RW, Jacob AE. Transposition of ampicillin resistance from RP4 to other replicons. Mol Gen Genet. 1974;132(1):31-40. doi: 10.1007/BF00268228. PubMed ID: 4609125